ID: 945285660

View in Genome Browser
Species Human (GRCh38)
Location 2:208078851-208078873
Sequence CTCTGGGCTGGTACTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945285660_945285666 -6 Left 945285660 2:208078851-208078873 CCCTCCTCAGTACCAGCCCAGAG No data
Right 945285666 2:208078868-208078890 CCAGAGCCCAGTAGCTCCACTGG 0: 22
1: 39
2: 80
3: 140
4: 365
945285660_945285667 -5 Left 945285660 2:208078851-208078873 CCCTCCTCAGTACCAGCCCAGAG No data
Right 945285667 2:208078869-208078891 CAGAGCCCAGTAGCTCCACTGGG 0: 23
1: 41
2: 83
3: 142
4: 313
945285660_945285668 -2 Left 945285660 2:208078851-208078873 CCCTCCTCAGTACCAGCCCAGAG No data
Right 945285668 2:208078872-208078894 AGCCCAGTAGCTCCACTGGGTGG 0: 35
1: 50
2: 121
3: 150
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945285660 Original CRISPR CTCTGGGCTGGTACTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr