ID: 945316055

View in Genome Browser
Species Human (GRCh38)
Location 2:208371802-208371824
Sequence TGACATACTCATAATGGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945316051_945316055 -1 Left 945316051 2:208371780-208371802 CCACTCACTGTGTGTTGTGATAT 0: 1
1: 0
2: 0
3: 14
4: 179
Right 945316055 2:208371802-208371824 TGACATACTCATAATGGGGTAGG 0: 1
1: 0
2: 0
3: 7
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945316055 Original CRISPR TGACATACTCATAATGGGGT AGG Intronic
900691427 1:3982851-3982873 GGACACAATCATAATGGGTTAGG - Intergenic
903338473 1:22639998-22640020 TGAAATACTAAGAATGGGCTGGG - Intergenic
905752879 1:40481264-40481286 TGAAAGACTAATAATGTGGTGGG + Intronic
906308143 1:44734321-44734343 TGAAATAAGCATAATGGGCTAGG - Intergenic
909915571 1:81313934-81313956 TGATATACTTATAATGGATTGGG - Intronic
910607427 1:89102209-89102231 TGACATACTCATATTGGAACAGG + Intergenic
911259935 1:95673788-95673810 TGACATATACATAATTGTGTGGG - Intergenic
912677116 1:111693231-111693253 TGCCATAACCATAATGGGGTGGG + Intronic
913322904 1:117601831-117601853 GGACATACTGCTAGTGGGGTGGG + Intergenic
914982356 1:152425934-152425956 TGACATGCTAATTAAGGGGTGGG - Intergenic
917583927 1:176405762-176405784 TGACATACTCCTCATGGCCTGGG - Intergenic
920736514 1:208537760-208537782 TGACATACACATTAGGAGGTTGG + Intergenic
921064580 1:211613619-211613641 TTACATACTCAAAAGAGGGTGGG - Intergenic
1063424936 10:5943528-5943550 TCACACACACATAATGGGGTCGG + Intronic
1064678894 10:17789562-17789584 TGACATACTCTCACTGAGGTAGG - Intronic
1065824336 10:29556251-29556273 TGAAGGACTCAGAATGGGGTGGG + Intronic
1066372629 10:34830108-34830130 TAAAATAATAATAATGGGGTAGG + Intergenic
1070440211 10:76435709-76435731 TGCCATGCTCATAGAGGGGTTGG + Intronic
1075584230 10:123645553-123645575 TGAAATACTCATGATGGGCAGGG + Intergenic
1078177697 11:8982499-8982521 TGACAGACACATAATAGGATGGG + Exonic
1085429858 11:76438493-76438515 TCACATACTCATAATCTAGTGGG - Intergenic
1085867717 11:80314767-80314789 TGACAGATTCAAAATGGGTTTGG + Intergenic
1091209824 11:133846555-133846577 TGACATAGTCAGAATCGGCTAGG + Intergenic
1094707586 12:32929292-32929314 TGACATAGACAAAATGGGGCAGG - Intergenic
1095992824 12:48049339-48049361 TGACATATATATTATGGGGTTGG + Intronic
1098608229 12:72420945-72420967 TTACAGACTCATTATGGGATTGG + Intronic
1101630938 12:106494247-106494269 TGACATACTTATATTGGGGGTGG - Intronic
1106532178 13:30603518-30603540 TGACATTCTCAGATTGGGTTAGG + Intronic
1108016203 13:46079123-46079145 TAAGATACTTATAATGAGGTAGG + Intronic
1109837787 13:67881353-67881375 TGAAATACTAATTATGGGCTGGG + Intergenic
1110148639 13:72223688-72223710 TGAGAAACTGATTATGGGGTTGG - Intergenic
1112779572 13:102883948-102883970 TGACAAACTCATAATTAGGAAGG + Intergenic
1114786678 14:25608163-25608185 AGACATACACAAAATGGGGCAGG - Intergenic
1114812306 14:25915488-25915510 TGACACAATCAGAATGTGGTAGG - Intergenic
1116047038 14:39756114-39756136 AGACATAATCATGATGGGGGTGG + Intergenic
1118034719 14:61854089-61854111 ACACATACACATATTGGGGTGGG - Intergenic
1121049639 14:90812066-90812088 GCACATGGTCATAATGGGGTTGG - Intronic
1125704740 15:41723714-41723736 CAACATACTAAAAATGGGGTAGG - Intronic
1125847573 15:42871512-42871534 TGACATACCCTTCATGGGCTTGG + Intronic
1139226324 16:65235968-65235990 TGACACACTGAGAAAGGGGTGGG - Intergenic
1141119085 16:81336868-81336890 TGGTATACTGATAATGGGGGAGG - Intronic
1148070960 17:44908234-44908256 TCTCATACTCATGATGGGGAGGG - Intronic
1153576797 18:6530350-6530372 TTACATACTGATAAAGGGTTCGG - Intronic
1155932550 18:31722960-31722982 TTACATACTAATCATGAGGTTGG + Intergenic
1159670870 18:71219172-71219194 TTACATACTCATCATAAGGTAGG + Intergenic
1163578423 19:18123869-18123891 TGACACACGCAGAATGGGGCAGG - Intronic
933582403 2:84142422-84142444 TCACAGACTCATATTGGGATTGG + Intergenic
933686197 2:85143349-85143371 AGACAAAATCATAATGTGGTGGG - Intronic
933951578 2:87334923-87334945 TGACATGCTAATAAAGGAGTGGG - Intergenic
934134483 2:88982544-88982566 TGACATGCTAATAAAGGAGTGGG + Intergenic
934235823 2:90231236-90231258 TGACATGCTAATAAAGGAGTGGG - Intergenic
934880683 2:97974376-97974398 TGGAATCCTCAAAATGGGGTTGG + Intronic
938317565 2:130340569-130340591 TGAAAAACACATAATGGAGTGGG - Intronic
942573785 2:177341015-177341037 GGAGATATTGATAATGGGGTAGG + Intronic
945316055 2:208371802-208371824 TGACATACTCATAATGGGGTAGG + Intronic
947485915 2:230548595-230548617 TGACATAGACAAAATGGGGCAGG - Intergenic
1177283635 21:19019526-19019548 TGACATACTCATTAGGGCTTTGG - Intergenic
1178023848 21:28442054-28442076 TGACATTCTCATTATTTGGTGGG + Intergenic
1181896410 22:26111760-26111782 TGACATACTCATACAGTTGTTGG - Intergenic
949588802 3:5471139-5471161 TTACATACTGATAATGATGTTGG - Intergenic
949776011 3:7633280-7633302 TTCCATGCTCATAATGAGGTAGG + Intronic
957609665 3:82450806-82450828 TAACATATACATAATGAGGTTGG - Intergenic
961220272 3:125193999-125194021 TTACATAGACATAATGGGCTGGG + Intronic
967772628 3:193351507-193351529 AGACTGACTCATAATGGGGGAGG + Intronic
970923994 4:21428909-21428931 TAAGATATTGATAATGGGGTAGG - Intronic
971081702 4:23219961-23219983 TGACATAGTCAGCATGAGGTGGG + Intergenic
971519645 4:27532578-27532600 TGAGATACTGGGAATGGGGTGGG + Intergenic
971890450 4:32513583-32513605 TGACTTACTCATGATGTGGTGGG - Intergenic
977655728 4:99518724-99518746 TGGCATATGCATAATGGGGGAGG - Intronic
980095020 4:128480669-128480691 TGACATTCTGATTATGCGGTGGG + Intergenic
981916530 4:150039912-150039934 TGACATGCTAATTATGGGGTGGG + Intergenic
984153181 4:176160218-176160240 TGACAAAGTCATAAAGGGCTTGG + Intronic
988883824 5:35533496-35533518 TGTCATACACATAATGGAGCAGG + Intergenic
994477528 5:100290136-100290158 TGGCATAATCATAATGGTGGTGG - Intergenic
995838212 5:116419274-116419296 TGCCTTACTGATATTGGGGTTGG + Intergenic
997218148 5:132131867-132131889 TGACAAACGTATAATGGGGGTGG + Intergenic
999522322 5:152363589-152363611 TGACTTACTCAGACTGGGCTTGG + Intergenic
1004127827 6:12890466-12890488 TGACCTGCACATAATGGGGGCGG - Intronic
1009791460 6:68406715-68406737 TAACATACTAATAATTGGTTAGG - Intergenic
1010026825 6:71228494-71228516 TGACATACTCAGGAAGGGATGGG - Intergenic
1011070569 6:83377077-83377099 TGAGATACTTATAAAGGGTTGGG - Intronic
1015013899 6:128386522-128386544 TGAAATACTCCTAATGGAGATGG + Intronic
1016561440 6:145399303-145399325 TGATCCACTCATACTGGGGTGGG + Intergenic
1016832121 6:148444535-148444557 CACCAAACTCATAATGGGGTAGG - Intronic
1020512746 7:9079492-9079514 AGAGATACTGGTAATGGGGTAGG - Intergenic
1021263541 7:18490257-18490279 TGACTTACTCGTTCTGGGGTAGG + Intronic
1027981314 7:85226441-85226463 TGACATACTCATTGTATGGTTGG + Intergenic
1030011065 7:105168211-105168233 TGACACACTCATAATGTTTTAGG - Intronic
1030126341 7:106155967-106155989 TGACCTACTCCTCATGGGGTGGG + Intergenic
1034195158 7:149240417-149240439 TGACATTCCCAGAATGGGGATGG - Intronic
1035112740 7:156496902-156496924 TGATATATTCATTTTGGGGTGGG - Intergenic
1040836279 8:51734882-51734904 TGAAATAAACATAATAGGGTTGG + Intronic
1043021618 8:75008392-75008414 TAACCTACACTTAATGGGGTGGG + Intronic
1045388832 8:101695016-101695038 TGACATAGTCAAAATGGAATCGG + Intronic
1046294820 8:112203647-112203669 GGACAGAATCATAATTGGGTTGG + Intergenic
1047083752 8:121493733-121493755 AGAAACACTAATAATGGGGTGGG + Intergenic
1048845434 8:138600462-138600484 TGACATGCTCAGAGTGGGGAGGG + Intronic
1055660918 9:78503098-78503120 TGACAGACTAATAATGTGGTAGG - Intergenic
1058958304 9:109969570-109969592 TGACATGCTCATCTTGGGGAAGG + Intronic
1189276966 X:39793760-39793782 TGAAATACTGAAAGTGGGGTCGG - Intergenic
1191587534 X:62845014-62845036 TGACATACTGATACTGTGCTAGG + Intergenic
1193762086 X:85479469-85479491 TGAGAAACCTATAATGGGGTCGG - Intergenic
1195254096 X:103076783-103076805 TGACATAGAGAAAATGGGGTGGG - Intronic
1197587634 X:128368880-128368902 TGACAGAGTCATAATGTGGAAGG - Intergenic
1200808377 Y:7456581-7456603 TGACTTACTCATAATATGCTGGG + Intergenic
1201925740 Y:19285688-19285710 TGACACAGACAAAATGGGGTAGG + Intergenic