ID: 945279473

View in Genome Browser
Species Human (GRCh38)
Location 2:208022578-208022600
Sequence CTGGAGGCCTAGAGTTGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 228}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945279473 Original CRISPR CTGGAGGCCTAGAGTTGCTG AGG (reversed) Intronic
900142966 1:1146180-1146202 CTGGAGGCCTCGACTTGGTGCGG - Intergenic
905120701 1:35679636-35679658 CAGGAGGCCTAGAGATGTGGGGG - Intergenic
905249472 1:36638711-36638733 CTGCAGGCCTGGACTTTCTGGGG + Intergenic
905592178 1:39173688-39173710 CTGAAGGTCCAGAGTTACTGAGG + Intronic
906154649 1:43606808-43606830 CTGGAGGCATAGCGCTTCTGTGG - Exonic
909440239 1:75688647-75688669 CTGGAGCCCTAGCATTGCTCAGG - Intergenic
909785478 1:79606111-79606133 ATTGAGGTCTAGAGTTCCTGTGG - Intergenic
911366988 1:96950454-96950476 CTGAAGGCCTACAGTTTCAGCGG + Intergenic
911647895 1:100355060-100355082 ATGAATGCCCAGAGTTGCTGAGG + Intronic
911878235 1:103197376-103197398 CGGGAGGCCTCCAGTTGCTGAGG + Intergenic
916213488 1:162376751-162376773 TTGGAGGTCCAGAGATGCTGAGG + Exonic
916687259 1:167158633-167158655 GTGGAGGCCTAGAGTCGGAGTGG + Intergenic
917504475 1:175615426-175615448 CTGCAGGCCTGGAGATGCTTCGG + Intronic
918133508 1:181649122-181649144 CTAGATGCCAAGAGTTGTTGAGG - Intronic
919849993 1:201666153-201666175 TCGGAGGCCCAGTGTTGCTGGGG - Intronic
920854937 1:209654438-209654460 CTGGAGCCCTGGAGTTCTTGGGG - Intergenic
924875710 1:248101741-248101763 CAGGAGGTCTAGAGTGACTGTGG - Intergenic
1062797438 10:355071-355093 CTTGAGGACTGGAGTTGCTGTGG - Intronic
1063954736 10:11255605-11255627 TTGGAGCCCTAGAGTTTCTGCGG + Intronic
1066049699 10:31621921-31621943 CTGGAGGCCCACATGTGCTGGGG + Intergenic
1067716291 10:48693287-48693309 CTGGAGGCAGAGACTTGCTATGG + Intronic
1068684316 10:59854074-59854096 CTGGAGGCCTGGAATTCATGTGG - Intronic
1069225062 10:65932851-65932873 CTGGAGGACAAGAGAAGCTGGGG - Intronic
1072633963 10:97165541-97165563 CATCAGGCCTAGAGTAGCTGAGG + Intronic
1072674269 10:97453886-97453908 CTGGGGGTATAGAGTTGCTAAGG + Intronic
1072675025 10:97459329-97459351 CTGGTGCCTAAGAGTTGCTGGGG + Intronic
1072685304 10:97533135-97533157 CTGGAGGTCAAGAACTGCTGAGG - Intronic
1073172011 10:101518561-101518583 AGGGAGGGCTGGAGTTGCTGGGG + Intronic
1073674199 10:105626914-105626936 TGGGTGGCCTCGAGTTGCTGAGG - Intergenic
1073838245 10:107469225-107469247 CTGGAGCCCCAGTGTAGCTGGGG - Intergenic
1077167207 11:1149078-1149100 CTGGAAACCCAGAGGTGCTGGGG - Intergenic
1078368002 11:10722391-10722413 CGGCAGGCATAGAGCTGCTGTGG + Intergenic
1078530921 11:12136300-12136322 CGGGAGTCCCAGAGCTGCTGTGG + Intronic
1082762635 11:57142324-57142346 CTTGTGGCCTAGAGTGGATGGGG + Intergenic
1084703360 11:70801888-70801910 CTGGAGCCCCAGACTTGCAGGGG + Intronic
1090576175 11:128106272-128106294 CTTAAGGCCTAGAGTTCCTTGGG - Intergenic
1091298572 11:134490219-134490241 CTGGAGGCCCAGGGCTGCGGAGG + Intergenic
1091298583 11:134490260-134490282 CTGGAGGCCCAGGGCTGCGGAGG + Intergenic
1091298594 11:134490301-134490323 CTGGAGGCCCAGGGCTGCGGAGG + Intergenic
1091298605 11:134490342-134490364 CTGGAGGCCCAGGGCTGCGGAGG + Intergenic
1091593119 12:1857125-1857147 ATGGAGGCCTAGGGATGATGGGG + Intronic
1096473681 12:51895337-51895359 CTTGAGGCCTGGAGTTGCTGTGG + Intergenic
1097118569 12:56716895-56716917 TTTGGGGGCTAGAGTTGCTGGGG + Intronic
1100470412 12:94887961-94887983 CTGTAGTCCTAGGGATGCTGAGG - Intergenic
1100976053 12:100123610-100123632 CTGGAGGCCCAGACTTGCAATGG - Intronic
1102763658 12:115412222-115412244 CTGGAGGAGCAGAGTTGCTGGGG + Intergenic
1103328014 12:120134478-120134500 CAGGAGGCCAGGGGTTGCTGTGG - Intronic
1103927319 12:124430068-124430090 CTGGCTGCCTAGAGCTGTTGTGG + Intronic
1104121194 12:125801605-125801627 TTGCTGGCCTGGAGTTGCTGTGG + Intergenic
1104969470 12:132524644-132524666 CTGGGGGCCCAGATGTGCTGGGG + Intronic
1105242744 13:18622190-18622212 CTGGTGGCCTGGAGTTGGGGAGG - Intergenic
1105804757 13:23946501-23946523 CTGGGGGCCTGGAGCTGCAGGGG - Intergenic
1106082523 13:26512255-26512277 CTCGAGGGTTAGAGATGCTGTGG - Intergenic
1107059828 13:36147653-36147675 CTGGATGGCTAGAGTTCCTTGGG - Intergenic
1107099513 13:36574710-36574732 CTTGAGACCTAGAGTTGCACTGG + Intergenic
1108086923 13:46803490-46803512 CTGGAGGCCTAGACTTGCGACGG - Intergenic
1109218665 13:59617877-59617899 GTGGAGGCATAGCTTTGCTGGGG - Intergenic
1111122352 13:83870141-83870163 CTGGAGGAATATTGTTGCTGTGG - Intergenic
1111215688 13:85138367-85138389 CTGCAGGCCTAGTGGTGCTAAGG - Intergenic
1112311330 13:98319820-98319842 CTGGATACCTACAGTTGCTGGGG + Intronic
1113559738 13:111269103-111269125 CTGGACGCTTGGAGATGCTGCGG - Intronic
1114630645 14:24157465-24157487 CTGAGGGCCTTGAGTTGCAGCGG + Intronic
1120367819 14:83592658-83592680 CTAGAGGCTAAGAGTTGTTGGGG - Intergenic
1122143839 14:99677296-99677318 CTGCAGGCATAGTGTAGCTGGGG - Exonic
1122156296 14:99752501-99752523 CTGCTGGCCTGGAGGTGCTGGGG - Intronic
1122717968 14:103706742-103706764 CTGGGGGCCTAGCTCTGCTGAGG + Intronic
1123028425 14:105439430-105439452 GTGGAGGCCAGGAGTGGCTGGGG - Intronic
1202902848 14_GL000194v1_random:53216-53238 CTGGGGGCCTGGAGGTGCAGGGG + Intergenic
1123488556 15:20762415-20762437 CTGGTGGCCTGGAGTTGGGGAGG + Intergenic
1123545052 15:21331488-21331510 CTGGTGGCCTGGAGTTGGGGAGG + Intergenic
1124440008 15:29678800-29678822 CAGGAGGACCAGAGCTGCTGGGG - Intergenic
1126763749 15:51993037-51993059 CTGGAGGTCTATGGTTGGTGGGG + Intronic
1128575968 15:68775454-68775476 ATGGAGGCCTGGAGTTGAGGAGG - Intergenic
1128656055 15:69462809-69462831 CTGGAGGCCGAGTGTGGCCGAGG + Intergenic
1129091430 15:73155467-73155489 GAGGAGGCCTAGAGATCCTGAGG - Intronic
1129112832 15:73347902-73347924 CTGGAAGCCTGGGGCTGCTGGGG - Intronic
1129679531 15:77650451-77650473 CTGGATGCCCAGGGTTGCTATGG - Intronic
1130151289 15:81313607-81313629 CTGGAGGCCGGGAGAGGCTGTGG - Intronic
1202953398 15_KI270727v1_random:58759-58781 CTGGTGGCCTGGAGTTGGGGAGG + Intergenic
1132670579 16:1100762-1100784 CTGGGGGCCTAGAGGTGCAGGGG + Intergenic
1132743136 16:1425942-1425964 CTTGATGCCAAGAGTTCCTGGGG - Intergenic
1133757055 16:8769672-8769694 CTTGGGGCTTTGAGTTGCTGTGG + Intronic
1134065483 16:11225567-11225589 CCAGAGGCCTAGAATAGCTGCGG - Intergenic
1134217746 16:12329308-12329330 ATGGACGCCTAGAGCTACTGGGG - Intronic
1134274134 16:12760563-12760585 CTGGGGGCCTGCTGTTGCTGAGG + Intronic
1137484103 16:48877350-48877372 GTGGAGCCCTAGGGTTGCTGGGG - Intergenic
1137843226 16:51660344-51660366 CTGAAGGCCTAAGGGTGCTGGGG + Intergenic
1139112233 16:63905058-63905080 CTTGAAGCCTGGGGTTGCTGGGG + Intergenic
1141783037 16:86177113-86177135 AAGGAAGCCTAGAGATGCTGGGG + Intergenic
1142126790 16:88414450-88414472 TTGGAGGCCCAGGGATGCTGTGG + Intergenic
1143498623 17:7326389-7326411 GTGCAGGCCTGGTGTTGCTGAGG - Intronic
1143717690 17:8786501-8786523 CTGGAACCCGAGAGATGCTGGGG - Intergenic
1147493686 17:40895699-40895721 CTGGAGTCCTAGAGCAGGTGGGG + Intergenic
1147875952 17:43620718-43620740 CTGGAGGGTTAGAGAGGCTGGGG - Intergenic
1148493240 17:48037019-48037041 CTTGAGGACTGGGGTTGCTGGGG - Intronic
1148550813 17:48550070-48550092 CTGGAGCCCTGGGGTTGATGGGG + Exonic
1148604012 17:48915181-48915203 CAGTAGGTCTAGAGTTCCTGGGG + Intronic
1148742464 17:49900644-49900666 CTGGGAGCCTGGAGCTGCTGGGG + Intergenic
1149223631 17:54443152-54443174 TTGCAGGCCTAGAGTGGCTCAGG + Intergenic
1151454489 17:74217914-74217936 CTGGGGGCCTGGTGTTGCTGTGG + Intronic
1151551654 17:74825878-74825900 CTGGAGCTCCAGGGTTGCTGTGG - Intronic
1152068544 17:78124311-78124333 CTGGAGGCCCAAGATTGCTGTGG - Intronic
1152731918 17:81976833-81976855 CTGGAAGCCTGGAGCTGGTGAGG + Intronic
1152819565 17:82429883-82429905 CAGGAGGTCTGGAGTTGCTGAGG - Intronic
1152880436 17:82811753-82811775 CAGGAAGCCAGGAGTTGCTGGGG + Intronic
1154411714 18:14145366-14145388 CTGGAGGCCTAGAGGCCCTCAGG - Intergenic
1154446194 18:14437687-14437709 CTGGTGGCCTGGAGTTGGGGAGG + Intergenic
1155160695 18:23193069-23193091 TTGGAGGCCTAGAGTTGGGTGGG + Intronic
1160450422 18:78960035-78960057 TTGGAAGGCTAGAGTTGCTCTGG - Intergenic
1160568881 18:79803300-79803322 CTGGAGGCCTAGAGGTGAGGGGG - Intergenic
1161586993 19:5111015-5111037 CTCGAGGCCTCGCTTTGCTGGGG + Intronic
1161888913 19:7019504-7019526 CGGTAGGCGCAGAGTTGCTGCGG + Intergenic
1161890455 19:7032517-7032539 CGGTAGGCGCAGAGTTGCTGCGG - Exonic
1161890993 19:7038216-7038238 CGGTAGGCGCAGAGTTGCTGCGG + Exonic
1161892541 19:7051245-7051267 CGGTAGGCGCAGAGTTGCTGCGG - Exonic
1161893078 19:7056677-7056699 CGGTAGGCGCAGAGTTGCTGCGG + Exonic
1162900142 19:13790254-13790276 TTGGAGCCCTAGACTTACTGGGG - Intergenic
1163977161 19:20863166-20863188 CTGGAAGCCTAGAAATGGTGAGG - Intronic
1164723265 19:30447485-30447507 CTGGAGTCCTAGACTTGTTTGGG + Intronic
1165024114 19:32947109-32947131 CAGCAGCCCTAGAGTTGCTCGGG - Intronic
1165357041 19:35310705-35310727 ATGGAGGCCCAGAGTGGGTGGGG + Intronic
1165984098 19:39752252-39752274 CTTGTGGCCTAGAGTGGCAGTGG + Intergenic
1166297498 19:41896295-41896317 CTGGGGGCCTGGAATTGCGGGGG - Intronic
925067489 2:939690-939712 CTGGAGAACCAGAGATGCTGGGG - Intergenic
926603962 2:14877789-14877811 CTGGAGGCCAAGAAAAGCTGAGG - Intergenic
927377659 2:22437052-22437074 CAGGAGGTCTAGAGTTACTGTGG + Intergenic
927510184 2:23639469-23639491 CTGGAGTCCTTGAGTAGCAGAGG - Intronic
927607622 2:24501875-24501897 CTGGATGAGTAGAGTTACTGAGG - Intronic
928130133 2:28643120-28643142 CTGGTGGCCGGGAGTGGCTGGGG - Exonic
928252119 2:29690177-29690199 CTGGAGCCCTGGAGTGGCTAAGG - Intronic
933145919 2:78852321-78852343 CTGGAGGCCTAGGATTGTTTGGG + Intergenic
933845398 2:86322517-86322539 CAGGAGGTCAAGAGTAGCTGTGG - Intronic
933997288 2:87679285-87679307 CAGGAGGCCCAGGGTTGTTGGGG - Intergenic
934503811 2:94877178-94877200 CTGGGGGCCTGGAGGTGCAGGGG - Intergenic
935657753 2:105439325-105439347 CTGCAGGCTTAGAATTGTTGTGG - Intergenic
936296564 2:111271625-111271647 CAGGAGGCCCAGGGTTGTTGGGG + Intergenic
939230615 2:139421161-139421183 GTGAAGGTCTAGAGTTGCAGGGG + Intergenic
944011836 2:194983108-194983130 CTGGAGGCCTGGGGGTGATGAGG - Intergenic
944381502 2:199116008-199116030 CTCAAGGCCTAGAGTATCTGTGG - Intergenic
944817474 2:203392866-203392888 CTTGGGGACCAGAGTTGCTGAGG + Intronic
945279473 2:208022578-208022600 CTGGAGGCCTAGAGTTGCTGAGG - Intronic
946097072 2:217283834-217283856 CTGGAGGCCTCGGGTAGCTGGGG - Intergenic
946313478 2:218895558-218895580 ATGGAGGCCTAGGGTTGAGGGGG + Intronic
947753708 2:232545880-232545902 CTGGAGTCCGAGAGTGGTTGGGG + Exonic
948135777 2:235635109-235635131 CTGGTGGTCTAGAGGTACTGTGG + Intronic
948248067 2:236503325-236503347 CTGGATGTCTAGACCTGCTGTGG + Intronic
948368753 2:237474628-237474650 CTGCAGGCCTGGAGTTCCTGGGG + Intergenic
949077755 2:242072038-242072060 CTGGTGTCTTAGAGATGCTGGGG - Intergenic
1170890726 20:20373202-20373224 CTGGAGGCCTGGAAACGCTGGGG + Intergenic
1173803512 20:45909881-45909903 CAGGAGGGCTGGAGGTGCTGTGG - Intronic
1174001745 20:47379849-47379871 CTGGGGGGCTGGAGTTGGTGCGG + Intergenic
1174581135 20:51572640-51572662 GTGGAGATCTAGGGTTGCTGTGG - Intergenic
1175127339 20:56762424-56762446 CAGGAGGCCTGGTGTTGGTGGGG - Intergenic
1175249712 20:57601794-57601816 GTGGGGGCCTGGAGCTGCTGGGG + Intergenic
1175955332 20:62606078-62606100 CTGGAGGCCTTGAGTTACGAGGG - Intergenic
1176269052 20:64225987-64226009 GTTGAGGCCTAGAGCTGCTGTGG + Intronic
1176449788 21:6852159-6852181 CTGGTGGCCTGGAGTTGGGGAGG - Intergenic
1176827960 21:13717183-13717205 CTGGTGGCCTGGAGTTGGGGAGG - Intergenic
1177876042 21:26633074-26633096 CTGGATCCCTAGATTTTCTGGGG + Intergenic
1179578138 21:42320418-42320440 CCGAAGGCCGAGAGTGGCTGCGG - Intergenic
1179682543 21:43034258-43034280 CTGGAAGCCTAGAGAGACTGGGG - Intergenic
1181953006 22:26568331-26568353 CTGGAGAGATGGAGTTGCTGTGG - Intronic
1182828304 22:33284352-33284374 CTGGCTGCCTAGGGTGGCTGTGG - Intronic
1183987219 22:41576313-41576335 CTGGGAGCCCAGAGCTGCTGAGG + Exonic
1184163571 22:42714071-42714093 CTTGAGGCCAAGAGTTGCGTGGG + Intronic
1184178898 22:42806118-42806140 CTCTAGGCCTAGGGATGCTGAGG + Intronic
1184394173 22:44222942-44222964 CAGAAGACCTAGAGTTGGTGGGG + Intergenic
949951648 3:9234102-9234124 ATGGAGCCCTAGATTAGCTGAGG + Intronic
950378536 3:12591729-12591751 CTGAAGGCCTGGAATTGCTCTGG + Exonic
950657229 3:14444102-14444124 CTGGAGGACCAGAGAGGCTGAGG - Intronic
953739484 3:45524930-45524952 CTGTAGGCATAAAGTTGCTTGGG - Intronic
954370964 3:50169410-50169432 CTGGAGGCCAGGAATGGCTGCGG + Intronic
954405583 3:50343353-50343375 CTGGTGGCCCAGAGTGGCTGTGG - Exonic
956693797 3:71901595-71901617 CTTCAGGCCTAGGGGTGCTGAGG + Intergenic
959516529 3:107273241-107273263 CTCTAGGCCTAGATTAGCTGTGG - Intergenic
960383507 3:116992538-116992560 CTGGAGGCCTAGAGTGCTTAGGG - Intronic
961661178 3:128469576-128469598 CTGGAGGCTTCGAGTAACTGAGG - Intergenic
961724708 3:128919832-128919854 CTGGAGGCCTAGAGGTACCAGGG - Intronic
962449912 3:135504432-135504454 CTGGTGTCCTAGAGAAGCTGTGG + Intergenic
962943326 3:140145356-140145378 CTAGAGGCATAAAGTTTCTGGGG + Intronic
964476273 3:157100463-157100485 CTGGGGGACTACAGTGGCTGTGG + Intergenic
965551278 3:169967130-169967152 CTGTGGGCCTGGAGTTCCTGTGG + Intronic
966825816 3:183964012-183964034 CTGGAGGCTGAGAACTGCTGGGG - Intronic
968970550 4:3791410-3791432 TTGGTGGCCCAGGGTTGCTGTGG - Intergenic
969317690 4:6391767-6391789 CTGGAGGCCTGGAGGTGCCATGG + Intronic
971341029 4:25769262-25769284 TTGGAGACCGAGAGGTGCTGGGG + Intronic
972708646 4:41571419-41571441 CTGGAGGCCTTGACTTTCTCAGG + Intronic
974078830 4:57192576-57192598 CTGTAGCCTCAGAGTTGCTGTGG - Intergenic
975539540 4:75492449-75492471 GTGGAGGCCTAGAGAAGCTAAGG + Intronic
976390084 4:84497948-84497970 GTGGCGGCCGAGAGCTGCTGCGG + Exonic
983605202 4:169575120-169575142 CTGGAGTCCTAGGCTTCCTGTGG + Intronic
984934340 4:184877096-184877118 CTTGGGGACTAGAGTAGCTGGGG + Intergenic
985953686 5:3243914-3243936 CTGCTGGCCTAGAGTTCCAGAGG - Intergenic
986323267 5:6651076-6651098 CTGGGGGCAAGGAGTTGCTGGGG + Intronic
987472509 5:18350682-18350704 CTGGTGGGCCAGAGTTCCTGCGG + Intergenic
993975270 5:94472393-94472415 CTGGAGACTTAGAGTGACTGTGG + Intronic
997423504 5:133787435-133787457 CTGAACGCCTAGGGTTGTTGGGG + Intergenic
999211215 5:149890692-149890714 CTTTAGGCTTAGAGTTGCTCAGG - Intronic
1000983927 5:167846502-167846524 CAGGAAGCCTAGAAGTGCTGGGG + Intronic
1001545627 5:172568973-172568995 CTGGGGTCCTACACTTGCTGGGG - Intergenic
1002100479 5:176855268-176855290 ATGGAGCCCTGGAGTTGCCGGGG - Intronic
1002130311 5:177077508-177077530 AGGGATGCCTAGAGTTGCTTGGG - Intronic
1002441730 5:179267758-179267780 CTGGAGGCAGAGAGCTGATGTGG + Intronic
1003922535 6:10846604-10846626 ATGAAGGCCCAGAGTGGCTGGGG + Intronic
1004431575 6:15549632-15549654 GGGGAGGCCCAGAGTTGCTGCGG - Intronic
1005500119 6:26422074-26422096 CAGGAGGCCTAGGGTTACAGAGG - Intergenic
1005504597 6:26458592-26458614 CAGGAGGCCTAGGGTTACAGAGG - Exonic
1006611746 6:35298195-35298217 CTGGAGGCCAGGAGGTTCTGAGG + Intronic
1007212466 6:40206398-40206420 CTGGAGGCTTGGAGTCCCTGTGG + Intergenic
1008666973 6:53726087-53726109 CTGGAGGCCGAGAAATGGTGAGG - Intergenic
1008952498 6:57175927-57175949 CTGGAGGCCTAGACTTGCAACGG + Intronic
1014005917 6:116418190-116418212 CTGGAAGCCTTGAGTTTCTTAGG + Intronic
1014035763 6:116765411-116765433 CTTGGGGCCCAGAATTGCTGGGG + Exonic
1021611316 7:22460550-22460572 CTGGTGGCCTGGACATGCTGTGG + Intronic
1021994468 7:26166397-26166419 CAGGAGCCCTAGAGTTTCTCAGG + Intronic
1022146150 7:27543015-27543037 CTGCTGCCCAAGAGTTGCTGGGG - Exonic
1027048603 7:75007543-75007565 TTGGAGCTCCAGAGTTGCTGAGG + Intronic
1028979739 7:96954149-96954171 CAGAAGGCTTACAGTTGCTGTGG + Intergenic
1029384407 7:100234106-100234128 TTGGAGCTCCAGAGTTGCTGAGG - Intronic
1031566535 7:123304874-123304896 ATGGAGACTTAGAGTTCCTGGGG - Intergenic
1032291908 7:130596554-130596576 CTGGAGCCCTAGTGTTGCCCAGG - Intronic
1032876285 7:136041489-136041511 CTGGAGTCCCTGAGTTGCAGGGG + Intergenic
1033415380 7:141157100-141157122 CTGGAGGCCTGGGGGAGCTGAGG + Intronic
1033591525 7:142812667-142812689 CTGGAGGCTGAGAGATTCTGGGG + Intergenic
1033967905 7:147000747-147000769 CTTGAAGCCCATAGTTGCTGAGG + Intronic
1035536291 8:393834-393856 CTGGTGTCTTAGAGATGCTGGGG - Intergenic
1037564507 8:20106144-20106166 CTTGAGGCCTAGGGGTGCTCTGG - Intergenic
1038457542 8:27687233-27687255 CTGAAAGCCTGGAGTTGTTGTGG + Intergenic
1038741939 8:30224042-30224064 CAGGTGGTCTAGAGCTGCTGGGG - Intergenic
1039792043 8:40883840-40883862 CTACAGGCCTGGAGCTGCTGCGG - Intronic
1041031446 8:53739906-53739928 GAGGAGGAATAGAGTTGCTGGGG - Intronic
1045684249 8:104694846-104694868 CTGGAGGCCTGGACTTGCTTGGG + Intronic
1050036129 9:1437987-1438009 CTGGAGGCCAAGAGTAACTGTGG + Intergenic
1052197577 9:25736220-25736242 ATAGAGGCTTGGAGTTGCTGAGG - Intergenic
1052805572 9:33010309-33010331 ATGGAGAGCTAGAGTTGCTTTGG - Intronic
1055303463 9:74905400-74905422 CTGGAGGCCCAGTGGTACTGAGG + Intergenic
1057174796 9:92988304-92988326 CTGGAGGCCCACAGGTACTGGGG - Intronic
1057850076 9:98558687-98558709 CTGGAGGGTTTGAGTGGCTGTGG - Intronic
1057928204 9:99171140-99171162 CTGGAGGGCTTGAGTTTCTCAGG - Intergenic
1060261880 9:122082916-122082938 CTGGGGGGCGAGGGTTGCTGAGG + Intronic
1061249330 9:129417245-129417267 CTGGAGGCCTCCAGGTGCAGGGG + Intergenic
1062189725 9:135241873-135241895 CTGCAGGCCTGGGCTTGCTGGGG - Intergenic
1062608215 9:137358266-137358288 CTGGAAGGCCAGAGGTGCTGTGG + Intronic
1203519396 Un_GL000213v1:32358-32380 CTGGTGGCCTGGAGTTGGGGAGG + Intergenic
1203745410 Un_GL000218v1:38413-38435 CTGGGGGCCTGGAGGTGCAGGGG + Intergenic
1203564698 Un_KI270744v1:81071-81093 CTGGGGGCCTGGAGGTGCAGGGG - Intergenic
1187820015 X:23277554-23277576 CTAGAGGCTTAGAATGGCTGGGG + Intergenic
1189090739 X:38080079-38080101 CTGGAGGCCTAGAAATGCCCTGG - Intronic
1197553867 X:127930362-127930384 CTTGAGACCTAGAATTACTGGGG + Intergenic
1200980568 Y:9259938-9259960 CTGCAGGCCTGTAGTTTCTGTGG + Intergenic
1201158730 Y:11153424-11153446 CTGGGGGCCTGGAGGTGCAGGGG + Intergenic