ID: 945299671

View in Genome Browser
Species Human (GRCh38)
Location 2:208204345-208204367
Sequence CTTTGTTGCCAGGATGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945299668_945299671 -2 Left 945299668 2:208204324-208204346 CCAGGGGAACGGTTACTAAATCT No data
Right 945299671 2:208204345-208204367 CTTTGTTGCCAGGATGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945299671 Original CRISPR CTTTGTTGCCAGGATGTGGA AGG Intergenic
No off target data available for this crispr