ID: 945293793

View in Genome Browser
Species Human (GRCh38)
Location 2:208150669-208150691
Sequence GGGATTTACAACCTAGGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945293790_945293793 -7 Left 945293790 2:208150653-208150675 CCAAAAAGGATGAATGGGGATTT No data
Right 945293793 2:208150669-208150691 GGGATTTACAACCTAGGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945293793 Original CRISPR GGGATTTACAACCTAGGAGT GGG Intergenic
No off target data available for this crispr