ID: 945283463

View in Genome Browser
Species Human (GRCh38)
Location 2:208059513-208059535
Sequence CTGGGAATAAAGAGCTGCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945283457_945283463 8 Left 945283457 2:208059482-208059504 CCATTATATCTAAGAAGTCAAGG No data
Right 945283463 2:208059513-208059535 CTGGGAATAAAGAGCTGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945283463 Original CRISPR CTGGGAATAAAGAGCTGCCT AGG Intergenic
No off target data available for this crispr