ID: 945306845

View in Genome Browser
Species Human (GRCh38)
Location 2:208266629-208266651
Sequence GTGGGGACGGAAGCCGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 1, 2: 4, 3: 26, 4: 405}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945306835_945306845 -3 Left 945306835 2:208266609-208266631 CCGGCTGCCTTGTCTGGCGAGTG 0: 1
1: 0
2: 0
3: 39
4: 494
Right 945306845 2:208266629-208266651 GTGGGGACGGAAGCCGGGTGGGG 0: 1
1: 1
2: 4
3: 26
4: 405
945306829_945306845 9 Left 945306829 2:208266597-208266619 CCTCCCTATTCCCCGGCTGCCTT 0: 1
1: 0
2: 2
3: 20
4: 233
Right 945306845 2:208266629-208266651 GTGGGGACGGAAGCCGGGTGGGG 0: 1
1: 1
2: 4
3: 26
4: 405
945306830_945306845 6 Left 945306830 2:208266600-208266622 CCCTATTCCCCGGCTGCCTTGTC 0: 1
1: 0
2: 0
3: 11
4: 132
Right 945306845 2:208266629-208266651 GTGGGGACGGAAGCCGGGTGGGG 0: 1
1: 1
2: 4
3: 26
4: 405
945306834_945306845 -2 Left 945306834 2:208266608-208266630 CCCGGCTGCCTTGTCTGGCGAGT 0: 1
1: 0
2: 1
3: 51
4: 1631
Right 945306845 2:208266629-208266651 GTGGGGACGGAAGCCGGGTGGGG 0: 1
1: 1
2: 4
3: 26
4: 405
945306831_945306845 5 Left 945306831 2:208266601-208266623 CCTATTCCCCGGCTGCCTTGTCT 0: 1
1: 0
2: 1
3: 10
4: 199
Right 945306845 2:208266629-208266651 GTGGGGACGGAAGCCGGGTGGGG 0: 1
1: 1
2: 4
3: 26
4: 405
945306833_945306845 -1 Left 945306833 2:208266607-208266629 CCCCGGCTGCCTTGTCTGGCGAG 0: 1
1: 0
2: 0
3: 4
4: 79
Right 945306845 2:208266629-208266651 GTGGGGACGGAAGCCGGGTGGGG 0: 1
1: 1
2: 4
3: 26
4: 405
945306839_945306845 -10 Left 945306839 2:208266616-208266638 CCTTGTCTGGCGAGTGGGGACGG 0: 1
1: 0
2: 1
3: 10
4: 130
Right 945306845 2:208266629-208266651 GTGGGGACGGAAGCCGGGTGGGG 0: 1
1: 1
2: 4
3: 26
4: 405

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945306845 Original CRISPR GTGGGGACGGAAGCCGGGTG GGG Intronic