ID: 945278617

View in Genome Browser
Species Human (GRCh38)
Location 2:208013968-208013990
Sequence GAGCCTAGGTCTTTGTTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 68}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945278616_945278617 -10 Left 945278616 2:208013955-208013977 CCTGCTAAAAAGTGAGCCTAGGT 0: 1
1: 0
2: 1
3: 6
4: 106
Right 945278617 2:208013968-208013990 GAGCCTAGGTCTTTGTTAACTGG 0: 1
1: 0
2: 0
3: 6
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945278617 Original CRISPR GAGCCTAGGTCTTTGTTAAC TGG Intronic
901455868 1:9362354-9362376 GAGCCTTTGTCCTTGTCAACTGG - Intronic
903037576 1:20503546-20503568 GAGTATAGGTTTTGGTTAACTGG - Intronic
916265099 1:162882586-162882608 GAGCTTTGGTCTTTGTGCACTGG - Intergenic
917694140 1:177502773-177502795 GAGTGTAGGTCTTTGTTATGGGG - Intergenic
921329952 1:214025530-214025552 GAGCCTATGTATTTATTACCTGG + Intronic
922511547 1:226172242-226172264 AAGCCTACGTTTTTGTTCACAGG + Intronic
924910097 1:248500725-248500747 GAGGCTCGGTCTTTGTGTACTGG + Intergenic
924914005 1:248547322-248547344 GAGGCTCGGTCTTTGTGTACTGG - Intergenic
1068584742 10:58784204-58784226 GAGCCAAGTTCTTTGTGGACAGG + Intronic
1068702580 10:60035660-60035682 AAGCCAAGGCTTTTGTTAACAGG + Intronic
1070941239 10:80349884-80349906 AAGCCTAGTTTTTTGTGAACAGG - Intronic
1074277446 10:112017306-112017328 GAGCCTAAGTATTTATTATCTGG - Intergenic
1074784923 10:116830558-116830580 GAGCCTAGGAGTTTGAGAACCGG + Intergenic
1076050289 10:127328085-127328107 GAGCCTAGGTGCTTGCTACCTGG - Intronic
1078856300 11:15208595-15208617 CAGCCTAGGTCTTTGTTAGAAGG - Intronic
1078888056 11:15525781-15525803 GAGCCTAGGTCTATGGAGACTGG - Intergenic
1078965468 11:16335253-16335275 AAGCCTAGATTTCTGTTAACAGG - Intronic
1081098807 11:38975393-38975415 GAGTCTAAGTATTTGTTAAATGG + Intergenic
1082656720 11:55866575-55866597 CAGCCTAGGTCTTTATTGAAAGG - Intergenic
1082863278 11:57875021-57875043 GAGCCAAGGGATTTGTTACCAGG + Intergenic
1087201637 11:95350880-95350902 GATCCTAGGTTTTTCTTTACTGG - Intergenic
1087968342 11:104447882-104447904 GATACTAGGTCTTTGTCAAATGG - Intergenic
1089550992 11:119277509-119277531 GAGCCTATGGCATTGTTACCTGG + Intronic
1094574764 12:31675043-31675065 GAGCATTGGTTTTTGTCAACTGG - Intronic
1102242108 12:111331059-111331081 GAGCCTAGATGTTTGTGAAGGGG + Intronic
1103324303 12:120110254-120110276 GAGCCTAGGTGTCTGTTCATGGG + Intronic
1115284565 14:31703223-31703245 GATCCTAGGACTTTATAAACTGG + Intronic
1121307247 14:92914681-92914703 GAGCCTAGGAATTTGTGACCAGG + Intergenic
1137508801 16:49080184-49080206 TAGCAGAGGTCTTTTTTAACTGG + Intergenic
1139492769 16:67295438-67295460 GAGGCTAGGTCTTTGCGAAGGGG + Intronic
1144800235 17:17921335-17921357 GACCCAAGTTCTTTTTTAACTGG + Intronic
1147389013 17:40098113-40098135 GAGCCAAGGTCATTGTTACCAGG - Intronic
1157281655 18:46350293-46350315 GAGCCTGGGCCTTTGATACCAGG + Intronic
1159388691 18:67759864-67759886 GAGCTTTGGTATTTTTTAACTGG - Intergenic
932297555 2:70639710-70639732 GTGCCCAGTTCTTTCTTAACTGG + Intronic
945278617 2:208013968-208013990 GAGCCTAGGTCTTTGTTAACTGG + Intronic
1178697586 21:34807777-34807799 GAGCCTAGGCCTTTCTTCCCAGG - Intronic
950985879 3:17365733-17365755 TAGCCTGGGTCTTTGATATCTGG + Intronic
953962306 3:47275866-47275888 GAGCCCAGGCCTCTGTTACCAGG - Intronic
954666850 3:52258850-52258872 GACCCTAGCTATTTGTTCACAGG + Intronic
955880501 3:63539652-63539674 GTGCCTAGGTCTTTGTTTTAAGG - Intronic
966744250 3:183260606-183260628 GACCCTAAGTCTTTATTAACGGG - Intronic
973176086 4:47207051-47207073 GAACCTAAGTCTTTCTTGACAGG + Intronic
975249083 4:72156272-72156294 AAGCCTAGATCTTTTTGAACGGG + Intergenic
979072921 4:116233543-116233565 TAACCTAGATTTTTGTTAACAGG + Intergenic
979313144 4:119228109-119228131 AAGTCTAGGTCGTTTTTAACTGG + Intronic
981570086 4:146142500-146142522 GAGCCATGGTCTTTGTTAAAGGG + Intergenic
988681279 5:33486636-33486658 CTGCCTCGGTCTTTCTTAACTGG - Intergenic
990825828 5:59896446-59896468 GAGCCTGGGTCTTTGTGTGCTGG - Intronic
992301227 5:75382618-75382640 GAGCCTAGGTCTTCAATAAATGG + Intronic
993553115 5:89300464-89300486 TAGCCGAGGCCTTTGTTATCTGG + Intergenic
995261356 5:110107839-110107861 TAGCCTAAGCCTTTGTTACCTGG - Intergenic
1001910244 5:175510727-175510749 GAGCCTATTTTTTTTTTAACAGG - Intronic
1004443505 6:15675864-15675886 GTGCTTAGGTCTTTGTAAAAGGG + Intergenic
1007382350 6:41498949-41498971 GAGCCTTGGTTGTTGTTAAGGGG - Intergenic
1008696105 6:54039997-54040019 GAGCACAGGTACTTGTTAACAGG + Intronic
1010653473 6:78482526-78482548 GAGCCCTGATCTTTATTAACTGG - Intergenic
1017793412 6:157821738-157821760 CAACCTATGTGTTTGTTAACAGG - Intronic
1026159259 7:67854182-67854204 GAGCCTTGGTCTTTGTCTCCTGG + Intergenic
1028288896 7:89041068-89041090 GAGCCTTGGTCCTTGGTAGCTGG + Intronic
1031280843 7:119797592-119797614 GAGCCTTGATCTATGTAAACTGG + Intergenic
1031801861 7:126256972-126256994 AAGACTAGATCTTTGTTACCTGG + Intergenic
1032745147 7:134778934-134778956 AAGCGTAGGTCTTTTTTAGCAGG - Intronic
1032869614 7:135969643-135969665 GAGAAAAGGTCTTTGTAAACAGG + Intronic
1033470703 7:141646483-141646505 GAGCCTTTAGCTTTGTTAACAGG - Intronic
1040922441 8:52637414-52637436 GAGCCTAGGGGTTTGTGAACAGG - Intronic
1048312579 8:133336973-133336995 GAACATAGTTCTTTGTTAAGGGG - Intergenic
1050916474 9:11141494-11141516 GAGCCTAGATCTTAGTGTACAGG - Intergenic
1051155419 9:14139162-14139184 GAGCCTAGATCTTTGTTCAAGGG - Intronic
1058339331 9:103874997-103875019 GAGCCCAGGACTTTGACAACAGG + Intergenic
1060753701 9:126193111-126193133 GAGGCTAGGTCTTGGGTAAGTGG - Intergenic
1186276061 X:7939229-7939251 GTTCCTAGGACTTTGTGAACGGG - Intergenic
1189275240 X:39780668-39780690 GAGGCCAGGTCTTTATTACCTGG + Intergenic
1194683973 X:96888893-96888915 GAGCCTAGGCCTTTAACAACTGG + Intronic
1196434063 X:115659093-115659115 GAGCCTAGGAGTTTGAGAACAGG + Intergenic