ID: 945290963

View in Genome Browser
Species Human (GRCh38)
Location 2:208127070-208127092
Sequence TGATAAGTATAGTACCTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 879
Summary {0: 1, 1: 2, 2: 41, 3: 245, 4: 590}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945290963 Original CRISPR TGATAAGTATAGTACCTGAC AGG Intergenic
900508655 1:3044847-3044869 TAATAAGCATAGCACCTGATGGG + Intergenic
900734317 1:4286136-4286158 TAATGAGGATAGTACCTGATAGG + Intergenic
903108313 1:21105093-21105115 TAATAAGCATAGTACTTGATAGG - Intronic
903372167 1:22843447-22843469 TGATAAGCATAGTACCCAATAGG + Intronic
904957312 1:34295853-34295875 TAATAAGCATAATACCTGGCAGG - Intergenic
906429323 1:45742257-45742279 TAATCAGTATAATACCTGATAGG - Intronic
906994208 1:50772740-50772762 TAATAAGCATAGTACCTGATAGG - Intronic
906997549 1:50813105-50813127 TAATAAGCATAGTACCTGATAGG - Intronic
908195130 1:61740686-61740708 CAATAAGTATAGTACCTGATAGG + Intergenic
908204556 1:61832214-61832236 TAATAAGCATAGTGCCTGACAGG - Intronic
908636472 1:66172060-66172082 TAATGAGTATAGTACCTAATGGG + Intronic
909255862 1:73420594-73420616 TAATAAGCATAGTATCTGACAGG - Intergenic
910686690 1:89924954-89924976 TAATGAGTATAGTACCTAATAGG - Intronic
911126757 1:94347634-94347656 TAATAAGCATAATACCTGATAGG + Intergenic
911261259 1:95689158-95689180 TAATAAGTGTAGTAGCTGACAGG + Intergenic
911591017 1:99747727-99747749 TGATAAGCATAGTACCCAATTGG - Intronic
911760645 1:101611031-101611053 TAATAAGCAAAGTACCTGATAGG + Intergenic
911900488 1:103497186-103497208 TAATAAGAATAGTACCTCAAAGG - Intergenic
911990212 1:104686612-104686634 TAATAAGCACAGTGCCTGACAGG + Intergenic
912155700 1:106916197-106916219 TAATAAGCATAGTACCTAATAGG - Intergenic
912216265 1:107616475-107616497 TTCTAAGCATAGTACCTGATAGG - Intronic
912611211 1:111046629-111046651 TGATAAGCATGGTACCTGCTGGG + Intergenic
913356140 1:117924234-117924256 TAATAAGCATAGTACCTGATGGG + Intronic
915006185 1:152639197-152639219 TGATAAGTATAGTAGCTGAGAGG + Intergenic
915238866 1:154505267-154505289 TGCTTAGCATAGTACCTGGCAGG + Intronic
915577235 1:156787615-156787637 TGATGAGCATAGTACCTGATAGG + Intronic
915689336 1:157672953-157672975 TGATAAGCATAGTACCCAACAGG + Intergenic
915946640 1:160157289-160157311 TAATAAGCATAGTACCTGATAGG + Intronic
916033594 1:160901107-160901129 TAATAAGTATAGTACCGGATAGG - Intergenic
916426078 1:164681715-164681737 TAATAAGCATAGTACCTCATAGG - Intronic
916593710 1:166220970-166220992 TAATAAGCATAGTACCTGATAGG + Intergenic
917183783 1:172328678-172328700 TAATAACCATAGTACCTGATAGG - Intronic
917411028 1:174760287-174760309 TGATAAGCATAGTACCCAATAGG + Intronic
917502007 1:175594153-175594175 GGAAAATTATAGTACCTGATTGG - Intronic
917572454 1:176282319-176282341 TAATAAGCATAGTACCTGATAGG + Intergenic
918481262 1:184979039-184979061 TAATAAGTATAGTACCCAATTGG - Intergenic
918558615 1:185836733-185836755 TGATAAGCATAGTACCCAACAGG + Intronic
918916070 1:190639478-190639500 TAATAAGCATAGTACCTGATAGG - Intergenic
919153163 1:193725640-193725662 TGATGAGTATTGCACTTGACTGG + Intergenic
919190585 1:194212221-194212243 TAATAAGTATAGTACCCAACAGG - Intergenic
919600288 1:199614015-199614037 TGATAAACATAGTACTTGATGGG + Intergenic
919617522 1:199826007-199826029 TAATAAGCATACTACCTGATGGG - Intergenic
919686722 1:200489679-200489701 TAATAAGCATAGTACCTGATGGG + Intergenic
920568527 1:206997070-206997092 TAATAAGCATAGCACCTGATAGG - Intergenic
920588535 1:207193775-207193797 TAATAAGCACAGTACCTGATGGG + Intergenic
921119914 1:212127325-212127347 TGAAAAGGATTGTTCCTGACAGG + Intergenic
921337023 1:214098433-214098455 TAATAAGCATAGTACTTGACAGG - Intergenic
921345286 1:214177402-214177424 TGATCACTATATTATCTGACTGG + Intergenic
921541791 1:216425056-216425078 TAATAAGCACAGTACCTGATAGG + Intergenic
921653236 1:217704170-217704192 TGATAAGTATAGCACCCAACGGG + Intronic
921753673 1:218827129-218827151 TAATAAGTATAGTACCTAATAGG + Intergenic
922114431 1:222597865-222597887 AAATAAGCATAGTACCTGATAGG + Intergenic
922971276 1:229742112-229742134 TAATAAGCATAGTACCTGATAGG + Intergenic
923248638 1:232158971-232158993 TAATAAGCATAGTAACTGATAGG - Intergenic
924185102 1:241480428-241480450 TACTAAGCATAGTACCTGATAGG + Intergenic
924819740 1:247477372-247477394 TACTAAGTATAGTGCCTGATAGG - Intergenic
924919872 1:248617395-248617417 TGATAAGCATAGTTCCTGATAGG - Intergenic
1062944148 10:1447681-1447703 TAATAAGCATAGTACCTGATTGG + Intronic
1063448098 10:6132812-6132834 TTATAAGCATAGTACCCAACAGG - Intergenic
1063629210 10:7718630-7718652 TAATGAGCATAGTACCTGATAGG + Intronic
1064776400 10:18782627-18782649 AAATAAGCATAGTACCTGATAGG + Intergenic
1064989343 10:21242495-21242517 TAATAAGCATAGTACCTGATAGG - Intergenic
1065392602 10:25199266-25199288 TAATAAGCATAGTACCTGATAGG + Intronic
1065652973 10:27913233-27913255 TAATAAGCATGGTACCTGATAGG + Intronic
1065899816 10:30196053-30196075 TAATAAGTATAGTACTCAACAGG + Intergenic
1066143926 10:32536614-32536636 TAATAAGCATAGTACCAGATAGG + Intronic
1066524400 10:36260650-36260672 TAATAAGTATAGTACCTGATAGG - Intergenic
1067915366 10:50392071-50392093 TAATAAGTATAGTACTCGACAGG - Intronic
1068025273 10:51634979-51635001 TAATAAGCATAGTACCTAACAGG - Intronic
1068114074 10:52717154-52717176 TAATAAGCATAGTACCCGAAAGG - Intergenic
1068402483 10:56548467-56548489 TAATGAGTATAGTACCTGATAGG + Intergenic
1069133666 10:64737010-64737032 TAATAAGCATTGTACCTGATAGG + Intergenic
1069296787 10:66856035-66856057 TAATAAGCATAGTACCAGATAGG + Intronic
1069485493 10:68820005-68820027 TAATAAGCATAGTAGCTGATGGG + Intergenic
1069900382 10:71703449-71703471 AGATAATAATAGTACCTGCCTGG + Intronic
1070123497 10:73600924-73600946 TAATAAGCATAGTACCTGATAGG - Intronic
1071452922 10:85816806-85816828 TAATAAGTATAGTACCTGATAGG + Intronic
1071454221 10:85831322-85831344 TAATTAGCATAGTACCTGATAGG - Intronic
1071670805 10:87607866-87607888 TAATAAGCATAGTACCTGATAGG + Intergenic
1071750485 10:88470275-88470297 TAATAAGCATAGTACCCGATAGG + Intronic
1071825911 10:89325746-89325768 TCATAAGCATAGTACATGATAGG - Intronic
1072053671 10:91731672-91731694 TAATAAGTATAGCACTTGATAGG + Intergenic
1072368328 10:94737896-94737918 TAATAAGCATAGTACTTGATAGG + Intronic
1072394845 10:95027970-95027992 TGGTAAGCATAGTATCTGATAGG + Intergenic
1072903803 10:99432013-99432035 TAGTAAGCATAGTACTTGACAGG + Intergenic
1073552973 10:104420527-104420549 TAATAAGCATAGTATCTGATAGG - Intronic
1074013658 10:109510129-109510151 TACTAAGCATAGTACCTGACAGG + Intergenic
1074167362 10:110895182-110895204 TAGTAAATATAGTACCTGATAGG + Intronic
1074209432 10:111316219-111316241 TAATAAGCATAGTACCTGATAGG - Intergenic
1075170532 10:120109490-120109512 TACTAAGCATAGTACCTGAGAGG - Intergenic
1075628500 10:123984017-123984039 TAATAGGCATAGTACCTGATAGG - Intergenic
1075819095 10:125290569-125290591 TAATAAACATAGTACCTGATAGG - Intergenic
1076325450 10:129617082-129617104 TGATAAGCATAGTACCCAATAGG + Intronic
1076418796 10:130313293-130313315 TAGCAAGCATAGTACCTGACAGG + Intergenic
1076609939 10:131718232-131718254 TGATACGCATAGTATCAGACAGG - Intergenic
1077945154 11:6889228-6889250 TAATAAGCATAGTACCTGATAGG - Intergenic
1077951716 11:6966366-6966388 TAATAAGCATAGTACCTGATGGG - Intronic
1077971429 11:7195637-7195659 TGGTAAGTATAGTGCCTGATAGG - Intergenic
1078272684 11:9811227-9811249 TAATAAGCATAGTACCTGATAGG - Intronic
1078517779 11:12039367-12039389 TAATAAACATAGTACCTGATAGG - Intergenic
1079555571 11:21754379-21754401 TGGTAAGCATAGTACCTGATAGG + Intergenic
1079621634 11:22562690-22562712 TCATGAGTATAGTACCCAACAGG + Intergenic
1079777350 11:24548590-24548612 TAATAAGCATAGTACCTGACAGG - Intronic
1079819661 11:25109520-25109542 TAGTAAGCATAGTACCTGATAGG + Intergenic
1080257025 11:30301926-30301948 TAATAAGCATAGTACCTGATAGG - Intergenic
1080480491 11:32644359-32644381 TAATAAGTATAGTACCTGATTGG - Intronic
1081211709 11:40343462-40343484 TTATAAGCATAGTACCTGATGGG + Intronic
1081222627 11:40480511-40480533 TAATAAGCATAGTACCTGACAGG - Intronic
1081259182 11:40937354-40937376 TAATTAGCATAGTACCTGATAGG - Intronic
1081307075 11:41526082-41526104 TAAAAAGCATAGTACCTGATAGG + Intergenic
1081346430 11:41992760-41992782 TAAAAAGTATGGTAACTGACAGG + Intergenic
1081524177 11:43913301-43913323 TAATAAGCATAGTACCCGATAGG + Intronic
1082652769 11:55815009-55815031 TAATAAGCATAATACCTGATAGG - Intergenic
1082668994 11:56010556-56010578 TCATGAGCATAGTACCTGATGGG - Intergenic
1082702722 11:56453133-56453155 TAATAAGCATAGCACCTGATAGG - Intergenic
1082716208 11:56617363-56617385 TGATAAGCACAGTGCCTGATAGG + Intergenic
1082755339 11:57069648-57069670 TAATAAGCATAGTACCTGATTGG - Intergenic
1083075609 11:60033783-60033805 TAATAAGCATAGTAACTGATGGG - Intergenic
1083130116 11:60617331-60617353 TAATAAGCATAGTACTTGAAGGG + Intergenic
1083362370 11:62119536-62119558 TAATAAGCATAGTACCTGATAGG + Intergenic
1084782833 11:71422272-71422294 TAATAAGCATAGTACTTGATAGG - Intergenic
1085223233 11:74894300-74894322 TAATAAGAATAGTACTGGACAGG - Intronic
1085828381 11:79872807-79872829 TAATAAGCATAGTACCTGATAGG - Intergenic
1086388526 11:86336083-86336105 TGAAAAGTACAGTAACTGAATGG + Intronic
1086563207 11:88192839-88192861 TAATAAGCATAGTACCTGATAGG + Intergenic
1087360378 11:97151228-97151250 TGATAAGCATAGTATCTGATAGG + Intergenic
1087380946 11:97404002-97404024 TAATAAGCATAGTACCTGATTGG + Intergenic
1087513063 11:99122647-99122669 TAATAAGCATAGTACCTGATAGG + Intronic
1087687544 11:101281582-101281604 TAATAAGCATAGTATCTGATAGG + Intergenic
1087749633 11:101993159-101993181 TAATAAGCAGAGTACCTGATAGG + Intronic
1087873108 11:103324275-103324297 TAATAAGTATAGTGCCCAACAGG + Intronic
1087908457 11:103725998-103726020 TAATAAGCATAGTACATGATAGG - Intergenic
1088149767 11:106730223-106730245 TAACAAGCATAGTACCTGATAGG + Intronic
1088338833 11:108740088-108740110 TGATAAGCATAGTACCTGATAGG + Intronic
1089740916 11:120582414-120582436 TAATAAGTATAGTACCTGATAGG + Intronic
1090379383 11:126315135-126315157 TAATAAGCATAATACCTGATAGG - Intronic
1090495697 11:127209929-127209951 TAATAAGCATAGCACCTGATAGG - Intergenic
1090742676 11:129679777-129679799 TAATAAACATAGTACCTGACAGG - Intergenic
1091012668 11:132019947-132019969 TAGTGTGTATAGTACCTGACAGG + Intronic
1091905865 12:4188766-4188788 TGTGAAGTGTAGTACCTGATAGG + Intergenic
1092393627 12:8104681-8104703 TAATAAGCATAGTACTTGATAGG + Intergenic
1092575482 12:9777927-9777949 TAATAAGTATAGTACCCAATAGG + Intergenic
1092625594 12:10324342-10324364 TAATCAGCATAGTACCTGACAGG + Intergenic
1092680852 12:10979140-10979162 TGATAAGCAGAGTACCTGATAGG - Intronic
1093491205 12:19706778-19706800 TAATAAGCACAGTACCTGACAGG - Intronic
1093497383 12:19774131-19774153 TAATAAGTATAATATCTGATAGG + Intergenic
1093669206 12:21852650-21852672 TAATAATCATGGTACCTGACAGG - Intronic
1093686023 12:22054829-22054851 TAGTAAGCATAGTACCTGATAGG + Intronic
1094167697 12:27459508-27459530 TAATAAGCATAGTACCTGATAGG - Intergenic
1094290400 12:28841758-28841780 TAATAAGCATAGTACCTGATAGG - Intergenic
1094407468 12:30132776-30132798 CAATAAGGATAGTACCTGATAGG - Intergenic
1095540907 12:43307751-43307773 TAATAAGCATAGTACCTGATAGG + Intergenic
1095575101 12:43727722-43727744 TAATGAGCATAGTACCTGATAGG - Intergenic
1096374725 12:51099187-51099209 TGTTAAGAATAGTACCTGGCTGG + Intronic
1096437332 12:51604948-51604970 TTATAAGCATAGTACCTGATGGG + Intronic
1096884706 12:54705412-54705434 TAATAAGCATAGTACCTGGTAGG + Intergenic
1096953577 12:55502233-55502255 TAATCAGCATAGTACCTGATAGG - Intergenic
1096963686 12:55606534-55606556 TAGTGAGTATAGTACCTGATAGG - Intergenic
1097369456 12:58758911-58758933 TAATAAGCATAATATCTGACAGG + Intronic
1097525235 12:60726003-60726025 TAGTAAGCATAGTACCTGATAGG - Intergenic
1097549593 12:61050383-61050405 TAATAAGGGTAGTACCTAACAGG + Intergenic
1097553489 12:61106266-61106288 TAATAAGCATAGTTCCTGATAGG - Intergenic
1098283185 12:68882192-68882214 TAATAAGCATAGTATCTAACAGG + Intronic
1098562430 12:71889741-71889763 TAGTAAGTATAGTATCTGATAGG + Intronic
1099310403 12:81013697-81013719 TAGTGAGCATAGTACCTGACAGG + Intronic
1099471102 12:83049267-83049289 TAATAAGTATAGTACCCAAGGGG + Intronic
1099651793 12:85438030-85438052 TGATAAGCAAAGTACCCAACAGG + Intergenic
1099696682 12:86031868-86031890 TAATACGCATAGTACCTGATAGG + Intronic
1099843898 12:88004921-88004943 TTATAAGCATAGTACCTGATAGG - Intronic
1099860061 12:88215062-88215084 TAATAAGCATGGTACCTGATAGG - Intergenic
1099917981 12:88919798-88919820 TAATAAGCATAGTACCTGACAGG - Intergenic
1100024164 12:90107409-90107431 TAATAACCATAGTACCTGATAGG - Intergenic
1100454499 12:94739332-94739354 TAATAAGCATAGTACCTGACAGG + Intergenic
1100664554 12:96737322-96737344 TGCTTAATATAGTACCTGTCAGG + Intronic
1102479693 12:113213352-113213374 TAATAAGCATAGTACCTGATAGG + Intronic
1102814539 12:115853791-115853813 TAATAAGCATAATACCTGATAGG + Intergenic
1103179457 12:118897024-118897046 TAATAAGCATAGTACCTGATAGG - Intergenic
1104027897 12:125042254-125042276 TGATAAGCACAGTACCCGATAGG + Intergenic
1104346255 12:128001912-128001934 TGATAAGCATAGTACCCGATAGG - Intergenic
1104612434 12:130240740-130240762 TTATAAGCATAGTACCTGATAGG - Intergenic
1105341082 13:19526605-19526627 TGATAAGCATAGTACCTGATAGG - Intronic
1105716607 13:23071851-23071873 TAATAAGCATAGGACCTGATAGG + Intergenic
1105878057 13:24577336-24577358 TGATAAGCATAGTACCTGATAGG + Intergenic
1106314486 13:28581015-28581037 TGATAAGTGTAGTACCCAATAGG + Intergenic
1106520989 13:30497556-30497578 TAATAAGCATGGTGCCTGACGGG + Intronic
1106749841 13:32750985-32751007 TGATAAGCATAGTACCCAAAAGG + Intronic
1107002371 13:35563986-35564008 TGATAAGCATAGTACCCAATAGG + Intronic
1107176146 13:37401041-37401063 TAATAAGCATAGTGCCTGATGGG - Intergenic
1107345931 13:39460938-39460960 TGATAAGCATAATACCTGATAGG + Intronic
1107573442 13:41688862-41688884 TAATAAGCATAGTACCTGATAGG - Intronic
1107914447 13:45134911-45134933 TGTTTAGCATGGTACCTGACTGG + Intronic
1108129543 13:47282985-47283007 TGATAAGCATAGTACCTGATAGG + Intergenic
1108227094 13:48301151-48301173 TAACAAGTGTAGTACCTGATAGG + Intergenic
1108426205 13:50303935-50303957 TGATAAGCATAGTATCTGATAGG + Intronic
1108505683 13:51110466-51110488 TAATAAGCATAGTGCCTGATTGG - Intergenic
1108559864 13:51632441-51632463 TGAAAAATATAGCACCTGAATGG - Intronic
1108788800 13:53941255-53941277 TAATGAGCATAGTACCTGATAGG - Intergenic
1108819003 13:54322460-54322482 TAATAAGCATAGTACCTAATAGG - Intergenic
1109008407 13:56908606-56908628 TGATGAACATAGTACCTAACAGG - Intergenic
1109065567 13:57684741-57684763 TGATAAGTATTTTACTTCACTGG + Intronic
1109476428 13:62885636-62885658 TGATAAGCACAGTACCTGATGGG + Intergenic
1109495026 13:63158327-63158349 TAATAAGTATAGTACCCTATAGG + Intergenic
1109550562 13:63893348-63893370 TAATAAGCATAGTACCTAATAGG - Intergenic
1109599246 13:64601355-64601377 TAATAAGTATAGTACCCAACAGG - Intergenic
1109621579 13:64914379-64914401 TAGTAAGTATAGTACCTGATAGG - Intergenic
1109833464 13:67824965-67824987 TAATAAGCATAGTATCTGATAGG + Intergenic
1109841668 13:67924557-67924579 TAATAAGCATAGTACCCGATAGG - Intergenic
1110016322 13:70409866-70409888 TGATAACTCTAGTATCTAACGGG + Intergenic
1110406736 13:75159356-75159378 TAATAAGCATAGTACCAGACAGG - Intergenic
1110559220 13:76892271-76892293 TAATAAGCATAGTACCTGATAGG + Intergenic
1110610481 13:77482009-77482031 TAATAAACATAGTACCTGATAGG + Intergenic
1110802740 13:79718612-79718634 TAATAAGCATAGTACCTCACAGG + Intergenic
1110803646 13:79729813-79729835 TAATAAGCATAGTACCTGATAGG + Intergenic
1110829993 13:80019655-80019677 TAATAAGCATAGTACCTGATAGG - Intergenic
1111050020 13:82870764-82870786 TAATAAGCATAGTACCTGATGGG + Intergenic
1112070956 13:95849785-95849807 TAGTAAGCATAGTACCTGATAGG + Intronic
1112264512 13:97910980-97911002 TAGTAAGTATAGTACCTGATAGG - Intergenic
1112957618 13:105080718-105080740 TCATAAGCATAGTACCGAACAGG + Intergenic
1113024248 13:105922787-105922809 TGAAGAGTATGGTACCTGCCAGG + Intergenic
1113247793 13:108417919-108417941 CAATAAGCATAGTACCTGATAGG + Intergenic
1114127992 14:19753097-19753119 TAGTAAGTATAGTACCCAACAGG - Intronic
1114686921 14:24541817-24541839 TGTTAAGTATAGTACCCAATAGG - Intergenic
1114902528 14:27082380-27082402 TAATAAGCACAGTACCTGAGAGG + Intergenic
1114972290 14:28047964-28047986 TAATAAACATAGTACCTGATAGG + Intergenic
1115005094 14:28472848-28472870 TAATAAGCATAGTACCTGACAGG + Intergenic
1115013405 14:28578742-28578764 TAATAAGCATAGTACCTGACAGG + Intergenic
1115021042 14:28682183-28682205 TAATAAACATAGTACCTGATAGG + Intergenic
1115386098 14:32798760-32798782 TAATAAGTACAGTACCTGATAGG - Intronic
1115391749 14:32861927-32861949 TAATAAGCACAGTACCTGATAGG + Intergenic
1115455219 14:33594125-33594147 TGATAATTTTAGTATCTGAAAGG - Intronic
1116109399 14:40557741-40557763 TCATAAATATAATACCTCACAGG - Intergenic
1116120150 14:40712408-40712430 TAATAAGCATAGTACCTGATAGG - Intergenic
1116246456 14:42419986-42420008 TGATAAGCATAGTACCCAATAGG - Intergenic
1116258051 14:42583123-42583145 TAATAAGCATAGTACCTGATAGG + Intergenic
1116267587 14:42713781-42713803 TAATAAGCATAGAACCTGATTGG - Intergenic
1116359906 14:43980682-43980704 TAATAAGCATAGTACCAGATAGG - Intergenic
1116361659 14:44005986-44006008 TAATGAGCATAGTACCTCACAGG + Intergenic
1116536387 14:46036253-46036275 TAATAAGCATAGTACCTGATAGG - Intergenic
1116673770 14:47878449-47878471 TGATAAGCATAGTACCTAATAGG - Intergenic
1116680072 14:47957089-47957111 TAATAAGCATAGTACCCGATAGG + Intergenic
1116796780 14:49399673-49399695 TAATGAGCATAGTACCAGACAGG - Intergenic
1117194397 14:53325164-53325186 TAATGAGCATAGTACCTGATAGG + Intergenic
1117425678 14:55593592-55593614 AGATAGGTATAGTACGTGAAAGG + Intronic
1118059637 14:62121418-62121440 TAATAAGTGTAGTACCTGAGAGG + Intergenic
1118435601 14:65768150-65768172 TAATCAGTATAATACCTGATAGG + Intergenic
1118680435 14:68236097-68236119 TAATAAGCATAGTATCTGATAGG - Intronic
1119815291 14:77560908-77560930 TAATCAGCATAGTACCTGATAGG - Intronic
1119876813 14:78066839-78066861 TAATAATCATAGTACCTGATAGG + Intergenic
1120282447 14:82456532-82456554 TGATAATTAAACAACCTGACAGG + Intergenic
1120323318 14:82993568-82993590 TAATGAGCATAGTACCTGATAGG + Intergenic
1120716195 14:87843470-87843492 TAATAAGCATAGTATCTGATGGG + Intronic
1121163799 14:91771973-91771995 TAATAAGCATGGTACCTGATAGG - Intronic
1121513135 14:94528460-94528482 TAATAAGCATAGTACCTGATAGG - Intergenic
1123575091 15:21657685-21657707 TAATAGGCATAGTACCTGATAGG + Intergenic
1123607563 15:22049997-22050019 TAGTAAGTATAGTACCCAACAGG - Intergenic
1123611707 15:22100174-22100196 TAATAGGCATAGTACCTGATAGG + Intergenic
1123917382 15:25046367-25046389 TAATAAGCATAGTACCTGATAGG + Intergenic
1124634472 15:31356132-31356154 TGATAAACATAGTACCCGATAGG + Intronic
1125078252 15:35646253-35646275 TAATAAGCATAGTACCTAATAGG - Intergenic
1125127883 15:36245637-36245659 TAATAAGCATAGTACCTGATAGG - Intergenic
1126046564 15:44646863-44646885 TAATAAGCATAGTACCTGATAGG - Intronic
1126213297 15:46125315-46125337 TAATAAGCATAGTACCCAACAGG - Intergenic
1126213583 15:46128766-46128788 TAATAAGTATAGTACCCAATAGG + Intergenic
1126233927 15:46359782-46359804 TAATAAGCATAGTACCTGCTAGG - Intergenic
1126723663 15:51608636-51608658 TAATAAGTATAGTTCCCGATAGG - Intronic
1126945270 15:53812294-53812316 TAGTGAGCATAGTACCTGACAGG + Intergenic
1127022860 15:54769466-54769488 TGGTAAGCATAGTACCTGATAGG - Intergenic
1127136527 15:55929437-55929459 TAATAAGCATAGTACCCAACAGG + Intronic
1127163634 15:56219476-56219498 CAATAAGCATAGTACCTGATAGG + Intronic
1130069528 15:80634875-80634897 TGCTAAGCATAGTACCTGATAGG + Intergenic
1131710559 15:95050690-95050712 TAATAAGCATAGTACCTGATAGG + Intergenic
1202979799 15_KI270727v1_random:341799-341821 TAGTAAGTATAGTACCCAACAGG - Intergenic
1202983959 15_KI270727v1_random:391929-391951 TAATAGGCATAGTACCTGATAGG + Intergenic
1133535879 16:6701983-6702005 TAATAAGCATAGTACCCAACAGG - Intronic
1133706202 16:8357383-8357405 TAATAAGCATAGTACCTAATAGG - Intergenic
1133712865 16:8418261-8418283 TAATAAGCATAGTACCTGAGAGG - Intergenic
1134373674 16:13649678-13649700 TAATAAGCATAGTACCTGACAGG + Intergenic
1136056863 16:27696445-27696467 TAATAAGCATAGTACCTGATAGG + Intronic
1136678023 16:31932010-31932032 TAATAAACATAGTACCTGAGAGG - Intergenic
1137506903 16:49061970-49061992 TAATAAGCATAGTGCCTGATAGG + Intergenic
1137858118 16:51817301-51817323 TAATAAGCATAGTACCTAATGGG + Intergenic
1137944873 16:52724180-52724202 TAATAAGCATAGTACTTGATAGG + Intergenic
1139317393 16:66085431-66085453 CAATAAGCATAGTACCTGATAGG - Intergenic
1140591818 16:76362789-76362811 TAATAAGCATAGTACCTCACAGG - Intronic
1140636591 16:76922111-76922133 TGCTAAGCATAGTACTCGACAGG + Intergenic
1140947665 16:79784974-79784996 TGATAAGCATAGTACCCAATAGG - Intergenic
1141478378 16:84289295-84289317 TGATAAGCATAGCACCCAACGGG + Intergenic
1143436719 17:6934118-6934140 TGATAAGCATAGTACCCAATAGG + Intronic
1144231290 17:13206836-13206858 TAATAAGCACAGTACCTAACAGG + Intergenic
1147523247 17:41195153-41195175 TAATCAGCATAGTACCTGACAGG - Intronic
1147529091 17:41256960-41256982 TAATAAGCATAATACCTGATAGG + Intergenic
1149014817 17:51896193-51896215 TAATAAGCATAGTACCCGGCAGG + Intronic
1150052080 17:61974441-61974463 TAATAAGCATAGTACTTGATAGG - Intronic
1153348662 18:4055386-4055408 TGATAAGCACAGAACCTGATAGG + Intronic
1153543405 18:6181291-6181313 TAATAGGCATAGTACCTGATAGG + Intronic
1153571683 18:6479493-6479515 TAGTAAGCATAGTACCTGATAGG - Intergenic
1153860217 18:9195220-9195242 TAATAAGCATAGTACCTGATAGG - Intronic
1153980968 18:10310294-10310316 CGATAACTATAGTACCTCATGGG - Intergenic
1154371943 18:13771860-13771882 TAATAAGCATAGTACCTGATAGG - Intergenic
1154395723 18:13986848-13986870 TAATAAGCATAGTACCCAACAGG - Intergenic
1155100069 18:22602090-22602112 TGATAAGCATAGTACCCAATAGG + Intergenic
1155613240 18:27692882-27692904 TAAAAAGCATAGTACTTGACAGG + Intergenic
1155768330 18:29666233-29666255 TAGTAAGTATAGTACCTAACAGG + Intergenic
1156067863 18:33166881-33166903 TAATAAGCATAGTACCTGATAGG + Intronic
1156258899 18:35426281-35426303 TAATAAGCATAGTACTTGATAGG - Intergenic
1156790376 18:40965321-40965343 TAATAAGTATAGTAACTGATAGG - Intergenic
1156799603 18:41093663-41093685 TGATAAGAATATTAACTCACTGG - Intergenic
1157003419 18:43553713-43553735 TAATAAGCATAGTACCTGATAGG + Intergenic
1157054111 18:44204990-44205012 TTGTAAGCATAGTACCTAACAGG - Intergenic
1157235905 18:45965337-45965359 TAATGAGTATAGTGCTTGACAGG - Intronic
1157796045 18:50576524-50576546 TAATAAGCATAGAACCTGAGAGG - Intronic
1158738093 18:60106981-60107003 TAATAAGCAAAGTACCTGATAGG - Intergenic
1158822984 18:61182289-61182311 TAGTAGGTATAGTACCTGAGAGG - Intergenic
1159173471 18:64803576-64803598 TAATAAGCATAGTACCTGATAGG + Intergenic
1159458132 18:68688935-68688957 TAATAAGCATAGTACCCAACAGG - Intronic
1159518774 18:69492533-69492555 TAATAAGCATAGTACCCGATAGG + Intronic
1159757401 18:72382334-72382356 TAACAGGCATAGTACCTGACAGG - Intergenic
1159791249 18:72781951-72781973 TAATAAGCATAGTACCCAACAGG + Intronic
1159905529 18:74087338-74087360 TAATAAGCATAGTACCCGATAGG + Intronic
1160249952 18:77193913-77193935 TAATAAGCATAGTACCTGATAGG + Intergenic
1160280916 18:77489816-77489838 TGATAAGCATAGTCCCTGATAGG - Intergenic
1161902672 19:7131270-7131292 TAATCAGCATAGTACCTGATAGG - Intronic
1166145148 19:40829142-40829164 TAATAAGCATAGCACCCGACAGG + Intronic
1168184408 19:54689964-54689986 TGATAAGCATAGTACCAAATAGG + Intronic
1168374508 19:55865089-55865111 TAATAAGCATAGTACCTGATAGG + Intronic
925017361 2:541436-541458 ACATAAGCATAGCACCTGACAGG - Intergenic
926856374 2:17260619-17260641 TGATAAGCATAGTACCTGATAGG + Intergenic
927376694 2:22424762-22424784 TGATAAGCATAGTACCCAATAGG + Intergenic
928056005 2:28055302-28055324 TAATAACCATAGTACTTGACAGG - Intronic
929019030 2:37532171-37532193 GCTTAAGTATAGTACCTGGCTGG - Intergenic
929135647 2:38621469-38621491 TAATAAGCATAGTACTCGACAGG - Intergenic
929718289 2:44336568-44336590 TAATAAGTATAGTACCCAATAGG - Intronic
930462007 2:51693212-51693234 TAATAAGCATAGCACCTGATAGG - Intergenic
930528896 2:52566932-52566954 TAATAAGCACAGTACCTGATAGG + Intergenic
930546500 2:52773982-52774004 TAATAAGCATAATACCTGACAGG - Intergenic
930558220 2:52927265-52927287 TAATAAGCATAGTACTTGATAGG - Intergenic
930635122 2:53796220-53796242 TAATGAATATAGTACCTGATGGG + Intronic
930836553 2:55799911-55799933 TAATAAGCATAGTACCTGATAGG - Intergenic
930928792 2:56855187-56855209 TAGTAAGCATAGTACCTGATAGG + Intergenic
931151659 2:59580878-59580900 TAATAAGTATAGTACCTGATAGG - Intergenic
931658849 2:64537312-64537334 TAATAAGCATAGTACCCGACAGG - Intronic
931779686 2:65568301-65568323 TAATCAGTATAGTACTTGATAGG + Intergenic
932033483 2:68215170-68215192 TAATAAGCATAGTAGCTGATAGG - Intronic
932507824 2:72253736-72253758 TAGTAAGCATAGTACCTGATAGG - Intronic
932913308 2:75828371-75828393 GAATAAGCATAGTACCTGATAGG - Intergenic
933101579 2:78265685-78265707 TAATAAGTATAGTACTGGATAGG - Intergenic
933182221 2:79240322-79240344 TAGTAAGCATAGTACCTGACAGG + Intronic
933455348 2:82512617-82512639 TGATAAGCGTAGTACCTAATAGG - Intergenic
933512687 2:83261284-83261306 TAATAGGCATAGTACCTGAGAGG - Intergenic
933593070 2:84254487-84254509 TAATAAGCATAGTACCTGACAGG + Intergenic
933605796 2:84381618-84381640 TAATAAGCATAGTACCCAACAGG - Intergenic
934664603 2:96161216-96161238 TAATAAGGATAGTACTAGACAGG - Intergenic
935459795 2:103316904-103316926 TAATAAACATAGTACCTGATAGG + Intergenic
935665958 2:105512928-105512950 TAATAAGCATAGTACCTGATAGG + Intergenic
936727396 2:115336464-115336486 TCATAATTATAGTATCTGATAGG + Intronic
936752758 2:115665997-115666019 TAATAAGCATAGTACCCAACAGG + Intronic
937723478 2:125130888-125130910 TCATAAGCATAATACCTGATAGG - Intergenic
938183432 2:129206222-129206244 GGATGAGTATGGTATCTGACTGG - Intergenic
938395016 2:130939006-130939028 TAATAAGTATAGTACTGGATGGG + Intronic
938990135 2:136619376-136619398 TAATAATCATAGTACCTGATAGG + Intergenic
939197088 2:138986747-138986769 TAATAAGCATAGTACGTGATAGG + Intergenic
939287219 2:140147614-140147636 TAATAAGCATAGTACCTGATAGG - Intergenic
939375043 2:141354099-141354121 TGATAAGCATAGTACCCGAGAGG - Intronic
939600314 2:144180993-144181015 TGATAAATATAGCTCATGACAGG - Intronic
939947823 2:148431492-148431514 TAATAAGCATACTACCTGATAGG + Intronic
940063620 2:149600626-149600648 TAATAAGCATAATACCTGATAGG - Intergenic
940208726 2:151234409-151234431 TAATAAGCATAGTACTTGATAGG - Intergenic
940455699 2:153896687-153896709 TAATAAGCATAGTACCCGATAGG + Intronic
940547526 2:155107573-155107595 TAATAAGCATAGTATCTGATAGG - Intergenic
940685487 2:156844977-156844999 TAATAAGCATAGTACCTGATGGG - Intergenic
941512842 2:166435836-166435858 AGTGAAATATAGTACCTGACTGG - Intronic
942128505 2:172851843-172851865 TAATAAGCATGGTACCCGACAGG - Intronic
942819421 2:180094042-180094064 TAATAAGAATAGTACCTGACAGG + Intergenic
942929859 2:181477012-181477034 TAATAGGCATAGTACCTGATAGG - Intronic
943056952 2:182993746-182993768 TAATAAGCATAGTACCTGATAGG - Intronic
943425007 2:187720444-187720466 TAATAAGTGTAGTACCCAACAGG + Intergenic
943889021 2:193261741-193261763 TAATAAATATAGTACCCAACAGG + Intergenic
944471804 2:200061673-200061695 TAATAAGCATAATACCTGATAGG - Intergenic
944649568 2:201816217-201816239 TAGTGAGTATAGTACCTGATAGG + Intronic
945241432 2:207680504-207680526 TACTAAGTGTAGTACCTGATAGG + Intergenic
945290963 2:208127070-208127092 TGATAAGTATAGTACCTGACAGG + Intergenic
945356750 2:208849455-208849477 TAACAAGTATAGTATCTGATAGG + Intronic
945487327 2:210412261-210412283 TAATGAGCATAGTACCTGATAGG + Intergenic
945541893 2:211098225-211098247 TGATAAGTATACTACCTGATGGG + Intergenic
945798578 2:214395629-214395651 TAATAAGCATAGTACCCGATAGG + Intronic
946598289 2:221331055-221331077 TGATAAGCATAGTACCCAATAGG - Intergenic
946983526 2:225246364-225246386 TGATAAGCATAGTACCAGATAGG + Intergenic
947027195 2:225749697-225749719 TAATAAGCATAGTACCCTACAGG - Intergenic
947953151 2:234165159-234165181 TGATAAGCGTAGTACCCAACAGG + Intergenic
948118001 2:235507906-235507928 TAGTAAGTACAGTACCTGATAGG + Intronic
1168741550 20:195900-195922 TAATAAGCATAGTACCTGATAGG + Intergenic
1169378154 20:5083959-5083981 TAATGAGCATAGTACCTGAAAGG + Intronic
1170190860 20:13643646-13643668 TAATAAGCATAGTACCTGATAGG + Intergenic
1170515415 20:17124486-17124508 TGGTGAGCATAGTACCTGATAGG - Intergenic
1170521201 20:17187364-17187386 TGATAAGCATAGTACCTGATAGG - Intergenic
1170798104 20:19567544-19567566 TAATAAGCATAGTACCTGATAGG - Intronic
1171117899 20:22542429-22542451 TAATCAGCATAGTACCTGATAGG + Intergenic
1171239656 20:23554891-23554913 TAATAAGCACAGTACCTGATAGG + Intergenic
1172402458 20:34661314-34661336 TAATAAGCACAGTACCCGACAGG + Intronic
1172784358 20:37456902-37456924 TAATAAGCATAGTACCTGATAGG + Intergenic
1174257602 20:49269709-49269731 TAATGAGCATAGTACCTGATAGG - Intronic
1174859118 20:54073428-54073450 TAATAAGTAAAATACATGACAGG - Intergenic
1176898309 21:14409773-14409795 TAATAAGCATAGTACCTGATTGG + Intergenic
1177019030 21:15829262-15829284 TAATAAGCACAGTACCTGATAGG + Intronic
1177483678 21:21727318-21727340 TAATAAGCATGGTACCTGACTGG + Intergenic
1177741961 21:25165543-25165565 TAATAAGCATAGTATCTGATAGG - Intergenic
1177797230 21:25791811-25791833 TAATAAGCATAGTATCTGATAGG + Intergenic
1177884972 21:26736050-26736072 TAATAAGCATAGTACCCAACGGG + Intergenic
1178046722 21:28703201-28703223 TAATAAGCACAGTACCTGATAGG - Intergenic
1178060332 21:28846738-28846760 TGATAAGCATAGTATCTGATAGG + Intergenic
1178099233 21:29249259-29249281 TAATAAGCATAGTACCTAATAGG + Intronic
1178224879 21:30704722-30704744 TAATAAGCATAGTACCGGATAGG + Intergenic
1178489513 21:33040182-33040204 TAATAAGCATAGTACCGGATAGG + Intergenic
1179253256 21:39692068-39692090 TAATAAGCATGGTACCTGATAGG + Intergenic
1182969787 22:34563038-34563060 TACTAAGTATAGTACCCAACAGG + Intergenic
1184156544 22:42671258-42671280 TGGCAAGCACAGTACCTGACGGG - Intergenic
1184438496 22:44494921-44494943 TGGTAAGACTAGTACCTGCCAGG - Exonic
950597956 3:14002357-14002379 TAATAAACATAGTACCTGATAGG + Intronic
950848429 3:16037992-16038014 TAATGAGTATAGCACCTGATAGG + Intergenic
950947690 3:16966874-16966896 TAATAAGCATAGTACCTGTTAGG + Intronic
951499343 3:23366654-23366676 TAATAAGCATAGTACCCAACAGG - Intronic
951785343 3:26412618-26412640 TGGTAAGCATAGTACCTGACAGG + Intergenic
952408926 3:33029838-33029860 TAATAAGCATAGTACCTGATAGG - Intronic
952667624 3:35925973-35925995 TAATAAGCATAGTACCTGATAGG + Intergenic
953230619 3:41061973-41061995 TAATAAGCATAGAACCTGACAGG + Intergenic
953783436 3:45892603-45892625 TAATAAGCATAGTACCTGACTGG - Intronic
954771917 3:52978445-52978467 TGGTAAGTATAGTTCCTTAAGGG - Intronic
955149195 3:56349943-56349965 TAATAAGCATAGTACCTGATAGG - Intronic
955471614 3:59292418-59292440 TAATAAGCATAGTACCTGATAGG + Intergenic
955865176 3:63374473-63374495 TAATAAGCATAGTACATGACAGG - Intronic
956283289 3:67582217-67582239 TAATAAGCATAGTACCTGATAGG + Intronic
956577447 3:70768918-70768940 TAATAGGCATAGTACCTGATAGG + Intergenic
957479983 3:80780287-80780309 TAATAAGCATAGTACCTGATAGG - Intergenic
957535713 3:81500994-81501016 TAATAAGCATAGTACCTGATGGG - Intronic
957879387 3:86190626-86190648 TAATAAGCATAGTACCTGATAGG - Intergenic
957901361 3:86497622-86497644 TAATAAACATAGTACCTGATAGG - Intergenic
957935206 3:86933576-86933598 TGGGAAGTCTAGTACTTGACAGG + Intergenic
957951321 3:87131119-87131141 TAATAAGTATAGTACCAGATAGG + Intergenic
958696155 3:97529250-97529272 AGCTAAGTAAAGTACCTAACAGG - Intronic
958875337 3:99609826-99609848 TAATAAACATAGTACCTGATAGG + Intergenic
959007392 3:101035743-101035765 TAATAAGCATAGTACCTGATAGG - Intergenic
959213131 3:103414649-103414671 TACTAAGCACAGTACCTGACAGG - Intergenic
960279414 3:115764753-115764775 TAATAAGCATAGTACCAAACAGG + Intergenic
960719243 3:120609539-120609561 TAATAAGCATAGTACCTGATAGG + Intergenic
960750495 3:120946505-120946527 TGATAAATATAGTATTTAACTGG + Intronic
960778408 3:121289009-121289031 TAATAAGTATAGTGCCTGGTAGG - Intronic
961082248 3:124036166-124036188 TAATAAGCATAGTACCTGATAGG + Intergenic
962341612 3:134590123-134590145 TGATAAGCATAGTACCCAATAGG - Intergenic
962695452 3:137943226-137943248 TTAAAAGCATAGTACTTGACTGG + Intergenic
962921477 3:139954077-139954099 TAATAAGCAGAGTACCTGATAGG + Intronic
963075085 3:141338683-141338705 TAACAAGCATAGTACCTGATAGG - Intronic
963550833 3:146720810-146720832 TAATAAGCATAGTACCTCATAGG + Intergenic
963677112 3:148326149-148326171 TAGTGAGCATAGTACCTGACAGG - Intergenic
963963118 3:151332846-151332868 TGATAAGCATGGTACCGGATAGG + Intronic
964256902 3:154785530-154785552 TGATAATTATAGTACCCAATAGG + Intergenic
964593627 3:158396227-158396249 TGATAAGCATAGTACCTGATAGG - Intronic
965031224 3:163370484-163370506 TAATAAGCATAGTACCTGATAGG - Intergenic
965033940 3:163409769-163409791 TGAAAAGAATAATACCTAACTGG + Intergenic
965036723 3:163449386-163449408 TAATAAGCATAGTATCTGACAGG - Intergenic
965087889 3:164123081-164123103 TAATAAGTATAGTACCTGATAGG - Intergenic
965152509 3:164997592-164997614 TAATAAGCATAGTACTTGACAGG + Intronic
965466781 3:169039616-169039638 TAATAAGTATAGTACCTGATAGG - Intergenic
965725915 3:171715869-171715891 TACTAAGCATAGTACCTGACAGG + Intronic
965877538 3:173345373-173345395 TAATAAGCCTAGTACCTGATAGG - Intergenic
966572858 3:181466419-181466441 TAATAAACATAGTACCTGATAGG + Intergenic
966771167 3:183504808-183504830 ACATAAGCATAGTACCTGATAGG + Intronic
966964475 3:184976572-184976594 TGGTAAGCATAGTACCCGATAGG + Intronic
967564356 3:190956346-190956368 TAAGGAGTATAGTACCTGACAGG - Intergenic
967605537 3:191440958-191440980 TAATAAGCATAGTACCTAATAGG - Intergenic
970298269 4:14654684-14654706 TAATAAACATAGTACCTGATGGG - Intergenic
970653779 4:18207790-18207812 TAATAAGCATAGTACCTAATAGG + Intergenic
970715716 4:18920188-18920210 TGATAGGTATAGTACGACACAGG + Intergenic
971566901 4:28156208-28156230 TAATGAGCAGAGTACCTGACAGG + Intergenic
971958945 4:33459377-33459399 TAATAAGCATAGTACCTGATAGG - Intergenic
972126157 4:35768801-35768823 TGATAAGTAGAGAAACTCACAGG + Intergenic
972967603 4:44530734-44530756 TAATAAGCATAGTACCCAACAGG + Intergenic
973012687 4:45095672-45095694 TAATAAGCATAGTACCTGATCGG - Intergenic
974411528 4:61547372-61547394 TAATAAGCATAGTACCTGATAGG + Intronic
974742614 4:66025601-66025623 TAATATGCATAGTACCTGAAAGG - Intergenic
974745498 4:66069815-66069837 TAATAAGCATAGTACCTGATAGG + Intergenic
974759783 4:66260108-66260130 TAATAAGCATAGTATCTGATAGG + Intergenic
974766001 4:66347311-66347333 TAATACACATAGTACCTGACAGG - Intergenic
974795304 4:66741535-66741557 TAATAAGCATAGTATCTGATAGG + Intergenic
974914624 4:68164200-68164222 TGATAAGCATACTACCTGATAGG - Intergenic
975555438 4:75659755-75659777 TGATAGGTATATTACCTTAGGGG - Intronic
975667788 4:76750553-76750575 AGGTAAGCATAGTACCTGATAGG - Intronic
976059961 4:81116136-81116158 TAATAAGCATAGTACCTGATAGG + Intronic
977386012 4:96340257-96340279 TGATAAGCATAGTACCTGATAGG - Intergenic
977543017 4:98340911-98340933 TAATAAGCATAGTACCCGATAGG - Intronic
977651829 4:99478995-99479017 TAATAAGCATAGTACCTCATAGG + Intergenic
977769790 4:100844733-100844755 TAGTGAGCATAGTACCTGACAGG - Intronic
978063507 4:104367267-104367289 TAATAAGCATAGTACTTGATAGG - Intergenic
978206025 4:106082477-106082499 TAGTGAGCATAGTACCTGACAGG - Intronic
978217438 4:106221854-106221876 TAATAAGCATAGTACCAGACAGG - Intronic
978243726 4:106548397-106548419 TAATAAGCATAATACCTGATAGG - Intergenic
978405635 4:108375906-108375928 TGGTAAGCATAGTACCTAACAGG + Intergenic
978902403 4:113968149-113968171 TGATCATTATAGTACCTCATGGG - Intronic
978982746 4:114969428-114969450 CGATAAGCATAGTATCAGACAGG + Intronic
979154364 4:117364241-117364263 TAATAAGCATAGTATCTGATAGG - Intergenic
979370515 4:119880500-119880522 TAATAACTACAGTACCTGATAGG - Intergenic
979897768 4:126181348-126181370 TAGTGAGTATAGTACCTGACAGG - Intergenic
980046929 4:127999544-127999566 TCATGAGCATAGTACCTGATAGG - Intronic
980106837 4:128595890-128595912 TGACAAGAATAGTACCAGGCTGG - Intergenic
980144649 4:128966962-128966984 TAATGAGCATAGTACCTGATAGG + Intronic
980299943 4:130976553-130976575 TAATAAGCAGAGTACCCGACAGG + Intergenic
980507487 4:133741394-133741416 TAATAAGCATAGTACCCAACAGG + Intergenic
980528418 4:134018462-134018484 TAATAAGCATAGTACCCAACAGG + Intergenic
980578857 4:134721933-134721955 TATTAAGTATAGCACCTGAGAGG - Intergenic
980830225 4:138122058-138122080 TAATAAGTATAGTACCTGATAGG - Intergenic
981241330 4:142479846-142479868 TAATAAGCATAGTACCTGATAGG - Intronic
981252507 4:142620543-142620565 TAATAAGCATAGTACCTGATAGG - Intronic
981444784 4:144823091-144823113 TGATAAGCATGGTACCTGACAGG + Intergenic
981466669 4:145080235-145080257 TAGTAAGTATAGTACCTAATAGG - Intronic
981627153 4:146771362-146771384 TAATAAGCATAGTATCTGATAGG + Intronic
981785864 4:148479057-148479079 TGATAAGCATATTACCTGATAGG + Intergenic
981868264 4:149454504-149454526 TAATAAGCATAGTACCTGATAGG - Intergenic
983333264 4:166359115-166359137 TAATAAGTATAGTACCTTCTAGG + Intergenic
984870674 4:184322292-184322314 TCATAAGAATAGTACCTGACAGG + Intergenic
985027639 4:185754336-185754358 TAATAAGCATAGTACTTGATAGG - Intronic
985395879 4:189543334-189543356 TAATAAGCATAGTACCTGATAGG - Intergenic
985839225 5:2293568-2293590 TGATAAGCATGGTACCTGATAGG - Intergenic
986473690 5:8101878-8101900 TAATAAGTGTAGTACCTAATAGG + Intergenic
986549962 5:8941628-8941650 TAGTAAGTATAGTACCTGATAGG - Intergenic
986901996 5:12447247-12447269 TAGTAAGCATAGTACCTGACAGG + Intergenic
986998217 5:13631788-13631810 TAATAAGCATAGTACATGATGGG - Intergenic
987018549 5:13846237-13846259 TAATAAGCATAGTACCTGATAGG + Intronic
987159510 5:15126664-15126686 TAATAAGCATAGTACCTGATAGG + Intergenic
987430498 5:17826785-17826807 TAATAAGCACAGTACCTGATAGG - Intergenic
987584010 5:19831075-19831097 TAATAAGCATAGTACCTGATAGG - Intronic
987908810 5:24114818-24114840 TAATAAGCATAGTACCTGATGGG + Intronic
987966975 5:24890144-24890166 TAGTAAGTATAATATCTGACAGG - Intergenic
988091995 5:26554901-26554923 TAATAAGCATAGTACCTGACAGG - Intergenic
988675095 5:33425006-33425028 TAATAAGCATAGTACCTGATGGG + Intergenic
988976285 5:36519492-36519514 TAATAAGCATAGTGTCTGACAGG - Intergenic
989013454 5:36901054-36901076 TAATGAGCATAGTACCTGACAGG + Intronic
989208948 5:38841178-38841200 TAATAAGCATAGCACCTGATAGG + Intergenic
989298894 5:39864801-39864823 TAATAAGTGTAGGACCTGACAGG + Intergenic
989325518 5:40188571-40188593 TGACAAGTATAATGACTGACAGG + Intergenic
989490391 5:42046040-42046062 TAATAAGTATAATACCTGAGAGG - Intergenic
989526495 5:42459552-42459574 TAATAAGCATAGTATCTGATAGG - Intronic
989770816 5:45143143-45143165 TAATAAGCATAGTACTTGATAGG + Intergenic
990024507 5:51168954-51168976 TACTAAGCATAGTACCTGATAGG - Intergenic
990052958 5:51530807-51530829 TAATAAGCACAGTACCTGATAGG - Intergenic
990062786 5:51672802-51672824 TGATAAGCATAGTACCCAATAGG + Intergenic
990091535 5:52057149-52057171 TAATAAGCATAGTACCTGATAGG + Intronic
990433915 5:55768233-55768255 TAATAAGCATAGTCCCTGATAGG + Intronic
990537621 5:56738434-56738456 TGACAAGTATTCAACCTGACTGG + Intergenic
991121281 5:63017426-63017448 TAATAAGCATAGTATCTGATAGG + Intergenic
991558131 5:67919166-67919188 TAATCAGCATAGTACCTGATAGG + Intergenic
991958907 5:72022055-72022077 TAATAAGCATAGTACTTGATAGG + Intergenic
992056314 5:72995003-72995025 TAATAAGCACAGTAACTGACAGG - Intronic
992966166 5:82002824-82002846 TGATAAGCATAGTATCCGATAGG - Intronic
993213871 5:84993845-84993867 TAATAAGCATAGGACCTTACAGG + Intergenic
993238736 5:85351274-85351296 TAATAAGCATAGTACCTGATAGG + Intergenic
993258388 5:85623334-85623356 TAATAAACATAGTACCTGATAGG - Intergenic
993362259 5:86992223-86992245 TAATAAGCATAGCACCTGATAGG + Intergenic
993446830 5:88023317-88023339 TAATAAGAATGGTATCTGACAGG + Intergenic
993459191 5:88162133-88162155 TAATAAGCATATTACCTGATTGG + Intergenic
993465645 5:88243191-88243213 TAATGAGCATAGTACCTGATAGG + Intronic
993633857 5:90320309-90320331 TAATAAGCATAGTACCCGATAGG + Intergenic
993759936 5:91782440-91782462 TAATAAGCATGGTACCTGATAGG + Intergenic
993794902 5:92255109-92255131 CAATAAGCATAGTACCTAACAGG - Intergenic
993967720 5:94378209-94378231 TAATAAGCATAGCACCTGACAGG + Intronic
994129222 5:96205421-96205443 TAATAAGCATAGTACCTGATAGG + Intergenic
994176584 5:96718430-96718452 TGATAAGCACAGTACCTGATAGG - Intronic
994200094 5:96963842-96963864 TGATCAATATACTACCTTACTGG - Intronic
994412838 5:99431216-99431238 TAATGAGCATAGTACCTGATAGG + Intergenic
994471303 5:100211591-100211613 TAATAAGGATAGTACTCGACAGG - Intergenic
994481003 5:100334504-100334526 TAATGAGCATAGTACCTGATAGG - Intergenic
995387090 5:111600065-111600087 TAATAAGCATAGTACCCAACGGG + Intergenic
995603794 5:113828618-113828640 TGATAAGCATACCACCTGATAGG + Intergenic
995778603 5:115752126-115752148 TGATAAGCATAGTACCCAATAGG + Intergenic
995994937 5:118286436-118286458 TAATAAGCATAGTACCAGATAGG + Intergenic
996025869 5:118645386-118645408 TAATGAGCATAGTACCTGATAGG - Intergenic
996150320 5:120026767-120026789 TAATAAGCATAGTACCTAATAGG + Intergenic
996180586 5:120414402-120414424 TAATAAGCATAGTACCCGACAGG - Intergenic
996318248 5:122185511-122185533 TAATAAGCATAGTATCTGATAGG + Intergenic
997188575 5:131906897-131906919 TAATAAGCATAGTACCTGATAGG - Intronic
998688165 5:144553993-144554015 TAATAAGCATAGTACTTGATAGG + Intergenic
998692899 5:144606814-144606836 TGATAAGCATAGTATCTGAAAGG + Intergenic
999076128 5:148797327-148797349 AAATAAATATAGGACCTGACAGG + Intergenic
999076245 5:148798491-148798513 AAATAAGTATAGAATCTGACAGG - Intergenic
1000493034 5:161939261-161939283 TAATAAGCATGGTACCTCACAGG + Intergenic
1001178864 5:169499572-169499594 TAATAAACATAGTACCTGATAGG + Intergenic
1001181390 5:169523917-169523939 TAATAAGAATAGTACCTGATAGG - Intergenic
1001850965 5:174964781-174964803 CAATAAGTATAGTACCTGATAGG + Intergenic
1001869862 5:175142701-175142723 TAATCAGCATAGTACCTGACAGG + Intergenic
1001891196 5:175340545-175340567 TAATAAACATAGTACCTGAGAGG - Intergenic
1003242394 6:4356006-4356028 TAATAAGCATAGTACCTGATAGG + Intergenic
1004164443 6:13243692-13243714 TAATAAGCATAGTACCTGATAGG + Intronic
1004632042 6:17431189-17431211 TAATAAGCATAGCACCTGACAGG - Intronic
1004818004 6:19333472-19333494 TAATAAGCATAGTACTTGATAGG + Intergenic
1004860563 6:19800828-19800850 TAATAAGCACAGTACCTGATGGG - Intergenic
1004962473 6:20806087-20806109 TAATAAGTGTAGTACCTGTTAGG + Intronic
1005199146 6:23323474-23323496 TAATAAGGATAGTACCTGATAGG - Intergenic
1005771887 6:29082055-29082077 TGATAAGCATAGTATATGATAGG + Intergenic
1005902517 6:30229543-30229565 TAATAAGCGTAGTACCTGATGGG + Intergenic
1006217661 6:32459177-32459199 TAATAAGCATAGTATCTCACAGG - Intergenic
1006268090 6:32942040-32942062 TAATAAGTATAGTATCTGATAGG + Intronic
1006324658 6:33344566-33344588 TAACAAGCATAGTACCTGATAGG - Intergenic
1007258884 6:40548141-40548163 GGATAAAAATAGTACCTGGCTGG + Intronic
1008269953 6:49479994-49480016 TAATAAGCATAGTACCTGATAGG - Intronic
1008642462 6:53478620-53478642 TAATAAGCATAGTACCTGATAGG + Intergenic
1008716182 6:54292837-54292859 TGATAAACATAGTCCCTGATGGG + Intergenic
1009247392 6:61256149-61256171 TAATAAGCATAGTACCTGATAGG + Intergenic
1009599336 6:65778072-65778094 TAATAAGCATAGTACTTGATGGG - Intergenic
1009646578 6:66411032-66411054 TAATAAGCATAGTACCTGATAGG - Intergenic
1009656483 6:66552612-66552634 TAACAAGCATAGTACCTGATAGG - Intergenic
1009804700 6:68588497-68588519 TAATAAGCATAGTGCCTGATCGG + Intergenic
1009871302 6:69455031-69455053 TTATAAGCATAGTACCTGATAGG - Intergenic
1010178758 6:73059450-73059472 TAAAAAGCATAGTACCTGATAGG - Intronic
1010326951 6:74575456-74575478 TAATGAGTATACTACCTGATAGG + Intergenic
1010404417 6:75486709-75486731 TGATAAAAATAGTACCTCATAGG + Intronic
1010654125 6:78491508-78491530 TAATAAGCATAGTACTTGATAGG - Intergenic
1010811839 6:80309807-80309829 TAATAAGCATAGTAACTGATAGG + Intronic
1011253571 6:85398815-85398837 TGATAAGCATAGTACCTGACAGG - Intergenic
1011297034 6:85837494-85837516 TAATAAACATAGTACCTGATAGG - Intergenic
1011314138 6:86012616-86012638 TAATAAGCACAGTACCTGATAGG + Intergenic
1011396211 6:86911503-86911525 TAATAAGCATAGCACCTGATAGG - Intergenic
1011978074 6:93332986-93333008 TAATAAGCATAGTATCTGACAGG + Intronic
1012238891 6:96850047-96850069 TGATAAGCATGATTCCTGACAGG - Intergenic
1012396107 6:98799174-98799196 TAATAAGTATAGTACCCAATAGG - Intergenic
1012440710 6:99259867-99259889 TAATAAGTATGGTACCTGATAGG - Intergenic
1012639927 6:101597262-101597284 TAGTAAGCATAGTACCTAACAGG - Intronic
1012830504 6:104198769-104198791 GAATAAGCATAGAACCTGACAGG - Intergenic
1012834564 6:104248937-104248959 TAATAAGCATAGTGCCTGATAGG - Intergenic
1012991799 6:105933778-105933800 TAATAAGCATGGTACCTGATAGG + Intergenic
1013727626 6:113119116-113119138 TAATAAGCCTAGTACCTGATAGG - Intergenic
1013816262 6:114102089-114102111 AACTAAGTATAGTACCTGATAGG - Intronic
1014309226 6:119779454-119779476 TAATAAACATAGTACCTGATAGG - Intergenic
1014567223 6:122964395-122964417 CAATAAGCATAGTACCTGATAGG - Intergenic
1014841075 6:126220863-126220885 TAATAAGCATAGTAACTGATAGG + Intergenic
1015470885 6:133604906-133604928 TAATATGTATAGTACCTGGTAGG + Intergenic
1016484643 6:144523633-144523655 TGATGAGTATAGTTCCTTAAAGG + Intronic
1016616874 6:146060351-146060373 TAATAAGGATAGTACCCAACAGG + Intronic
1016652450 6:146478307-146478329 TAATAAGCATAGTACCCGATAGG + Intergenic
1017369189 6:153684519-153684541 TAATAAGCATAGTACCCAACAGG - Intergenic
1017869849 6:158478139-158478161 TAATAAGCATAGTACCCGACAGG - Intronic
1017929853 6:158942316-158942338 TAATAAGCATACTACCTGAGAGG + Intergenic
1018473309 6:164115362-164115384 TTATCAGTATTGTGCCTGACAGG + Intergenic
1019824502 7:3272571-3272593 TGATAAGAAAAGTACCTAGCAGG - Intergenic
1020076004 7:5259407-5259429 TAATAAGCACAGTACCCGACAGG - Intergenic
1020331058 7:7017427-7017449 TAATGAGCATAGTACCTGATAGG - Intergenic
1020375815 7:7485014-7485036 TAAGAAGCATAGTACCTGATAGG - Intronic
1020385721 7:7600053-7600075 TAATAAACATAGTACCCGACAGG - Intronic
1020497525 7:8875154-8875176 TGATAAGCATAGTACCTAACAGG - Intergenic
1020985903 7:15134134-15134156 TAATAAGTGTAGTACCTAATAGG + Intergenic
1021016290 7:15539245-15539267 TAATAAGCATAGCACCTGATAGG + Intronic
1021259433 7:18435294-18435316 TGATGAGCATAGCACCTGATAGG - Intronic
1021363129 7:19742223-19742245 TGAAAAGTATAGTACCTGATGGG - Intronic
1021530102 7:21634701-21634723 TAATGGGCATAGTACCTGACAGG - Intronic
1021618488 7:22527143-22527165 TAATAAGCATAGTACCTGATAGG - Intronic
1021650225 7:22825829-22825851 CAATAAGCATAGTACCTGATAGG + Intergenic
1021889928 7:25177910-25177932 TGATAAGCATAGTACCCAAGAGG + Intronic
1022579508 7:31536242-31536264 TGATGAGTATAGCAGCAGACTGG - Intronic
1022694903 7:32695078-32695100 TAATAAGCATAGTACCTGATAGG - Intergenic
1022928082 7:35076596-35076618 TAATAAGCATCGTACCTGATAGG - Intergenic
1023325257 7:39048310-39048332 TAATAAGCATATTACCTGATAGG + Intronic
1023657070 7:42434416-42434438 TGATAAGCATAGTACCCAACAGG + Intergenic
1023782875 7:43674037-43674059 TAATAAGCATAGAACCTGATAGG - Intronic
1024041005 7:45554215-45554237 TAATAAGCATAGTAACTGATAGG - Intergenic
1024217790 7:47262595-47262617 TAATAAGCATAGTACCTAATAGG - Intergenic
1024423318 7:49196159-49196181 TAATAAGCATAGTACCTTATAGG + Intergenic
1024947752 7:54828037-54828059 TAATAAGCATAGTACCCGATAGG - Intergenic
1025203077 7:56974154-56974176 TAATAAGCACAGTACCCGACAGG + Intergenic
1025668867 7:63602772-63602794 TAATAAGCACAGTACCCGACAGG - Intergenic
1026161855 7:67876451-67876473 TAATAAGCATAGTACCTGATAGG + Intergenic
1026264098 7:68781511-68781533 TAATAAGCATAGTACCTGATAGG - Intergenic
1026498590 7:70923963-70923985 TAGTAAGCATAGTACCTGATAGG + Intergenic
1026576223 7:71573781-71573803 TAGTAAGCATAGTACCTGATAGG + Intronic
1027561387 7:79735467-79735489 TAATAAGCATAATACCTGATTGG - Intergenic
1027577808 7:79952788-79952810 TAATAAGCATAGTAACTAACAGG - Intergenic
1027634321 7:80651276-80651298 TAATAAGCATAGTACCTGATAGG - Intronic
1027745749 7:82071745-82071767 TGAAAAGTATAGTTTCTGGCAGG - Intronic
1027825332 7:83107166-83107188 TGATAAGCATAGTACCTGATAGG + Intronic
1028343545 7:89752485-89752507 TAATAAGCATAGTACCTGATTGG - Intergenic
1028374195 7:90128992-90129014 TAATAAGCATAGTACCTGATAGG + Intergenic
1030421777 7:109315586-109315608 AAATAAGCATAGTACCTAACAGG - Intergenic
1030454404 7:109754923-109754945 TAATAAGCATAGTACCTTATGGG + Intergenic
1030807874 7:113938354-113938376 TAATAAGCATAATACCTGATAGG + Intronic
1031039149 7:116820469-116820491 TAATAAGCATAGTACCTGATAGG + Intronic
1031286869 7:119881529-119881551 TGATAAGTATAGCACCCCACAGG - Intergenic
1031290748 7:119930412-119930434 TAAGAAGCATAGTACCTGATAGG - Intergenic
1031405474 7:121380588-121380610 TAGTAAGCATAGTACCTGATAGG - Intronic
1031429277 7:121646741-121646763 TAATAAGCATAGTACCCAACAGG + Intergenic
1031542605 7:123013283-123013305 TGACATGCATAGTACCTGATAGG + Intergenic
1031550658 7:123108083-123108105 TAATAAGCATAGTATCTGAATGG + Intergenic
1031555311 7:123167933-123167955 TAATAAGCATAGTACCTGATAGG - Intronic
1031647738 7:124247420-124247442 TAATAAGCATAGTACCTGATAGG + Intergenic
1031807033 7:126319060-126319082 TAGTAAGCATAGTACCTGATAGG + Intergenic
1032625378 7:133586188-133586210 TAATAAATATAGTACCTGATAGG + Intronic
1032875638 7:136035169-136035191 TAATGAGCATAGTACCTGATGGG + Intergenic
1032960946 7:137033383-137033405 TAATAAGCATAGTACCTGATAGG - Intergenic
1033438463 7:141355814-141355836 TGGTGAGCATAGTACCTGACAGG + Intronic
1034064732 7:148125363-148125385 TAATAAGCATAGTACCTGATAGG + Intronic
1036436730 8:8741786-8741808 TAATGAGTATAGTACCTAAAAGG - Intergenic
1037028585 8:14072215-14072237 TAATAACCATAGTACCAGACAGG + Intergenic
1037261083 8:17009092-17009114 TAATAAGCATAGTACGTGATAGG - Intergenic
1037373030 8:18200574-18200596 TAATAAGCATAGTACTTGAGAGG - Intronic
1037541385 8:19875267-19875289 TAATAAGCATAGTGCCTGATAGG + Intergenic
1038317506 8:26500257-26500279 TAATAAGCATAGTACCTGAGAGG - Intronic
1038854345 8:31314740-31314762 TAATAAGCATAGTACCCGATAGG - Intergenic
1038906115 8:31904905-31904927 TGATAAGCATAGTATTTGATAGG - Intronic
1038967525 8:32591829-32591851 TAATAAGCATAGTACCCAACTGG - Intronic
1039245741 8:35606527-35606549 TGATAAACATAGTACCCCACAGG + Intronic
1039335006 8:36579151-36579173 TAATAAGCATAGTACCTAATAGG - Intergenic
1039793520 8:40893773-40893795 TAGTAAGCATAGTACCTGATAGG + Intronic
1040792295 8:51246321-51246343 TAATTAGCATAGTACCTGATAGG - Intergenic
1040911584 8:52524544-52524566 TAATAAGCATAGTACCCCACAGG + Intergenic
1040954633 8:52967345-52967367 TAATAAGCATAGTCCCTGAAAGG + Intergenic
1041065353 8:54077382-54077404 TAATAAGCGTAGTACCTGATAGG - Intronic
1041172387 8:55157624-55157646 TAATAAGCATAGTACCTGATGGG + Intronic
1041295146 8:56349121-56349143 TAATCAGCATAGTACCTGAGAGG + Intergenic
1041356076 8:57002056-57002078 TAGTAAGCATAGTACCTGATAGG + Intergenic
1042984034 8:74564057-74564079 TAATAAACATAGTACCTGATAGG + Intergenic
1043240460 8:77927239-77927261 TAATCAGCATAGTACCTGATAGG - Intergenic
1043778191 8:84297158-84297180 TGATGAGCATAGTACCTGATAGG + Intronic
1043994840 8:86800300-86800322 TGGTGAACATAGTACCTGACAGG + Intergenic
1044458060 8:92412058-92412080 TGATAAGCATAGTACCCAATAGG - Intergenic
1044597381 8:93971460-93971482 TTTTAAGAATAGTACATGACTGG + Intergenic
1044771026 8:95634360-95634382 TAATAAGAATAGTACCTGATAGG + Intergenic
1045610107 8:103829745-103829767 TAATGAGCATAGTACCTGATAGG - Intronic
1045613021 8:103870249-103870271 TGATAATAATAGTACTTCACAGG + Intronic
1045723940 8:105148750-105148772 TAATAAGCATAGTACCTGACAGG + Intronic
1045844138 8:106613697-106613719 TGATATGTATAGGACATAACAGG - Intronic
1045945871 8:107795245-107795267 TAATAAACATAGTACCTGACAGG - Intergenic
1046048201 8:108988022-108988044 TAATAAACATAGTACCTGATAGG - Intergenic
1046072025 8:109267227-109267249 TAATAAGCATAGTTCCCGACAGG + Intronic
1046279398 8:112005963-112005985 TAATTAGCATAGTACCTGATAGG + Intergenic
1046886184 8:119369747-119369769 TAATCAGCATAGTACCTGATAGG - Intergenic
1047025075 8:120815101-120815123 TAATAAGCATAGTACCTTATAGG + Intergenic
1047159095 8:122356491-122356513 TCATAAGCATAGTACCTGATAGG + Intergenic
1047433281 8:124811988-124812010 CAATAAGCATAGTACCTGATAGG + Intergenic
1047548412 8:125842454-125842476 TAATAAGTATAGTACCCAATAGG - Intergenic
1047641947 8:126830006-126830028 TAATAAGCATAGTACCTGATAGG - Intergenic
1048780392 8:137992769-137992791 TGATAAGCATAGTACCCAACAGG + Intergenic
1049115788 8:140686289-140686311 TGATAAGCATAATACCTGATAGG - Intronic
1050145448 9:2562401-2562423 TAATAAGCATAGTACCTGATAGG - Intergenic
1050933481 9:11361754-11361776 TAATAAGCATAGTACTTGATAGG - Intergenic
1050966390 9:11809508-11809530 TAATAAGCATAGTACCTGACAGG + Intergenic
1051267869 9:15326149-15326171 TAATAAGCAGAGTACCTGATAGG - Intergenic
1051551868 9:18338726-18338748 TAATAAACATAGTACCTGATAGG + Intergenic
1051886737 9:21901056-21901078 TAATAAGCATAGTACCTAAGAGG - Intronic
1051945497 9:22564917-22564939 TAATAAGCATAGTATCTGATAGG + Intergenic
1052005812 9:23346963-23346985 TGGTAAGCATAGTACCCAACTGG - Intergenic
1052185331 9:25587019-25587041 TAATAAGCATGGTACCTGATAGG - Intergenic
1052276751 9:26685407-26685429 TTATAAGAATAGTACCTCATGGG - Intergenic
1054750471 9:68899864-68899886 TAATAAGCATAGTACCTAATAGG + Intronic
1055015939 9:71618234-71618256 TGATAAGCATAGTACCTAATAGG - Intergenic
1055222470 9:73953384-73953406 TTTTATGTATAGTACCTCACAGG - Intergenic
1055472940 9:76631774-76631796 TAATGAGCATAGTACCTGATAGG + Intronic
1055782751 9:79837148-79837170 CCATAAGAATAGTATCTGACAGG + Intergenic
1055831865 9:80389093-80389115 TAATGAACATAGTACCTGACAGG - Intergenic
1055988024 9:82073138-82073160 TAATAAGTATAGTACCCAATAGG - Intergenic
1056146054 9:83730550-83730572 TAATAAGCATAGTAACTGATAGG - Intergenic
1056877925 9:90353248-90353270 AAATAAGCATAGTACCTGATAGG - Intergenic
1057348909 9:94278061-94278083 TGACAAGTATAGGTCTTGACTGG - Intronic
1057408087 9:94791700-94791722 TAATAAGCATAGTACCCGATAGG - Intronic
1057689770 9:97273447-97273469 CAATAAGCATAGTACCTGATAGG + Intergenic
1057990032 9:99758889-99758911 TAGTAAGCATAGTACCTGATAGG + Intergenic
1058073553 9:100626930-100626952 TAATAATCATAGTACCTGATAGG + Intergenic
1058199036 9:102015480-102015502 TAATAAGCATAGTACCTGATAGG - Intergenic
1058301888 9:103385032-103385054 TAATAGGCATAGTACCTGATAGG - Intergenic
1058720944 9:107763113-107763135 TGATAAGCATAGTACCTCATAGG - Intergenic
1058903790 9:109464442-109464464 TCATAAGCATAGTACCCGAAAGG - Intronic
1059493399 9:114688825-114688847 TGCTAAGCATAATACCTGATAGG + Intergenic
1059512042 9:114857692-114857714 TGGTGAACATAGTACCTGACAGG - Intergenic
1059622581 9:116023967-116023989 TAATAAGCATAGTATCTGACAGG + Intergenic
1059740495 9:117145094-117145116 TAATAAGCATAGTACTTGATAGG + Intronic
1060008410 9:120021054-120021076 TAAGAAACATAGTACCTGACAGG + Intergenic
1060122009 9:121000782-121000804 TAATAAGCATAGTACCTAATAGG + Intronic
1061823531 9:133242097-133242119 TAATAAGCATAGTACCCGATAGG - Intergenic
1185775405 X:2799193-2799215 CAATAAGCATAGTACCTGATAGG + Intronic
1185868360 X:3642512-3642534 TAATAAGCATCATACCTGACAGG - Intronic
1185921666 X:4099961-4099983 TAATAAGCATAGTATCTGATAGG + Intergenic
1185932502 X:4218693-4218715 TAATAAGCATAGTACCCGATAGG - Intergenic
1186310441 X:8311946-8311968 CAATAAGCATAGTATCTGACAGG - Intergenic
1186356503 X:8797676-8797698 TTATAAGCATAGCACCTGATGGG - Intronic
1186378213 X:9031659-9031681 TTATAAGCATAGTACCTGATGGG - Intronic
1186662545 X:11683635-11683657 TAATAAGCATAGTACCCGATGGG - Intergenic
1186795318 X:13042455-13042477 TTATAAGCATCGTACCTGATGGG - Intronic
1186904965 X:14101027-14101049 TAGTGAGTATAGTACCTGATAGG + Intergenic
1186920999 X:14280207-14280229 TAATAAGCATAGTACCCCACAGG + Intergenic
1187054283 X:15727292-15727314 TAATAAGCATTGTACCTGATAGG + Intronic
1187356544 X:18578387-18578409 TGATAGGTATACAACTTGACTGG + Intronic
1187593419 X:20743886-20743908 TAATAAGTATAGTATCTGATAGG - Intergenic
1187607323 X:20899873-20899895 AAATAAGCATAGTACCTGATAGG + Intergenic
1187845913 X:23537082-23537104 TGATAAGCATGGTACCTGATAGG - Intergenic
1187882130 X:23857126-23857148 TAATAAGCCTAGTACCTGATGGG - Intronic
1187945248 X:24420040-24420062 TAATAAGCATAGTACCTGATAGG + Intergenic
1188035054 X:25307970-25307992 TAATAAACATAGTACCTGATGGG + Intergenic
1188035126 X:25308879-25308901 TAATAAGTATAGTACCTGATAGG + Intergenic
1188148687 X:26645984-26646006 TAATAAGTATAGTACCTGATAGG + Intergenic
1188155234 X:26733765-26733787 TAATAAGCATAGTACCTGATAGG + Intergenic
1188172565 X:26945926-26945948 TGATAAGCATAGTATCTGAGAGG + Intergenic
1188228020 X:27625898-27625920 TAATAAGCATAGCACCTGATAGG - Intronic
1188295925 X:28448162-28448184 TAATAAGCATAGTACCAGATAGG - Intergenic
1188362306 X:29270964-29270986 TAATAAGCATAGTAGCTGATAGG + Intronic
1188521961 X:31048334-31048356 TGATAATTATCCTACCTCACAGG - Intergenic
1188573530 X:31618112-31618134 TAATAAGCATGGTACCTGATAGG - Intronic
1188635606 X:32426993-32427015 TAATAAGCATACTACCTGATAGG - Intronic
1188663013 X:32783505-32783527 TAATAAGCATAGTACCCAACAGG - Intronic
1188666449 X:32827534-32827556 TAATAAGTATGGTGCCTGATAGG + Intronic
1188850782 X:35129236-35129258 TAATTAGTATAGTGCCTGAGAGG + Intergenic
1189154633 X:38744835-38744857 TAGTAAGCATAGTACCTGATAGG - Intergenic
1189571226 X:42300037-42300059 TAATAAGCATAGTACCTGATAGG + Intergenic
1189584167 X:42440741-42440763 TAATAAGCATAGTACCTAATAGG - Intergenic
1189611239 X:42738393-42738415 TAATAAGCATAGTACCTGATAGG - Intergenic
1189736951 X:44080980-44081002 TAATAAGCATAGTACCCGACAGG + Intergenic
1189898310 X:45679513-45679535 TAATAAGCATAGTATCTGATAGG - Intergenic
1190127532 X:47720069-47720091 TAGTGAATATAGTACCTGACAGG - Intergenic
1190880655 X:54490222-54490244 TAATAAGCATAGTACCCGATAGG - Intronic
1190942972 X:55061346-55061368 TAATCAGCATAGTACCTGATAGG + Intergenic
1191219279 X:57969632-57969654 TAATAAGTATAGTACCCAATAGG + Intergenic
1191700429 X:64036150-64036172 TGGTAAGTATAGTACCCAATAGG - Intergenic
1192024985 X:67440418-67440440 TGATCAGTATAGTACCCAATAGG + Intergenic
1192063541 X:67856198-67856220 TAATAAGGATAGTACCTGATAGG - Intergenic
1192072023 X:67951060-67951082 TAATAAGCATAGTACCTGATAGG + Intergenic
1192339008 X:70246796-70246818 TAGTAAGCATAGTACCTGATAGG - Intergenic
1192767514 X:74157219-74157241 TAATAAGCATAGTACCTGATAGG - Intergenic
1192852683 X:74974226-74974248 TAATAAGCATAGTTCCTGATAGG - Intergenic
1192877365 X:75245831-75245853 TGATAAGCATAGTACCTGATAGG - Intergenic
1193020622 X:76788726-76788748 TAATGAGCATAGTACCTGATAGG - Intergenic
1193085150 X:77442343-77442365 TAATAAGCATAGTACCCGATAGG + Intergenic
1193264079 X:79447127-79447149 TAATGAGCATAGTACCTGACAGG + Intergenic
1193479218 X:82006811-82006833 TAATAAGTATAGTACCCAATAGG + Intergenic
1193488799 X:82121271-82121293 TGATAAGCATAGTAACTGATAGG - Intergenic
1193513953 X:82440207-82440229 TAATCAGCATAGTACCTGATAGG - Intergenic
1193515466 X:82456488-82456510 TGATGAGAATAGTACCTGATAGG - Intergenic
1193585378 X:83315137-83315159 TAATAAGCATGGTACCTGAGAGG + Intergenic
1193672565 X:84407162-84407184 TAATAAGCATAGTACCTGATAGG + Intronic
1193674929 X:84438496-84438518 CCATAAGTATAGTACCCAACAGG + Intronic
1193696614 X:84714906-84714928 TAATAAGCATAGTACCAGATAGG + Intergenic
1193732891 X:85122761-85122783 TGATAAGCATAGTACTTGATAGG + Intergenic
1193792190 X:85828312-85828334 TAATAAGCACAGTACCTGATAGG - Intergenic
1193801732 X:85945179-85945201 TAATAAGCATAGTACCTGATAGG - Intronic
1193812935 X:86073027-86073049 TAATAAGCATAGTACTTGATAGG + Intergenic
1193823204 X:86191516-86191538 TAATAAGTATAGTACCTTATAGG - Intronic
1193827982 X:86250090-86250112 TAATAAGCATACTACCTGATAGG - Intronic
1193836938 X:86355018-86355040 TAATAAGCATAGTACCTCATAGG + Intronic
1194061018 X:89198056-89198078 TAATAAGTGCAGTACCTGATAGG - Intergenic
1194251393 X:91579692-91579714 AAATAAGTATAGTACGTGATAGG + Intergenic
1194310135 X:92296349-92296371 TAGTAAGCATGGTACCTGACAGG + Intronic
1194469719 X:94278148-94278170 TGATAACATTAGTACCTCACAGG + Intergenic
1194550071 X:95286731-95286753 GTGTAAGTATAGTACCTGGCAGG - Intergenic
1195046996 X:101063354-101063376 TAGTAAGCATAGTACCTGATAGG + Intergenic
1195155695 X:102121772-102121794 TAATAAGCATAGTAGCTGATAGG - Intergenic
1195314161 X:103661498-103661520 TAATGAGTTTAGTACCTGATAGG - Intergenic
1195467671 X:105197866-105197888 TAATAAGCATAGTACCTGATAGG + Intronic
1196010544 X:110882933-110882955 TAATAAGCATAGTACCTCATAGG + Intergenic
1196015152 X:110931363-110931385 TAATAAGCATAGTACCTGATAGG - Intergenic
1196052337 X:111318835-111318857 TAATAAGCATAGTACCTGATAGG - Intronic
1196475301 X:116077662-116077684 TAATAAGTATAGTACCCAATAGG - Intergenic
1196727291 X:118907794-118907816 TAATAAGCATAGTACCTAATAGG + Intergenic
1197118818 X:122865995-122866017 TGATGAGAATAGGAGCTGACTGG - Intergenic
1197293792 X:124692323-124692345 TAATAAGCATAGTACCTGATAGG - Intronic
1197374810 X:125669568-125669590 TAATAAGCATAGTACCTGATAGG - Intergenic
1197568006 X:128112378-128112400 TGATAAGCATAGTCCCCAACAGG - Intergenic
1197598880 X:128503619-128503641 TGATAAGCATAGTACCCAATAGG + Intergenic
1197601088 X:128531062-128531084 TAGTAAGGATAGTACCTGATAGG - Intergenic
1197950055 X:131884996-131885018 TAATAAGCATAGTATCTGATAGG + Intergenic
1198196900 X:134372733-134372755 GGATAAAAATAGTACCTCACGGG - Intergenic
1198733235 X:139756858-139756880 TAAAAAGTATAGTACCTGATAGG - Intronic
1198945453 X:142008114-142008136 TGATAACCATAGTACCCGATAGG + Intergenic
1198954036 X:142107232-142107254 TAATAAGCACAGTACTTGACAGG - Intergenic
1199181951 X:144867964-144867986 TAATAAGTATAGTACCTGACAGG + Intergenic
1199338462 X:146647161-146647183 TAATAAGCATAGTACCTGATAGG + Intergenic
1199706602 X:150431518-150431540 TAATAAGCATAGTACCTGATAGG + Intronic
1199718025 X:150520429-150520451 TAATAAGCATAGTACCTGATAGG - Intergenic
1199816156 X:151398298-151398320 TAATAAGCATAGTACCCGATAGG + Intronic
1200020547 X:153201709-153201731 TTACAAGCATAGTACCTGATGGG + Intergenic
1200570334 Y:4820923-4820945 AAATAAGTATAGTACGTGATAGG + Intergenic
1200618427 Y:5410636-5410658 TAGTAAGCATGGTACCTGACAGG + Intronic
1200743951 Y:6885911-6885933 TGATGAGCATAGTACCTGATAGG - Intergenic
1201294512 Y:12452206-12452228 TAATAAGCATAGTACCTGATAGG - Intergenic
1201386558 Y:13446207-13446229 TAATATGCATAGTACCTGATAGG - Intronic
1201693216 Y:16792727-16792749 TAATTAGCATAGTACCTGATAGG + Intergenic
1201889402 Y:18925400-18925422 TAATAAGCATAGTACCAGATAGG - Intergenic
1202591082 Y:26483983-26484005 TGATAAGCATAGTACCTGATAGG + Intergenic