ID: 945320316

View in Genome Browser
Species Human (GRCh38)
Location 2:208414052-208414074
Sequence ACTAGGGCCCACTGTTTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 18, 2: 74, 3: 75, 4: 85}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945320308_945320316 15 Left 945320308 2:208414014-208414036 CCCTATCTTAGTGCACCTAATGG 0: 1
1: 5
2: 59
3: 69
4: 79
Right 945320316 2:208414052-208414074 ACTAGGGCCCACTGTTTTACTGG 0: 1
1: 18
2: 74
3: 75
4: 85
945320313_945320316 0 Left 945320313 2:208414029-208414051 CCTAATGGGAAAGGAATATGCTT 0: 1
1: 0
2: 28
3: 107
4: 327
Right 945320316 2:208414052-208414074 ACTAGGGCCCACTGTTTTACTGG 0: 1
1: 18
2: 74
3: 75
4: 85
945320310_945320316 14 Left 945320310 2:208414015-208414037 CCTATCTTAGTGCACCTAATGGG 0: 1
1: 8
2: 57
3: 67
4: 75
Right 945320316 2:208414052-208414074 ACTAGGGCCCACTGTTTTACTGG 0: 1
1: 18
2: 74
3: 75
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945320316 Original CRISPR ACTAGGGCCCACTGTTTTAC TGG Intronic
902322366 1:15677138-15677160 ATTAGGGCCCACTGTTTTACTGG - Intergenic
902963646 1:19982179-19982201 ATTAAGGCTCACTGTTTTACTGG - Intergenic
904037112 1:27564893-27564915 TCTAGGGCCCCTCGTTTTACAGG + Intronic
904061378 1:27713578-27713600 ATTAAGGCCCACTGTTTTACTGG - Intergenic
906690266 1:47787944-47787966 ACTTGGGCCCTCTGTTCTGCTGG - Intronic
909554247 1:76935385-76935407 AATAGAGCTCACTGTTTTATGGG - Intronic
912692766 1:111816669-111816691 ATTATTGCCAACTGTTTTACAGG + Intronic
912836881 1:113004533-113004555 ACTAAGGCCCCCTGCTTTAAGGG - Intergenic
915079728 1:153343924-153343946 ATTAAGGCCCACTGTTTTACTGG - Intronic
917273372 1:173303321-173303343 ATTAAGGCCCACTGTTTTACTGG + Intergenic
917905499 1:179584015-179584037 ACTGGAGCCCACTGTTCTTCTGG - Intergenic
918658118 1:187054157-187054179 ATTAGGGCCCACTGTTTTACTGG + Intergenic
919020690 1:192101340-192101362 ATTAGGGCCCACTGTTTTACTGG + Intergenic
919868694 1:201803816-201803838 ACTAGGGCTCAGTGTTAGACGGG - Intronic
920281187 1:204844997-204845019 ATTAAGGCCCACTGTTTTACTGG + Intronic
920610180 1:207428324-207428346 ATTAAGGCCCACTGTTTTACTGG + Intergenic
922381787 1:225036634-225036656 ATTAAGGCCTACTGTTTTACTGG + Intronic
922917236 1:229268879-229268901 ACTAGATCCCACTTTTTTCCAGG - Intergenic
924951601 1:248889711-248889733 ATTAAGGCCCACTGTTTTACTGG - Intergenic
1064234905 10:13564935-13564957 ATTAGGGCCCACTGTTTTACTGG + Intergenic
1068327896 10:55518591-55518613 ATTAAGGCCCGCTGTTTTACTGG - Intronic
1068648553 10:59496385-59496407 ATTAAGGCCCACTGTTTTACTGG + Intergenic
1069379564 10:67829062-67829084 AGTAAGGCTCACTGTTTTACTGG - Intronic
1071162183 10:82760200-82760222 ACTGGGGCCCTGTGTTTTTCTGG - Intronic
1071892636 10:90028365-90028387 ATTATGGCCCAGTGTTTTACTGG + Intergenic
1073737890 10:106370702-106370724 ATGAAGGCCCACTGTTTTACCGG - Intergenic
1073992652 10:109280569-109280591 AGTAGGGAGCACTGTGTTACAGG + Intergenic
1077041872 11:528393-528415 ACCAGGTCCCACTGATTGACAGG - Intergenic
1078429782 11:11280225-11280247 GCTGGGGCCCACTGTTTGCCAGG + Intronic
1083162589 11:60864222-60864244 ATTAAGGCCCACTGTTTTACTGG - Intergenic
1083586311 11:63862245-63862267 AGTAGATCTCACTGTTTTACAGG + Intronic
1083765404 11:64839132-64839154 ACTACGGCCCACAGTGTGACTGG - Exonic
1084750532 11:71201951-71201973 ATTAGGGTCCCCTGTTCTACAGG + Intronic
1086483228 11:87268012-87268034 TCTAGGGCACACTGTATTACAGG - Intronic
1088678471 11:112219279-112219301 ATTAAGGCCCACTGTTTCACTGG + Intronic
1090135188 11:124190552-124190574 ATTAGGGCCCACTGTTTTACTGG - Intergenic
1090146385 11:124327664-124327686 ATTAAGGCCCATTGTTTTACTGG - Intergenic
1090152533 11:124400727-124400749 ACAGGGTCTCACTGTTTTACAGG + Intergenic
1090748550 11:129726524-129726546 AGCAGGGCCCTCTGTTTTACAGG - Intergenic
1091610355 12:2002360-2002382 ACTAGGTCTCTCTGTTTTTCTGG + Intronic
1092347874 12:7731160-7731182 ATTAAGGCCCACTGTTTTACTGG - Intronic
1092564094 12:9647399-9647421 ATTAAGGCCCACTGTTTTACTGG + Intergenic
1093074485 12:14743545-14743567 TTTAAGGCCCACTGTTTTACCGG + Intergenic
1093539461 12:20264553-20264575 CCTAGGGCCCATTGTTTTTGTGG + Intergenic
1094053873 12:26249027-26249049 GTTGGGGCCCACTGATTTACAGG - Intronic
1094125372 12:27017509-27017531 ACTAAGGCCCACTGTTTTACTGG + Intergenic
1094203877 12:27819994-27820016 ATTAAGGCCCACTGTTTTACTGG + Intergenic
1095141580 12:38669768-38669790 ACCAAGGCCCACTGTTTTACTGG - Intronic
1096534191 12:52260462-52260484 ATTAAGGCCCACTGTTTTACTGG + Intronic
1099487481 12:83246431-83246453 ATTAAGGCCCACTGTTTTACTGG + Intergenic
1100287175 12:93177994-93178016 ATTAGGGCCCACTGTTTTACTGG - Intergenic
1102161519 12:110772916-110772938 TTTAAGGCCCACTGTTTTACTGG + Intergenic
1102987409 12:117289878-117289900 ATTAAGGCCCACTGTTTTACTGG + Intronic
1103571160 12:121846088-121846110 ACAGGGTCCCACTGTTTTCCAGG + Intronic
1103836846 12:123828605-123828627 ATTAAGGTCCACTGTTTTACTGG + Intronic
1104890475 12:132137221-132137243 ATTAGGGTCCACTGTTTTACTGG + Exonic
1109658929 13:65433074-65433096 ATTAGGGCCAAGTGTTTTATTGG + Intergenic
1109889018 13:68582815-68582837 GTTAGAGCCCACTCTTTTACAGG + Intergenic
1109889040 13:68583033-68583055 ATAAAGGCCCACTGTTTTACTGG + Intergenic
1110986557 13:81977902-81977924 ATTTGGGTCCACTGTTTTACTGG - Intergenic
1111573510 13:90118668-90118690 ATTAAGGCCCACTGTTTTACTGG + Intergenic
1114214125 14:20642947-20642969 ATTAAGGCCCATCGTTTTACTGG - Intergenic
1115399904 14:32944906-32944928 ACTATGGCCCACAGTTCTCCTGG + Intronic
1117294259 14:54364648-54364670 ACCAGGACCCACTGCTGTACAGG + Intergenic
1120930552 14:89844090-89844112 AGAAGTGGCCACTGTTTTACTGG - Intronic
1121191398 14:92033946-92033968 TCTAAGGCCCACTGCTTTACTGG + Intronic
1121656170 14:95597455-95597477 AGTAAGGCCCACTGTTTTACTGG + Intergenic
1122434846 14:101688498-101688520 ATTTGGACCCACTGTTTTGCTGG - Intergenic
1124136100 15:27037646-27037668 ATTAAGGGCCACTGTTTTACTGG + Intronic
1124199236 15:27663003-27663025 ATTAGGGCCCACTGTTTTACTGG + Intergenic
1125750677 15:42025560-42025582 ATTAAGGCCCAATGTTTTACTGG + Intronic
1128710075 15:69865242-69865264 GCTAGGGCCCAAGGTTTCACAGG - Intergenic
1131333470 15:91524422-91524444 ATTAAGGCCCACTGTTTTACTGG - Intergenic
1135902045 16:26469563-26469585 ATTAAGGCCCACTGTCTTACTGG + Intergenic
1136388122 16:29943122-29943144 CCTAAGGCCCACTGTTTTACTGG - Intronic
1137019438 16:35409128-35409150 ATTAAGGCCCACTGTTTTCCTGG + Intergenic
1137043100 16:35631723-35631745 ATTAAGGCCCACTGTTTTACTGG + Intergenic
1138648374 16:58441930-58441952 ATTAAGGCCCACTGTTTTACTGG - Intergenic
1138967539 16:62103270-62103292 ATTAAGGCCCACTGTTTTACTGG + Intergenic
1140699125 16:77565058-77565080 ACTTGGGCCCTCTGTGTTTCAGG - Intergenic
1140825456 16:78701749-78701771 GCAAGGGCCCACTGCTTAACTGG - Intronic
1142921374 17:3190078-3190100 ATTAAGGCCCACTGTTTTACTGG + Intergenic
1144713627 17:17419608-17419630 GTTAGGGACCACTGTTTTAGAGG + Intergenic
1145727561 17:27145759-27145781 ACTAGGGCTTACAGTTATACTGG - Intergenic
1146815961 17:35942758-35942780 ATTAAGGCCCACTGTTTTACTGG - Intronic
1147519288 17:41154053-41154075 ATTAAGGCCCACTCTTTTACTGG - Intergenic
1147588021 17:41664083-41664105 AGTAGAGCCCACTGTATGACTGG + Intergenic
1147873518 17:43604464-43604486 ATTAAGGCCCACTATTTTACTGG - Intergenic
1149260107 17:54871062-54871084 ACTAGTCCCCACTGATATACAGG + Intergenic
1149366725 17:55952629-55952651 ATTAAGGCCCACAGTTTTACTGG - Intergenic
1153614967 18:6925840-6925862 ATTAAGGCCCACTGTTATACTGG - Intergenic
1154979529 18:21491106-21491128 GCTAGGCCCCACTGGATTACAGG - Intronic
1156731432 18:40197912-40197934 ATTAAAGCCCACTGTTTTACTGG + Intergenic
1156984880 18:43338383-43338405 ATTAAGGCCCACCATTTTACTGG + Intergenic
1160292237 18:77605694-77605716 ATTATGGCCCACTGTTTCACTGG + Intergenic
1161970423 19:7576503-7576525 ACAAGGTCTCACTGTTTTCCAGG + Intergenic
1162051075 19:8033454-8033476 GTAAGGCCCCACTGTTTTACTGG + Intronic
1163057680 19:14733440-14733462 ATTAAGGCCCACTGTTTTACTGG - Exonic
1163073461 19:14866155-14866177 ATTAGAGCCCACTGTTTTTCTGG - Intergenic
1163086924 19:14988184-14988206 ATTAAGGCCCACTGTTTTACTGG + Intronic
1163724972 19:18917794-18917816 ATTAAGGCCCACTGTTTTACTGG - Intronic
1165586327 19:36919367-36919389 GCTGGGGACCACTGTCTTACAGG - Intronic
1167774824 19:51548022-51548044 ATTAGGGCCCACTGTTTTACTGG - Intergenic
1168387271 19:55974757-55974779 AAAAAGGCCCATTGTTTTACTGG + Intronic
925726761 2:6880532-6880554 ATTTAGGCCCACTGTTTTACTGG + Intronic
928418150 2:31113871-31113893 ATTAAGGCCCACTGTTGTACTGG - Intronic
929212172 2:39369147-39369169 ACGAAATCCCACTGTTTTACAGG + Intronic
929655325 2:43725355-43725377 ATTAAGGCCCACTGTTTTATTGG + Intronic
930599187 2:53424254-53424276 ATTAAGGCCCACTGTTTTACTGG + Intergenic
932196676 2:69789948-69789970 ATTAAGACCCACTGTTTTACTGG + Intronic
932197818 2:69799327-69799349 ATTAAGACCCACTGTTTTACTGG + Intronic
932206645 2:69889268-69889290 ATTAGGGACCCCTGTTTTAAAGG + Intergenic
932270117 2:70401893-70401915 ACTAGAGCCCACTGTTACAAGGG - Intergenic
933102188 2:78274655-78274677 GTTAAGGCCCACTGTTTTACTGG - Intergenic
933919188 2:87027538-87027560 ACTTGGGGCCTCTGTTTTGCTGG - Intergenic
934003806 2:87742369-87742391 ACTTGGGGCCTCTGTTTTGCTGG + Intergenic
934819118 2:97356707-97356729 ATTAGGGCCCACCATTTTACTGG - Intergenic
936230395 2:110695304-110695326 ATTAAGGCCTACTGTTTTACTGG - Intergenic
936867159 2:117087778-117087800 ATTAAAGCCCGCTGTTTTACTGG - Intergenic
939538198 2:143459760-143459782 ACAAAGGCCCACTGTTGGACAGG - Intronic
940911262 2:159212002-159212024 AATAGGGACCTCTGTTTCACAGG - Intronic
941820518 2:169840173-169840195 ATTAAGGCCCACTGTTTTACTGG + Intronic
942102649 2:172600973-172600995 ATTAAGGGCCACTGTTTTACTGG + Intronic
945320316 2:208414052-208414074 ACTAGGGCCCACTGTTTTACTGG + Intronic
945326811 2:208491739-208491761 ATTAGGACCCACTGTTTTACTGG + Intronic
946545981 2:220743902-220743924 ACTATTGCTCACTATTTTACCGG + Intergenic
947001069 2:225456847-225456869 ATTAGGGCCCACTGTTTTACTGG + Intronic
948227383 2:236321902-236321924 ATTAGGGTCCATTGTTTTACTGG - Intergenic
948745271 2:240087620-240087642 ATTAAGGCCCACTGTTTTACTGG + Intergenic
1169286511 20:4312084-4312106 ATTAAGGCCCACTGTTTTACTGG - Intergenic
1170122575 20:12926577-12926599 ATTAAGGCCCACTGTTTTACTGG - Intergenic
1172172729 20:32950719-32950741 CTTAAGACCCACTGTTTTACTGG + Intronic
1172218063 20:33250546-33250568 ACTAGGGCCAACAATTGTACTGG + Intergenic
1172470714 20:35192600-35192622 ATTAGGGCCTACTGTTTTACTGG + Intergenic
1175239472 20:57536191-57536213 ATTAAGGCCCACTGTTTTACTGG - Intergenic
1177728279 21:24995357-24995379 ATTACAGCCCACTGTTTTACTGG - Intergenic
1178839411 21:36126795-36126817 AATGGGGCCCATTGTTTTTCTGG - Intergenic
1179398483 21:41062493-41062515 CCTTGGGCCCACTGTTCGACAGG + Intergenic
950068685 3:10134792-10134814 ATTAAGGCCCACTGTTTTACTGG - Intergenic
950610097 3:14121117-14121139 ATTAAGGCCCACAGTTTTACTGG + Intronic
957381533 3:79436058-79436080 ACAAGGGTCCAGTGTTTTCCTGG - Intronic
957980901 3:87509506-87509528 ATTAAGGCCCACTGTTTTACTGG + Intergenic
961335066 3:126170927-126170949 ATTAAGGCCCACTGTTTTACTGG - Intronic
961796605 3:129413432-129413454 ATTAAGGCCCACAGTTTTACTGG - Intronic
963490414 3:145993296-145993318 ATTAAGACCCATTGTTTTACTGG - Intergenic
965063354 3:163809781-163809803 ATTAGGGCCCACTGTTTTACTGG - Intergenic
965103170 3:164328907-164328929 ATTAGGGTCCACAGTTTTACTGG + Intergenic
966689332 3:182726869-182726891 ATTAATGCCCACTGTTTCACTGG + Intergenic
969044146 4:4324296-4324318 ATTAGGGCCCACTGTTTTACTGG - Intergenic
970410303 4:15799940-15799962 ATTAACGCCCACTGTTTTACTGG - Intronic
971540742 4:27813557-27813579 ATTAAGGCCCACTGTTTTACCGG - Intergenic
973041571 4:45475855-45475877 ATTAAGGCCCACTGTTTTACTGG - Intergenic
974351918 4:60759404-60759426 ATTAAGGCCCACTGTTTTATTGG - Intergenic
974596855 4:64024568-64024590 ATTAAGGCCCACTGTTTTCCTGG + Intergenic
974863535 4:67552402-67552424 ATTAAGGCCCACTGTTTTACTGG + Intergenic
975601676 4:76106667-76106689 ATTAAGGCCCACTGTTTTACTGG + Intronic
976298559 4:83496308-83496330 ATTAAGGCCCACTGTCTTACTGG + Intronic
977054446 4:92173184-92173206 ATTAAGGCCCACTGTTTTACTGG + Intergenic
978993080 4:115111183-115111205 ACTGGGGACAACTGTTCTACTGG + Intronic
982389423 4:154848419-154848441 ATTAAGGCCCACTGTTTTACTGG + Intergenic
983680459 4:170347440-170347462 ATTAAGGCCCACTGTTTTGCTGG + Intergenic
984107310 4:175564374-175564396 ATTACGGCCCACTGTTATCCAGG - Intergenic
984453885 4:179940423-179940445 ATTAAGGCCCACTGTTTTACTGG + Intergenic
987871081 5:23617569-23617591 ATTAAGGCCCACTGTTTTACTGG + Intergenic
989095139 5:37775076-37775098 ATTAGGTGCCACTGTTTGACAGG + Intergenic
989451485 5:41591477-41591499 ATTAGGGCCCACTGAAATACAGG - Intergenic
991269302 5:64760461-64760483 ATTAAGGCCCACTATTTTACTGG - Intronic
998258740 5:140611368-140611390 ATCAGGGCCCACTGTTTTACTGG + Intergenic
998259601 5:140619461-140619483 ATTAAGGCCCACTGTTTTACTGG - Intergenic
1002001267 5:176197508-176197530 ATTAAGGCCCACTGGTTTACCGG + Intergenic
1002253071 5:177941461-177941483 ATTAAGGCCCACTGGTTTACTGG - Intergenic
1002407083 5:179043428-179043450 GGAAAGGCCCACTGTTTTACTGG + Intergenic
1002649260 5:180679753-180679775 ATTAAGGCCCACTGGTTTACTGG - Intergenic
1002682341 5:180976672-180976694 ACTAGGGCCCACTGTTTCACTGG + Intergenic
1008295735 6:49774040-49774062 ACTAGGGACCACTGTTTCATGGG - Intergenic
1011565395 6:88667291-88667313 ACTAGGGGCCACAGTTGTGCTGG + Intronic
1012310031 6:97712336-97712358 ACTCGGCCCTATTGTTTTACAGG - Intergenic
1012545624 6:100415914-100415936 ATTAAGGCCCCCTGTTTTACTGG - Intronic
1013072797 6:106744116-106744138 ATTAAGGCCCACTGTTTTACTGG + Intergenic
1014957848 6:127643100-127643122 ATTAAGGCCCACTGTTTTACTGG + Intergenic
1017887642 6:158612046-158612068 ATTAGGGCCTACTTTTTTACTGG + Intronic
1017888590 6:158621150-158621172 ATTAGGACCCACTGTTCTACTGG + Intronic
1018127589 6:160696533-160696555 ACTTGGGGCCTCTGTTTTGCTGG + Intergenic
1018684728 6:166295234-166295256 ATTAATGCCCACTGTTTTACTGG - Intergenic
1018932870 6:168253341-168253363 ATTAAGGCCCACTGTTTTACTGG + Intergenic
1020586968 7:10080478-10080500 ATTAGGGCCCGCTGTTTTACTGG - Intergenic
1020895019 7:13929182-13929204 AATAGAGCCCACTGTATTGCAGG + Intronic
1021189042 7:17599256-17599278 ACTTGGGACCACTATTTCACAGG - Intergenic
1021892195 7:25196609-25196631 ATTAAGGCCCACTGTTTTACTGG + Intergenic
1023409709 7:39877539-39877561 TCCTTGGCCCACTGTTTTACGGG + Intergenic
1023974535 7:45018288-45018310 GCTGGGGACCTCTGTTTTACAGG + Intronic
1024496732 7:50056884-50056906 GCCAAGGCCTACTGTTTTACTGG - Intronic
1025770384 7:64499845-64499867 ATTAAGGCCCACTGTTTTACTGG - Intergenic
1026069019 7:67101181-67101203 ATTAAGGCCCACTGTTTTACTGG + Intronic
1026136273 7:67664109-67664131 ATTAAGGCCCACTGTTTTACTGG + Intergenic
1026646566 7:72175895-72175917 ATTAGGGCCCACTGTTTTACTGG - Intronic
1026707885 7:72711142-72711164 ATTAAGGCCCACTGTTTTACTGG - Intronic
1026742654 7:72988912-72988934 AATGGGGACCACTGTTCTACGGG + Intergenic
1026802505 7:73409312-73409334 ACTGGGGACCACTGTTCTAAGGG + Intergenic
1027028769 7:74873617-74873639 AATGGGGACCACTGTTCTACGGG + Intergenic
1027101081 7:75376165-75376187 AATGGGGACCACTGTTCTACGGG - Intergenic
1032798679 7:135300665-135300687 ATTAAGGCCCACTGTTTTACTGG - Intergenic
1033685420 7:143635956-143635978 ATTAAGGCCCACTGTTTAACTGG + Intronic
1033688590 7:143715174-143715196 ATTAAGGCCCACTGTTTAACTGG + Intronic
1033699194 7:143821664-143821686 ATTAAGGCCCACTGTTTAACTGG - Intergenic
1035539291 8:419931-419953 ACTATTGCCCAATTTTTTACTGG - Intronic
1035950885 8:4019466-4019488 ATTAGGGCCCACTGTTTTACTGG + Intronic
1038294186 8:26275732-26275754 ATTAGGAACCACTGATTTACTGG - Intergenic
1039669674 8:39581915-39581937 ATTAAAGCCCTCTGTTTTACTGG + Intergenic
1040920201 8:52607642-52607664 ATTAAGGCCCACTGTTTTACTGG + Intergenic
1041593087 8:59613586-59613608 TCAAGGTCCCACTGTTATACAGG + Intergenic
1041874550 8:62672962-62672984 ACTATAGCCAACTGGTTTACTGG + Intronic
1043616077 8:82127189-82127211 ATTAAGGCCCACTGTTTTAGTGG - Intergenic
1043851525 8:85221524-85221546 ATTAAGGCCCACTGTTTCACTGG + Intronic
1045520050 8:102895579-102895601 AGTAGCTCCCACTGTTTCACAGG - Intronic
1046221325 8:111219151-111219173 ATTAAGGCCCACTGTTTTACTGG - Intergenic
1046234055 8:111398185-111398207 ATTAGGGCCCACCGTTTTACTGG + Intergenic
1047637366 8:126779170-126779192 ATTAAGGCCCACTGTTTTACTGG - Intergenic
1048185639 8:132238111-132238133 ATTGGGACCCCCTGTTTTACTGG - Intronic
1052240116 9:26261683-26261705 ACCAGGGCCCACTGTTTTACTGG + Intergenic
1053048631 9:34940142-34940164 ATTAAGGCCCACTGTTTCACTGG - Intergenic
1055068011 9:72138157-72138179 ATTAAGGACCACTGTTTTACTGG + Intronic
1055086851 9:72323208-72323230 ATTGGGGCCCACTGTTTTACCGG + Intergenic
1056038087 9:82630469-82630491 ATTAAGGCCCACTGTTTTACTGG - Intergenic
1056745185 9:89295559-89295581 ATTAAGGCCCATTGTTTTACTGG - Intergenic
1056746078 9:89304210-89304232 ATTAAGGCCCACTGTTTTACTGG - Intergenic
1057666770 9:97052006-97052028 ATCAAGACCCACTGTTTTACTGG + Intergenic
1057823839 9:98357118-98357140 ATTAGGGTTCACTGTTCTACGGG - Intronic
1058453955 9:105121971-105121993 ATTAAGGCCCACTGTTTTACTGG + Intergenic
1060309556 9:122447089-122447111 ATTAGGACCCACTGTTTTACTGG - Intergenic
1186063706 X:5738981-5739003 ACTAAGGCCCACTGTTTTACTGG - Intergenic
1190071787 X:47285664-47285686 ATTAAGGCCCACTGTTTCACTGG + Intergenic
1190072971 X:47293891-47293913 ATTAAGGCCCACTGTTTTACTGG + Intergenic
1190122762 X:47676135-47676157 AGTAAGGCCCACTGTTTCACTGG - Intergenic
1190126807 X:47712899-47712921 ATTAAGGCCCACTGTTTTACTGG - Intergenic
1190557692 X:51652776-51652798 ACTGGGTCCGGCTGTTTTACGGG + Intergenic
1190948713 X:55121122-55121144 ATTAAGGCCCACTGTTTTACTGG + Intronic
1191663535 X:63674719-63674741 ATTAACGCCCACTGTTTTACTGG + Intronic
1193337865 X:80312346-80312368 ACTAAGGCCCACTGTTTTACTGG - Intergenic
1195257132 X:103101777-103101799 ATTAAGGCCCACTATTTTACTGG - Intergenic
1196102237 X:111858707-111858729 ATTAAGGGCCACTGTTTTACTGG + Intronic
1198931582 X:141867297-141867319 ATTAAGGCCCATTGTTTTACTGG - Intronic
1198932218 X:141873342-141873364 ATTAAGGCGCACTGTTTTACTGG + Intronic
1199311824 X:146329712-146329734 ATTAAGACCCACTGTTTTACTGG + Intergenic
1200877502 Y:8173561-8173583 ATAAAAGCCCACTGTTTTACTGG + Intergenic
1200882249 Y:8228533-8228555 AATAAGGCCCACTGTTTTACTGG - Intergenic
1201525314 Y:14926693-14926715 ATTAAGGCCTACTGTTTTACTGG - Intergenic
1201648154 Y:16258325-16258347 ATTAAGGCCCACTGTTTTACTGG + Intergenic
1201654656 Y:16326976-16326998 ATTAAGGCCCACTGTTTTACTGG - Intergenic
1202104505 Y:21348691-21348713 ATTAAGGCCTACTGTTTTACTGG + Intergenic
1202106213 Y:21369652-21369674 AACAAGGCCCAGTGTTTTACTGG - Intergenic
1202194075 Y:22277963-22277985 AATAAGGACCACTGTTTTACTGG - Intergenic
1202201402 Y:22354182-22354204 AATAAGGCCCAGTGTTTTACTGG + Intronic