ID: 945310409

View in Genome Browser
Species Human (GRCh38)
Location 2:208305710-208305732
Sequence ATGATGAGGTTTACTTTATT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 232}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945310406_945310409 -7 Left 945310406 2:208305694-208305716 CCTGTTTTTAAAATGGATGATGA 0: 1
1: 0
2: 3
3: 63
4: 525
Right 945310409 2:208305710-208305732 ATGATGAGGTTTACTTTATTGGG 0: 1
1: 0
2: 1
3: 23
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945310409 Original CRISPR ATGATGAGGTTTACTTTATT GGG Intronic
903910220 1:26718859-26718881 ATGATAAAGTTTAATTTATTAGG + Intronic
907104593 1:51870994-51871016 ATGATGAGGTACACATTGTTTGG - Intronic
908096254 1:60742010-60742032 AATATGAGTATTACTTTATTTGG - Intergenic
909499624 1:76319574-76319596 ATGAATAGGTTTTCTATATTTGG + Intronic
909519884 1:76555509-76555531 ATGACCAGGTTCACTTTGTTTGG - Intronic
911313165 1:96322464-96322486 ATGAAGAAGTTTATTTTATGAGG + Intergenic
912030425 1:105235239-105235261 GAGATGAGGTTTTATTTATTAGG - Intergenic
914974426 1:152347265-152347287 ATGTTGAGTTTTACCTTCTTTGG + Intergenic
916199773 1:162258985-162259007 ATGATGAGGTTTACAAGATGAGG - Intronic
916749011 1:167707338-167707360 ATGATTAGGTTTTCTTGATTAGG + Intergenic
918102442 1:181387967-181387989 ATGATCAGGCTTGCTTTATAGGG - Intergenic
918525404 1:185458977-185458999 ATGATGAGTTTTACCTTGTTGGG + Intergenic
918553907 1:185776586-185776608 AGGATGAAGCTTACTTCATTAGG + Intronic
920722885 1:208404119-208404141 ATTATGAATTTTACCTTATTGGG - Intergenic
921379383 1:214508412-214508434 AGGATGAGGGTTACTTTTTATGG - Intronic
923334397 1:232954755-232954777 GTGATGAGTATTACTATATTAGG + Intronic
924044975 1:240019620-240019642 ATGTTCATGTGTACTTTATTTGG + Intronic
924410000 1:243794784-243794806 ATGATGTGCTTTGCTCTATTTGG - Intronic
924837867 1:247672542-247672564 ATCATGAGGTTGACTTTCTGTGG - Exonic
1062961718 10:1577468-1577490 CTGATCAGGTCTCCTTTATTTGG + Intronic
1063228252 10:4036448-4036470 CTGATGAAGTTCACTTTGTTTGG - Intergenic
1063253438 10:4299894-4299916 ATTGTGAACTTTACTTTATTGGG + Intergenic
1065979658 10:30879425-30879447 ATTATGAATTTTACTTTATTGGG - Intronic
1066399623 10:35063112-35063134 ATAATGAGATTTACCTTGTTTGG + Intronic
1068489494 10:57705444-57705466 ATGAAGAGGTTTTCTGGATTGGG - Intergenic
1068489731 10:57707714-57707736 ATGATTTGCTTTACTTTTTTGGG - Intergenic
1070275636 10:75003591-75003613 ATGATGACATTTATTTTAATAGG + Intronic
1071045152 10:81364532-81364554 ATCCTGAGATTTACTTTGTTGGG + Intergenic
1072953802 10:99871318-99871340 TTGATGAGGTCTAATTTATCTGG + Intergenic
1072992127 10:100206777-100206799 ATTTTGTGCTTTACTTTATTTGG + Intronic
1076314338 10:129530381-129530403 ATGGTGTGGTTTACTTTTTGTGG + Intronic
1077451249 11:2647623-2647645 ATCCTGAGGTTTTCTTTACTGGG + Intronic
1077754146 11:5007351-5007373 ATGATGAGGCTTTATTTGTTTGG + Intergenic
1078837813 11:15048621-15048643 ATCATGAGGTTTACTTTTCCAGG + Intronic
1079954421 11:26844983-26845005 ATGATAACGTCTACTTTATAGGG - Intergenic
1081074932 11:38659990-38660012 ATGATGATGCTTACTTTAGACGG + Intergenic
1083649658 11:64194452-64194474 GTGATGTGCTTTCCTTTATTTGG + Intronic
1084222712 11:67694207-67694229 ATGTTGAAGTTAACTTTTTTGGG + Intergenic
1085859730 11:80218404-80218426 ATCCTGAGCTTTTCTTTATTGGG - Intergenic
1086148019 11:83575843-83575865 ATGGTGAATTTTACTTTATTGGG - Intronic
1088000485 11:104874390-104874412 ATGATAAAGTTTAATTTATTAGG + Intergenic
1091925905 12:4348722-4348744 ATGATGATGTCTAATTTGTTGGG + Intronic
1093122274 12:15285268-15285290 ATGATAAACTTTACATTATTGGG - Intronic
1094580811 12:31732291-31732313 ATGATAACGTTTACTTTGTATGG - Intergenic
1094747656 12:33364180-33364202 ATGCTGATGTACACTTTATTTGG + Intergenic
1095090309 12:38098497-38098519 ATAATGAGGTTTATGTTTTTTGG - Intergenic
1095933274 12:47650660-47650682 ATTTTGATGTTTACTTTATGAGG - Intergenic
1099389634 12:82063406-82063428 ATATTGAGGTTTAATTTATAAGG - Intergenic
1101333669 12:103777760-103777782 ATGATGGGGTTGACTTCATGTGG - Exonic
1101745667 12:107539555-107539577 ATGCTGGGGTTGACTTTTTTAGG - Intronic
1102921146 12:116792569-116792591 TTGATGATGATTATTTTATTCGG + Intronic
1103132605 12:118482192-118482214 TTGATGAGGTTAACATAATTAGG + Intergenic
1103789811 12:123461681-123461703 ATGATCAGGTTTGCCTGATTTGG + Intronic
1105338093 13:19493721-19493743 ATAAAGAGGTTTACTTAAATCGG - Intronic
1106793313 13:33178839-33178861 ATGTGGAGATTTTCTTTATTTGG - Intronic
1108275499 13:48805348-48805370 ATAATGAGGTTGACTTTGCTTGG - Intergenic
1108780066 13:53819373-53819395 CTGATGAGGTTTTGTTTTTTTGG + Intergenic
1109623203 13:64937892-64937914 AAAATGGGGTTTACATTATTAGG + Intergenic
1112782933 13:102921716-102921738 CTGATGAGGGTTACTACATTTGG + Intergenic
1115320245 14:32072786-32072808 TTTATGGGGTTAACTTTATTGGG + Intergenic
1115369577 14:32597072-32597094 AAGATGAGGTATTCATTATTAGG - Intronic
1115437589 14:33393197-33393219 ATCAAGAGATTTACTTAATTTGG + Intronic
1115534780 14:34362838-34362860 ATGTTGTGGTTTATGTTATTAGG - Intronic
1116005984 14:39290611-39290633 AAGAAGAGGTTTACTTGTTTGGG + Intronic
1116338617 14:43692756-43692778 ATGATAAGATTTTCTTTGTTGGG - Intergenic
1118332860 14:64827222-64827244 AGGATGCTGTTTACTTTGTTGGG - Intronic
1118557047 14:67035772-67035794 GTCATGGGTTTTACTTTATTGGG - Intronic
1120511273 14:85418019-85418041 AAGATGAGGTTTGCACTATTAGG - Intergenic
1120523007 14:85546659-85546681 ATGTTAAGGTTTCCTTTATAGGG - Intronic
1126263493 15:46723995-46724017 ATGTTGAGGTTTATTTTATTTGG + Intergenic
1127866115 15:63034523-63034545 ATGATCAGTTTTGCTTTAGTTGG - Intergenic
1130455953 15:84108316-84108338 ATAATGACCTTTACTTTAGTTGG + Intergenic
1130736111 15:86551521-86551543 CTGATGAGGTTTATTTTAAGTGG + Intronic
1131760230 15:95614759-95614781 ATGAAGATTTTTACTTTGTTTGG - Intergenic
1134755806 16:16666242-16666264 ATGATAAGCTTTCCTTTAATAGG - Intergenic
1134990260 16:18692923-18692945 ATGATAAGCTTTCCTTTAATAGG + Intergenic
1135863682 16:26080826-26080848 CTGATCAGGTTTGCTTTAGTGGG + Intronic
1139054100 16:63160476-63160498 ATGTTGAGCATTACTTTATGTGG - Intergenic
1139131150 16:64147631-64147653 ATGATGATGTTTACTTTTATCGG - Intergenic
1140630285 16:76844359-76844381 CTGATGAGGTTTTCTTTTATAGG + Intergenic
1146075309 17:29723229-29723251 ATGATAAGCTTTTTTTTATTTGG - Intronic
1146764404 17:35506257-35506279 ATGATGTGGTTCTCTTAATTAGG + Intronic
1149063678 17:52454907-52454929 ATGATGAGGTTTAGTTATGTGGG + Intergenic
1149494744 17:57110114-57110136 ATGATGAGGTCGACCTTCTTAGG - Exonic
1150426194 17:65078899-65078921 ATGCTGAGGATCACTTTCTTGGG + Intergenic
1153370391 18:4308820-4308842 AAGATGAAGTTCATTTTATTTGG - Intronic
1153526712 18:6001952-6001974 TTCTTGAGGTTTACTTTACTTGG - Intronic
1155123328 18:22844670-22844692 ATCTTGAGGCTTAATTTATTAGG + Intronic
1155346712 18:24864618-24864640 ATGATCAGTTTGAGTTTATTAGG - Intergenic
1155757474 18:29519191-29519213 ATTATGAGGTTACCTTTATAAGG - Intergenic
1156238477 18:35228017-35228039 ATGATCATGTTTACTTTTTGTGG - Intergenic
1158303557 18:56079641-56079663 AGGATGAGGTTGACTTTATATGG - Intergenic
1159891817 18:73960104-73960126 ATGATGATGTGTCCTTTCTTAGG - Intergenic
1164830767 19:31318833-31318855 ATGATGAGATTTCCATTATCAGG + Intronic
1166824558 19:45601001-45601023 ATGAGGAGGTTTTCTTTTCTGGG - Intronic
927529819 2:23785632-23785654 TTGATGAGGTATACATAATTTGG + Intronic
928215813 2:29360538-29360560 ATGTTGAGATTTGATTTATTGGG + Intronic
930189869 2:48446468-48446490 ATCATGAGGTTCAAATTATTTGG + Intronic
937571488 2:123368180-123368202 ATGATGAAAGTTACTTTAGTAGG + Intergenic
939256465 2:139750348-139750370 AAGTTGTGGGTTACTTTATTAGG - Intergenic
939844781 2:147229782-147229804 ATGATGGCGTTTAATTTTTTTGG - Intergenic
940739588 2:157492268-157492290 TTGATGAGGTTTAATTAACTTGG - Intergenic
943155894 2:184176340-184176362 ATGATTATGTATACTTTATTTGG - Intergenic
943411194 2:187550523-187550545 ATTATGAATTTTACCTTATTGGG - Intronic
945310409 2:208305710-208305732 ATGATGAGGTTTACTTTATTGGG + Intronic
947992741 2:234499246-234499268 ATGATGATGTTTCCGTTATTGGG + Intergenic
1169388669 20:5171889-5171911 ATGATGAGGCCGTCTTTATTGGG + Intronic
1170661139 20:18341541-18341563 GTTTTGAGGTTTTCTTTATTAGG - Intergenic
1171537866 20:25913071-25913093 ATGAAGAGGTTAACTTTTTAGGG + Intergenic
1174973940 20:55309458-55309480 ATGATGAGGTTTTCTAAATAAGG - Intergenic
1176735473 21:10542153-10542175 ATAAAGAGGTTTACTTAAATCGG + Intronic
1177772199 21:25529550-25529572 CTTATGAATTTTACTTTATTTGG - Intergenic
1177864557 21:26497732-26497754 ATTATTAGTTTTACATTATTAGG - Intronic
1178200565 21:30398448-30398470 ATGATTAGGTATAAATTATTAGG + Intronic
1179527440 21:41991580-41991602 ACGATGTGGTTTACTTTGTTGGG + Exonic
1183533665 22:38381210-38381232 ATAAAGAGGTTTACTTAAATAGG - Intronic
950982348 3:17320624-17320646 ATGATGAGTGTTATGTTATTAGG - Intronic
952428122 3:33196169-33196191 ATGGTGTGGTTGGCTTTATTTGG - Intronic
952660145 3:35835865-35835887 ATTATGGTGTTTGCTTTATTGGG - Intergenic
953071103 3:39520765-39520787 ATCCTGAGGTTTACTGTATCAGG - Intronic
954500195 3:51006329-51006351 CTCATGAAGTTTACATTATTGGG - Intronic
955664139 3:61332452-61332474 ATGATTAGGTTTTCTTTCCTAGG - Intergenic
955855974 3:63274561-63274583 ATGTTGAGCTTTACTAAATTGGG + Intronic
956399359 3:68860836-68860858 ATGATGTGATTTAGCTTATTGGG - Intronic
957998711 3:87725390-87725412 CTGATGGGGTTTTCTTTATAGGG + Intergenic
959270159 3:104197056-104197078 ATCCTGAATTTTACTTTATTTGG + Intergenic
959879903 3:111431572-111431594 ATCATGGGCTTTACTTTGTTGGG - Intronic
960138296 3:114127827-114127849 ATGATGTGGTCCACTATATTGGG + Intergenic
962854628 3:139332732-139332754 ATTATGAATTTTACTTTTTTGGG - Intronic
962938215 3:140101132-140101154 TTGATAATGTCTACTTTATTAGG + Intronic
965147113 3:164920996-164921018 ATTCTGAGATTGACTTTATTTGG - Intergenic
965259586 3:166464680-166464702 ATGATTACATTTATTTTATTAGG - Intergenic
965315663 3:167187111-167187133 CTGATGAGCTTTATTTTGTTCGG + Intergenic
965709979 3:171547550-171547572 ATGAAGAGGTTCCCTTTATGGGG - Intergenic
965985022 3:174741294-174741316 ATCATGAGATTGACTTTATTAGG + Intronic
966964775 3:184980044-184980066 CTTATGAGGTTTAGTTTGTTTGG + Intronic
966975775 3:185082168-185082190 AGGATGAGGTTTACTTGGCTGGG - Exonic
967446230 3:189569893-189569915 ATGAAGAGCTTTACTTGATATGG - Intergenic
971091869 4:23354799-23354821 GTGATGAAGTCTAGTTTATTGGG + Intergenic
971627907 4:28947182-28947204 AAGATGAGGTATTGTTTATTAGG + Intergenic
971693631 4:29869544-29869566 ATGATGTGTTTTATTTTAGTAGG - Intergenic
971803454 4:31322707-31322729 ATAATGACTTTTACTTTATCTGG - Intergenic
971930705 4:33078903-33078925 ATGTTGGGGTTTAGTTTATAAGG + Intergenic
972453531 4:39229470-39229492 ATAATTAGGTTTATTTTATTAGG - Intronic
973080619 4:45987794-45987816 ATGACAAGATTTTCTTTATTAGG - Intergenic
973301710 4:48592423-48592445 TTTATTAGGTTTACTTTGTTAGG - Intronic
974310829 4:60208253-60208275 ATTAGGAGGTTTGCTTTATAAGG + Intergenic
975877712 4:78863812-78863834 ATAATAAGTTTGACTTTATTAGG - Intronic
975956491 4:79846858-79846880 ATGTTCAGGTTAAATTTATTAGG - Intergenic
976551444 4:86400472-86400494 ATGGGGAGTTTTAATTTATTTGG + Intronic
980415412 4:132482657-132482679 CTGAGGAGATTGACTTTATTTGG - Intergenic
980600423 4:135017824-135017846 ATCATGACATTTACTTCATTTGG - Intergenic
981095040 4:140770327-140770349 ATGAAGAGGTTCTCTTGATTGGG - Intergenic
982490027 4:156018491-156018513 ATGATGTGCTTTCCTTTATCTGG + Intergenic
982828454 4:160028929-160028951 ATAATGAGTTTTATTATATTGGG + Intergenic
982829918 4:160046069-160046091 TTTATGAAGTTTACTTTCTTTGG - Intergenic
983346609 4:166535101-166535123 ATTATGAATTTTACATTATTAGG - Intergenic
983473136 4:168181412-168181434 ATGATAAAGTTTTCTTCATTAGG + Intronic
983782859 4:171694616-171694638 ATGATTAGGTTTTCTTCATGTGG + Intergenic
983946231 4:173588529-173588551 ATGATGAAGTTTACTTCCTAAGG + Intergenic
984151067 4:176131260-176131282 ATGCTGAGCTTTAATTTATAGGG + Intronic
985819494 5:2150012-2150034 AAAATGAGGGTTTCTTTATTAGG + Intergenic
989118666 5:37981672-37981694 ATGATGAAATCTATTTTATTTGG + Intergenic
990103596 5:52226566-52226588 TTGCTGTGGTTTTCTTTATTTGG + Intergenic
992307800 5:75461481-75461503 ATCATCTGCTTTACTTTATTTGG - Intronic
992923740 5:81557900-81557922 ATTATGAATTTTACTTTGTTGGG + Intronic
996813557 5:127546868-127546890 ATAATGACATTTATTTTATTTGG - Intronic
997354693 5:133254777-133254799 ATGATGGGGTTTGCTTAGTTGGG - Intronic
1000384880 5:160665737-160665759 ATGATGAGAATTACTATATTCGG - Intronic
1000768111 5:165317374-165317396 ATGATTAAGTTTAGTTTATTAGG - Intergenic
1001394534 5:171406763-171406785 ATTGTGAGGTTTATTTTACTAGG + Intronic
1003437461 6:6105043-6105065 CTGATGGGGTTTCCTTTGTTGGG + Intergenic
1005001019 6:21241939-21241961 ATGATCAGGTTTACTTACTCAGG - Intergenic
1005583919 6:27258149-27258171 GTGAAGGGGTTGACTTTATTTGG - Intergenic
1006094146 6:31645244-31645266 ATCATGAGGTTTTCTTGGTTAGG - Intronic
1006433322 6:34011881-34011903 ATTATGAATTTTACTTAATTGGG - Intergenic
1007233036 6:40363448-40363470 ATTATGAATTTTAATTTATTGGG - Intergenic
1008371632 6:50738808-50738830 ATGATGAGATCTCCCTTATTTGG - Intronic
1008836266 6:55834660-55834682 ATTATGAGTTTTACTTTTTTGGG - Intronic
1009496001 6:64347219-64347241 CTGATTTGGTTTAATTTATTTGG + Intronic
1009505551 6:64473253-64473275 ATCATGCGGTGTTCTTTATTAGG + Intronic
1009681830 6:66904210-66904232 ATTCTGAGGTTTACTTTTTCAGG + Intergenic
1010437050 6:75843916-75843938 ATGATGAGGTGTATTTAATTTGG + Intronic
1012530612 6:100231064-100231086 ATGATGAGGTCTATTCTATAGGG - Intergenic
1013933553 6:115565941-115565963 ATGATGAGGTTTTCATGATGAGG - Intergenic
1013987262 6:116209953-116209975 ATGATGAGGTTTAGTGGATTAGG + Intronic
1014622132 6:123680601-123680623 ATGATGAAGTTTGATTTCTTAGG + Intergenic
1014914590 6:127130829-127130851 ATGATGAGTTTTTTTTTATATGG + Intronic
1015389569 6:132665929-132665951 TTGATGATGTTAACTTTACTTGG + Intergenic
1015542471 6:134329335-134329357 ATTAAGAAGTTTACTTTATAGGG - Intergenic
1015574618 6:134658159-134658181 CTGAAGAGCTTTACTTAATTAGG - Intergenic
1015893338 6:137991064-137991086 ATCATGAGGTTTTCTTATTTTGG - Intergenic
1016565325 6:145445896-145445918 ATGATGCTGTATACTTTTTTAGG + Intergenic
1016764711 6:147779003-147779025 ATGATGAGGTAGGATTTATTTGG - Intergenic
1016864601 6:148753087-148753109 ATGCTGAAATGTACTTTATTTGG - Intronic
1018876958 6:167829464-167829486 ATGATTATTTTTACTCTATTTGG + Intronic
1019609081 7:1927794-1927816 ATGATCAGGTTTTCTTTTATAGG - Intronic
1020558997 7:9705761-9705783 ATGATAATGTTTACATTATGAGG + Intergenic
1021076782 7:16314847-16314869 ATGCTTAGGTGTAGTTTATTTGG + Intronic
1022597497 7:31726640-31726662 AAGATGAGGGATACTTTCTTTGG - Intergenic
1023162912 7:37314775-37314797 ATGATGATGTTTTCTTTGTTCGG - Intronic
1024752357 7:52482495-52482517 ATGATCAGGTATACTTATTTTGG - Intergenic
1026476560 7:70741171-70741193 AAGATAAGGTTTATTTTATCAGG + Intronic
1026540952 7:71279544-71279566 AAGATGAGGTCTACTAGATTAGG - Intronic
1030278672 7:107746294-107746316 AAGATGAGTTTTACTTCCTTAGG - Intronic
1030664263 7:112256979-112257001 ATAATGACCTTTAATTTATTTGG + Intronic
1031008801 7:116501986-116502008 ATGATTAGTTTTAGTTAATTGGG - Intronic
1032101261 7:128980128-128980150 ATCATCTGGTTTTCTTTATTTGG - Intronic
1034483388 7:151341123-151341145 ACGATAAAGTTTAATTTATTAGG + Intergenic
1034994304 7:155568644-155568666 ATGATGAGATCTACTGTCTTAGG - Intergenic
1035139393 7:156742627-156742649 GTCCTGAGGTTTTCTTTATTGGG - Intronic
1036538702 8:9680174-9680196 ATTATAAGGTTAATTTTATTTGG + Intronic
1036677066 8:10843147-10843169 ATTGTGAGTGTTACTTTATTGGG + Intergenic
1037449499 8:19002413-19002435 TTGATGAGGTATACTTTTTAAGG + Intronic
1038633356 8:29265849-29265871 CTGATGTTGTTTACTTTATTGGG - Intergenic
1038724115 8:30064395-30064417 ATTTTCAGGTTTACATTATTTGG + Intronic
1041291887 8:56315801-56315823 ATAATGGGTTTTACTTTATAAGG + Intronic
1041929350 8:63269931-63269953 ATGAGGAGGTTGAATCTATTTGG - Intergenic
1041987635 8:63944730-63944752 ATTATGAATTTTACTTTGTTGGG + Intergenic
1042386552 8:68182125-68182147 AGGCTGAGCTTTCCTTTATTTGG - Intronic
1043748352 8:83904333-83904355 GTGCTCAGGTTTACTTTATATGG - Intergenic
1044697201 8:94935375-94935397 GTAATGGGGTTTACTTTAGTGGG + Intronic
1045823949 8:106374332-106374354 ATGATTACATTTTCTTTATTGGG + Intronic
1046729797 8:117712661-117712683 ATTATGAGGTTTCCTTTAGAGGG - Intergenic
1047560548 8:125983521-125983543 ATTATGATATTTGCTTTATTTGG + Intergenic
1047763913 8:127974378-127974400 ATGATGATGCTGACTTTTTTTGG - Intergenic
1048644359 8:136402351-136402373 ATTCTGAGGTTTTCTTTGTTGGG - Intergenic
1050059324 9:1688581-1688603 CTGATGGGGATTATTTTATTTGG + Intergenic
1050893782 9:10858645-10858667 ATCATCAGGTTAACTTTACTTGG - Intergenic
1051894814 9:21975658-21975680 AAGATGAGGTTTATTTAATACGG + Intronic
1051950729 9:22629032-22629054 ATTATGAAATTTACATTATTGGG + Intergenic
1052038381 9:23709001-23709023 ATGATGATGTGTAGTTTCTTTGG - Intronic
1052166889 9:25341099-25341121 CTGATGTGGTTTCCTTTATAGGG - Intergenic
1056696804 9:88864078-88864100 GTGATGGATTTTACTTTATTAGG - Intergenic
1058006913 9:99926392-99926414 ATTGTGAAATTTACTTTATTGGG + Intronic
1058536101 9:105961729-105961751 ATGGTGAGCTTTACTCTAGTTGG - Intergenic
1059825253 9:118020912-118020934 ATGATGACTTTCATTTTATTGGG + Intergenic
1059965396 9:119608854-119608876 ATAATGGCGTTTACTCTATTTGG + Intergenic
1185725153 X:2414071-2414093 ATGATGAGGTCTAGTTGAGTTGG - Intronic
1185725201 X:2414618-2414640 ATGATGAGGTCTAGTTGGTTTGG - Intronic
1186605322 X:11084097-11084119 ATTATGTGGTTTACTTTATATGG - Intergenic
1187796864 X:23013269-23013291 CCAATGAGGTATACTTTATTTGG + Intergenic
1187989419 X:24853269-24853291 ATGAAGAGTTTTAGTTTATGTGG + Intronic
1189029678 X:37437823-37437845 AGGGAGAGGTTTACTGTATTAGG - Intronic
1191661288 X:63654158-63654180 ATGTTGAGGTTTTTTTTTTTTGG - Intronic
1191936669 X:66434424-66434446 ATGCTGAGGCTTACTGTAGTGGG + Intergenic
1192044627 X:67659016-67659038 ATGATCAGATTTTCTTTTTTAGG + Intronic
1194709972 X:97224027-97224049 ATGATGCTGTTTAATTTGTTTGG + Intronic
1194763761 X:97825337-97825359 ATGATGAGTTTAAGCTTATTTGG + Intergenic
1196298145 X:114023094-114023116 TTAATGAGGTTTACTTTACATGG - Intergenic
1196396321 X:115265918-115265940 ATGAAGAGGTTTGATTTATTAGG - Intergenic
1197336658 X:125217106-125217128 ATAATAAGGTTTAATTTATTAGG + Intergenic
1198589971 X:138167616-138167638 ATTATCAGGTTTACTTACTTTGG + Intergenic
1200307568 X:155043462-155043484 ATTATGAATTTTACTTCATTGGG + Intronic
1201460969 Y:14224037-14224059 ACGTTGATGTTTAATTTATTTGG + Intergenic
1202593470 Y:26511677-26511699 ATAAAGAGGTTTACTTAAATCGG + Intergenic
1202593784 Y:26514814-26514836 ATAAAGAGGTTTACTTAAATCGG + Intergenic