ID: 945306839

View in Genome Browser
Species Human (GRCh38)
Location 2:208266616-208266638
Sequence CCGTCCCCACTCGCCAGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945306839_945306847 8 Left 945306839 2:208266616-208266638 CCTTGTCTGGCGAGTGGGGACGG 0: 1
1: 0
2: 1
3: 10
4: 130
Right 945306847 2:208266647-208266669 TGGGGCCCTTGAGATTTCCTTGG 0: 1
1: 0
2: 0
3: 22
4: 235
945306839_945306845 -10 Left 945306839 2:208266616-208266638 CCTTGTCTGGCGAGTGGGGACGG 0: 1
1: 0
2: 1
3: 10
4: 130
Right 945306845 2:208266629-208266651 GTGGGGACGGAAGCCGGGTGGGG 0: 1
1: 1
2: 4
3: 26
4: 405

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945306839 Original CRISPR CCGTCCCCACTCGCCAGACA AGG (reversed) Intronic