ID: 945282874

View in Genome Browser
Species Human (GRCh38)
Location 2:208052867-208052889
Sequence GGGTGGGACTAGAGGGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945282874_945282877 -9 Left 945282874 2:208052867-208052889 CCATTTTCCCTCTAGTCCCACCC No data
Right 945282877 2:208052881-208052903 GTCCCACCCCCTCACGCCTTAGG No data
945282874_945282886 21 Left 945282874 2:208052867-208052889 CCATTTTCCCTCTAGTCCCACCC No data
Right 945282886 2:208052911-208052933 GAACCCACTTTCTGTCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945282874 Original CRISPR GGGTGGGACTAGAGGGAAAA TGG (reversed) Intergenic
No off target data available for this crispr