ID: 945278965

View in Genome Browser
Species Human (GRCh38)
Location 2:208017431-208017453
Sequence AGGTTCCTCCAGCATTTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 201}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945278965 Original CRISPR AGGTTCCTCCAGCATTTTCA AGG Intronic
901964879 1:12858565-12858587 GTGTTCCCCCAGCATGTTCATGG + Intronic
901989170 1:13098396-13098418 GTGTTCCCCCAGCATGTTCATGG - Intergenic
901992643 1:13128371-13128393 GTGTTCCCCCAGCATGTTCATGG + Intergenic
903166270 1:21522775-21522797 AGTTTCCTCCAGCAGATTCGGGG - Intronic
903644092 1:24881007-24881029 AGTTTCCTCCATTCTTTTCATGG + Intergenic
904083340 1:27885915-27885937 TGGTTCCTCCAGCACTTAGATGG - Exonic
907040667 1:51256365-51256387 AAGTTCCTCCATGTTTTTCATGG + Intronic
907754797 1:57301218-57301240 CTGTACCTCCAGCATTTACAGGG - Intronic
908634089 1:66143081-66143103 TGATTCTTCCAGCATTTTCTGGG - Intronic
909190497 1:72543063-72543085 TGGACCCTTCAGCATTTTCAGGG + Intergenic
910359388 1:86399752-86399774 AAGTTACTTCAGAATTTTCAAGG + Intergenic
914825300 1:151135025-151135047 AGGTACCTCAAGCATTCTGAAGG - Intronic
915194067 1:154176141-154176163 AGCTTCTTCCAGCTTTTGCAGGG + Exonic
915268897 1:154738328-154738350 ATTTTCCTCCAGAATTTTGAAGG - Intronic
917124582 1:171675595-171675617 AGGTTTCTTCAACATTGTCAAGG - Intergenic
923542743 1:234900368-234900390 AGGCCCATGCAGCATTTTCATGG - Intergenic
924268862 1:242311299-242311321 AAAATCCTCAAGCATTTTCAAGG + Intronic
924286343 1:242491823-242491845 AAGTTACTCCAACAGTTTCATGG - Intronic
924551878 1:245085775-245085797 AGGTTATTTCAGCATTTTGAGGG + Intronic
1063888635 10:10605964-10605986 ATGTTCTGCCAACATTTTCAGGG + Intergenic
1064553443 10:16524431-16524453 TGGTTCCCCCACAATTTTCAAGG + Intergenic
1065807472 10:29408274-29408296 AGATTCCTCCAGCATCTCCGAGG - Intergenic
1066045208 10:31588556-31588578 TGTTACCTCCAGCAGTTTCATGG + Intergenic
1070359660 10:75675069-75675091 TGATCCCACCAGCATTTTCAAGG - Intronic
1071735605 10:88295869-88295891 AGTTTGCTCCAGTGTTTTCAGGG - Intronic
1071744314 10:88398527-88398549 CAGTTCCTCCAGCATCATCAGGG + Intronic
1073108009 10:101043618-101043640 AGGTTCCTCCTGCCTTCTCCAGG - Intergenic
1074687244 10:115972214-115972236 AGCTTCCTTAAGGATTTTCAAGG + Intergenic
1075790054 10:125077712-125077734 CGGTGCCCCCAGCTTTTTCATGG - Intronic
1076269763 10:129141528-129141550 AGGTTCCACGTGCATTTGCAAGG + Intergenic
1076332985 10:129684912-129684934 TGGTTCCTCCAGCAAGTTCTAGG - Intronic
1077037856 11:503908-503930 CGTTTACTCCCGCATTTTCATGG - Intronic
1079308318 11:19344098-19344120 AGGTGGGTCCAGCATTCTCAGGG - Intergenic
1079327121 11:19503599-19503621 AGTTTCCTCCATGTTTTTCATGG + Intronic
1081352287 11:42068972-42068994 TTGTTCCCCCAGCATATTCAAGG + Intergenic
1081439348 11:43063323-43063345 AGGTGCCTACAGCTTTTTCAGGG - Intergenic
1081648686 11:44808291-44808313 ATCTTCCTCCAGCATCTTGAGGG + Intronic
1082091561 11:48094602-48094624 AAGTCCCTCCAGCATTTTACTGG - Intronic
1082119211 11:48359737-48359759 AGGTTCTTCTAGAATTTTTATGG - Intergenic
1082255086 11:50025407-50025429 AGGTTCTTCTAGAATTTTTATGG + Intergenic
1082880014 11:58028100-58028122 AGGTTTCTCCAGCATCACCATGG - Intronic
1083290686 11:61688482-61688504 AGGTTCCTCAAGCAAGTTCTTGG - Intronic
1085367806 11:75967933-75967955 AAGTTCCTCAAGCATGTTCCTGG - Intronic
1086011892 11:82114776-82114798 AGGCTCTTCCAACATTTGCATGG + Intergenic
1087365565 11:97214633-97214655 AGATTCCTCCATGTTTTTCATGG - Intergenic
1089584749 11:119503088-119503110 AGGGTCCTCCTGCTTCTTCAAGG + Intergenic
1089834376 11:121357261-121357283 AAGTTCCTTCAGGATCTTCAGGG - Intergenic
1092581910 12:9850925-9850947 AGGTTCATACAGTATTTTCTTGG + Intergenic
1094602023 12:31917423-31917445 AAGTCACTCCAGCATTTTCCAGG + Intergenic
1095285959 12:40410584-40410606 AGGTTCATCCTACATTTACATGG + Intronic
1097225784 12:57476165-57476187 AGTTTCCTCCCTCATTGTCAGGG - Exonic
1097573858 12:61366321-61366343 ATGTAACTCCAGCATTTTAAAGG - Intergenic
1101337669 12:103810687-103810709 ACGTTTCTGTAGCATTTTCAGGG - Intronic
1105219477 13:18312365-18312387 AGGGTACACCAGCATCTTCAAGG + Intergenic
1105518021 13:21107973-21107995 AGGTTCCTCCATGTTTTTTATGG + Intergenic
1105787409 13:23762953-23762975 AGGTCCCTCCAGCATAGTGAAGG + Intronic
1107716309 13:43202858-43202880 AGGTCCTGGCAGCATTTTCAGGG - Intergenic
1108525704 13:51284359-51284381 CGCTTCCTCCAGCATTGCCAGGG + Intergenic
1108552747 13:51562931-51562953 AGCTTCCTCCATGTTTTTCATGG - Intergenic
1108597881 13:51965197-51965219 ACGTTCCTCCAGCGGCTTCAGGG + Intronic
1110902900 13:80846053-80846075 AGTTTTCTCCAGTGTTTTCATGG + Intergenic
1111080682 13:83302734-83302756 AGGTTTCTCCTGCATTGTCAGGG - Intergenic
1113384641 13:109837342-109837364 GGGGTCCTGCAGCATTTTCGTGG + Intergenic
1114192484 14:20450633-20450655 AAGTTTCTGCATCATTTTCATGG + Intronic
1117209810 14:53483688-53483710 AAGGTCCTCCAGCTTTCTCAAGG + Intergenic
1120436767 14:84492520-84492542 AGTTTCATCCAGCCTTTTAAGGG + Intergenic
1121928189 14:97948302-97948324 GGATCCCTCCAGCATCTTCAGGG - Intronic
1122639462 14:103149721-103149743 AGGTTTGTCCAGCATTTGCATGG + Intergenic
1122980270 14:105188684-105188706 ACTTTCCTCCAGCATTTTGCAGG + Intergenic
1123706646 15:22955572-22955594 AACTTTCTCCAGCATCTTCAGGG - Intronic
1125729231 15:41883436-41883458 AGGCTCCTTCAGCATCTACAGGG - Exonic
1125797976 15:42418134-42418156 AGATTTTTCCAGTATTTTCAAGG - Intronic
1126798121 15:52277026-52277048 AGTCTCCTCTAGCATTTACATGG - Intronic
1128869580 15:71143566-71143588 AGGGTCCTCAAGCACTTTTAGGG - Intronic
1129876813 15:78980960-78980982 GGGATCCTGCAGCATTTCCAAGG - Intronic
1132075952 15:98820019-98820041 AGGATTCTGCAGCTTTTTCAGGG - Intronic
1132255844 15:100374645-100374667 AGGTTCCTCATGTCTTTTCATGG - Intergenic
1135540287 16:23324755-23324777 AGTTGCCTCCAGCATTGGCAGGG + Intronic
1137348746 16:47691225-47691247 AGGCTCCTCTAGCAGTTTCTTGG - Intronic
1140814657 16:78610105-78610127 AGGTCCCTGCTTCATTTTCAAGG + Intronic
1141090328 16:81125871-81125893 AGGTCCCTCCACCACCTTCAGGG - Intergenic
1141296758 16:82776867-82776889 AGCTTCCACCAGAATTTCCAGGG - Intronic
1141325777 16:83057905-83057927 AGGTTCCTCCCTAATTTTGAAGG + Intronic
1141901058 16:86990851-86990873 AGGTTCCTTCACCATTTTCTCGG - Intergenic
1142249514 16:88984691-88984713 AGGGTCCTGCAGCCTCTTCAGGG - Intergenic
1144414987 17:15038049-15038071 TGGTTCCTCCAGCATTCTCTTGG + Intergenic
1146910527 17:36645637-36645659 AGGTTGCTACAGTATTTTCCTGG + Intergenic
1148129075 17:45252180-45252202 AGGTTCCTCCTGTCTTTTCCTGG - Intergenic
1203166156 17_GL000205v2_random:97620-97642 AGGTTGCATCAGGATTTTCAAGG - Intergenic
1153692408 18:7606825-7606847 AGCTTCCTCCAGCATCTGTAAGG - Intronic
1157964915 18:52197264-52197286 AGGATCCTACTGCAATTTCATGG - Intergenic
1160214799 18:76919177-76919199 AGCTTACTCCTGAATTTTCAGGG + Intronic
1166640447 19:44490324-44490346 ATGTTCATGCAGCAATTTCAAGG - Intronic
925305652 2:2846537-2846559 AGGTTCCTGCAGCTTTATCTTGG - Intergenic
926171594 2:10556167-10556189 AGGTTCCTCCATTATTAACATGG + Intergenic
927703294 2:25281730-25281752 AGGTTAAGCCAGCAATTTCAGGG - Intronic
928440936 2:31291293-31291315 AGGTTCTTCCAGTATTGCCATGG - Intergenic
929412967 2:41717647-41717669 AGGTTTTTCTAGCATTTTAAAGG + Intergenic
933171899 2:79134120-79134142 TAGACCCTCCAGCATTTTCAGGG + Intergenic
933271033 2:80233110-80233132 AGGTTCCTACTGAATTTTCAGGG - Intronic
933438992 2:82285671-82285693 AGTTTCCTGCAGCTTGTTCAGGG - Intergenic
933446877 2:82391995-82392017 GGGTTCCTGAAACATTTTCAGGG + Intergenic
933794783 2:85910907-85910929 ATGCTCCTCCTGCATTTGCAGGG + Intergenic
934184571 2:89660152-89660174 AGGGTACACCAGCATCTTCAAGG - Intergenic
934294853 2:91734290-91734312 AGGGTACACCAGCATCTTCAAGG - Intergenic
934777551 2:96949017-96949039 AACTTCCTACAACATTTTCATGG + Intronic
934973057 2:98778769-98778791 AGGTCCTTTCAGCATTTTAAAGG + Intergenic
937793105 2:125983489-125983511 AGGCTCATCCATCATTTTCCTGG - Intergenic
938948993 2:136240166-136240188 ATGTTCCACCAGCATCTCCAAGG + Intergenic
940712180 2:157175952-157175974 TGGTTCTTCTTGCATTTTCAAGG - Intergenic
945278965 2:208017431-208017453 AGGTTCCTCCAGCATTTTCAAGG + Intronic
945895259 2:215474111-215474133 AAGTGTCTCCTGCATTTTCATGG - Intergenic
947104343 2:226652985-226653007 AGGTTCCCTGAGCATTTTTATGG - Intergenic
1169895842 20:10504321-10504343 TGGTTCTTCCTGTATTTTCAGGG - Intronic
1173525130 20:43726518-43726540 ATGTTCCTCCAGATTTTTGATGG + Exonic
1174619858 20:51865672-51865694 AGGGTCCCCCAGCTGTTTCAGGG + Intergenic
1174930521 20:54808952-54808974 ATGTTCCTCCAGAACTTTTAAGG + Intergenic
1176335360 21:5592921-5592943 AGGTTGCATCAGGATTTTCAAGG + Intergenic
1176392397 21:6228027-6228049 AGGTTGCATCAGGATTTTCAAGG - Intergenic
1176405599 21:6361476-6361498 AGGTTGCATCAGGATTTTCAAGG + Intergenic
1176469022 21:7088147-7088169 AGGTTGCATCAGGATTTTCAAGG + Intergenic
1176492583 21:7469925-7469947 AGGTTGCATCAGGATTTTCAAGG + Intergenic
1176508059 21:7668458-7668480 AGGTTGCATCAGGATTTTCAAGG - Intergenic
1176700181 21:10038026-10038048 AGTGTTCTCAAGCATTTTCATGG + Intergenic
1181137610 22:20779646-20779668 AACATCCTCCAGCTTTTTCATGG + Exonic
1183811260 22:40259655-40259677 AGGTGCCTGCAGCAATTTCCAGG - Intronic
949258890 3:2083419-2083441 AGTTTCCTCCACAATTTTCCAGG - Intergenic
950709383 3:14803919-14803941 AGGTCTCTCCAGCGTTCTCAGGG + Intergenic
952641448 3:35601566-35601588 TGGTGCCTCCATTATTTTCATGG - Intergenic
954346429 3:50003644-50003666 AGGTCCCTCTAGCCTTTTCCTGG + Intronic
956121143 3:65967147-65967169 ATGTTTCTCCAGCATTTCAAAGG - Intronic
956370877 3:68559288-68559310 GGGATCCTCCTGCATGTTCAGGG - Intergenic
957351113 3:79022816-79022838 AGGTTTCTTCAGAATTCTCAGGG - Intronic
959621463 3:108402777-108402799 AGGTGCATCCTGCATCTTCAGGG - Intronic
960049188 3:113224253-113224275 AGGTCCCTCAATCATTCTCAGGG - Intronic
960974145 3:123159166-123159188 ATGTTCATCCAGCACTTTCATGG + Intronic
962332660 3:134493231-134493253 GGTTTCTTCCAGCTTTTTCATGG - Intronic
964440186 3:156700559-156700581 AGGTTTCTCCTGCTTTTTAATGG + Intronic
964989515 3:162790403-162790425 AGGATTCTCCATTATTTTCATGG + Intergenic
971780613 4:31029509-31029531 ACATTACTCCAGCATTTTCCTGG + Intronic
972848659 4:43021286-43021308 ATTTCCCTCCACCATTTTCAAGG + Intronic
978695580 4:111573695-111573717 AGTTTCCTCCTACATTTTGATGG + Intergenic
978991141 4:115083973-115083995 ATGTTGCTTCAACATTTTCAGGG - Intronic
979769206 4:124501737-124501759 AGCCTCCTCTAGCCTTTTCAAGG + Intergenic
980372589 4:131896781-131896803 AGTGTTCTCAAGCATTTTCATGG + Intergenic
980461662 4:133123375-133123397 AGTTTCCTCCAGAGCTTTCAGGG - Intergenic
981672959 4:147308746-147308768 AGCATCCTGCAGCAGTTTCAGGG + Intergenic
984388750 4:179099971-179099993 TGATTCTTCAAGCATTTTCAAGG - Intergenic
985009071 4:185563853-185563875 AGGTTCCTCCAGAGTTCTCTTGG + Intergenic
985723339 5:1502170-1502192 AGCTTCCTCCTGCAAATTCAAGG + Intronic
986281160 5:6323661-6323683 TGATTCCTCCAGCATTTGGATGG + Intergenic
987354346 5:17049422-17049444 TGGCTCCTCCAGCATTTGCCTGG + Intergenic
990796993 5:59554703-59554725 AGATTCCTCCAGTCGTTTCATGG - Intronic
990857636 5:60287919-60287941 TGATGCCTCCAGCATTTTAAAGG + Intronic
992121745 5:73600426-73600448 AGTTTTCTCCAGTGTTTTCATGG + Intergenic
992299073 5:75359120-75359142 ATGTTCCTCCAGAAGGTTCAGGG - Intronic
999189594 5:149737211-149737233 AGGTTCCTCCATGACTTTCATGG + Intronic
999835898 5:155372170-155372192 AGGTTTTTCCAGCATTTTAATGG + Intergenic
999918961 5:156296720-156296742 ATGCTCCTCCAACATTTTCCAGG - Intronic
1000285403 5:159822229-159822251 ATTCTCCTCCAGCATCTTCAGGG - Intergenic
1001183610 5:169545283-169545305 AAGTTCTTCCAGCAATCTCATGG + Intergenic
1002689862 5:181043378-181043400 AGGTCCCTCTAGCACTTCCACGG + Intronic
1005357952 6:25002580-25002602 AGGTTCCTTCAGTATTTGTAAGG - Intronic
1006669054 6:35718289-35718311 AGCTGCCTCCCGCATGTTCATGG + Intronic
1006909995 6:37557532-37557554 TGGGGCCTCCTGCATTTTCATGG + Intergenic
1007531989 6:42551248-42551270 ATTTTCCTCCAGAATTTTGAAGG - Intergenic
1010683431 6:78823008-78823030 AGCTTCCTTTAGCATTTTTAAGG - Intergenic
1011703096 6:89973395-89973417 AGGTTGCTCCACAATTATCATGG - Intronic
1012952687 6:105535410-105535432 AAGTTCCTTCAGCAATTCCAAGG - Intergenic
1013722495 6:113047303-113047325 AGGGTGGTCCAGAATTTTCAGGG + Intergenic
1018252002 6:161880874-161880896 AGATTCCGCCAGCACGTTCAGGG + Intronic
1019004484 6:168784727-168784749 AGGTTCTGCCTGCATTTTCCAGG + Intergenic
1021736794 7:23647502-23647524 TGGTTCTTCCAGCAATTTAATGG + Intergenic
1022013555 7:26329663-26329685 AGGTTCCTCAAGCAGGTACACGG - Intronic
1022948577 7:35313828-35313850 AAATTCCTGCAGCTTTTTCAAGG + Intergenic
1023786376 7:43712409-43712431 ATATTCCTCCAGAATTTTGAAGG + Intronic
1024876671 7:54032773-54032795 AGGTTCCTCCATGTCTTTCATGG + Intergenic
1026580437 7:71611726-71611748 AAATTCCTTTAGCATTTTCATGG - Intronic
1027908229 7:84213866-84213888 AGGTTGCCCCAGCACTATCATGG + Intronic
1030160092 7:106498795-106498817 AAGTGCTTCCAGCATGTTCAGGG + Intergenic
1030849909 7:114470947-114470969 TGTTTCCTTCATCATTTTCAGGG + Intronic
1030856951 7:114570528-114570550 AGGTTCCTACAGCAGTATCATGG + Intronic
1031027872 7:116700234-116700256 AGATGTCTCCAGCATTTTTACGG + Exonic
1032313118 7:130807101-130807123 TGGTTCCTCCTGCATTTTGAGGG - Intergenic
1032935289 7:136722762-136722784 TGATTCATCCAGCATTTTTAAGG - Intergenic
1035216185 7:157369076-157369098 AGTGGCCTCAAGCATTTTCAGGG + Intronic
1036673316 8:10807680-10807702 ATTTTCCTTCAGCATTTTGAAGG - Intronic
1038484516 8:27924241-27924263 AGTTACCTCCAAGATTTTCAAGG - Intronic
1039126408 8:34206904-34206926 AGGTTCCTCCATGTCTTTCATGG - Intergenic
1039400776 8:37267127-37267149 AGGTGCCTCCATCATTCTCCTGG + Intergenic
1041423277 8:57693006-57693028 AGAATCCTCCAGCTTCTTCATGG - Intergenic
1042892877 8:73632885-73632907 AGGGTTCTCAAGCATTTGCAGGG - Intronic
1046164756 8:110417792-110417814 AGGTCCCTCCTGTCTTTTCATGG - Intergenic
1046592347 8:116221398-116221420 AGGATACTGCAGCATTTTGAGGG - Intergenic
1046761320 8:118024087-118024109 AGATTTCTCCCACATTTTCATGG - Intronic
1046816109 8:118585663-118585685 AGGTTACTTCAGAATTTTCCTGG + Intronic
1048219356 8:132527172-132527194 TGGATCCTCCAGCATTCTCCAGG - Intergenic
1051870749 9:21735109-21735131 AGATTCCTTCAGCATCTGCAAGG + Intergenic
1053492376 9:38518591-38518613 AGGTCCCTCCTGCTTTTTCGGGG - Intergenic
1054318159 9:63621397-63621419 AGTGTTCTCAAGCATTTTCATGG + Intergenic
1055740552 9:79383505-79383527 AGGTTCTTGCTGCATTATCATGG - Intergenic
1056310264 9:85333796-85333818 AGGTTCCTCCTGCCTTGTCCAGG + Intergenic
1056859858 9:90170947-90170969 AGCTTCCTCCAGTGTATTCAAGG - Intergenic
1058596444 9:106620988-106621010 AGGATCCTCCAGCCTCATCAAGG - Intergenic
1203426278 Un_GL000195v1:41997-42019 AGGTTGCATCAGGATTTTCAAGG - Intergenic
1203439981 Un_GL000195v1:181081-181103 AGGTTGCATCAGGATTTTCAAGG + Intergenic
1188550676 X:31361304-31361326 TGATTCCACCAGCATTTTCAAGG + Intronic
1191248033 X:58243443-58243465 AGGTGACTCCAGCATTCTAACGG + Intergenic
1194955720 X:100177940-100177962 AGGTTTCTGCAGCTTTCTCATGG + Intergenic
1196685995 X:118510765-118510787 ATGGTCCTTCTGCATTTTCAAGG + Intronic
1199482225 X:148310345-148310367 AAGTTACTCTAGCATTTCCAAGG - Intergenic
1200014557 X:153148253-153148275 AGGTTTCTAAAGCAGTTTCAAGG + Intergenic
1200025045 X:153251701-153251723 AGGTTTCTAAAGCAGTTTCAAGG - Intergenic
1200175865 X:154115876-154115898 ATTTTCCTCCAGCATTTGGAGGG + Intergenic