ID: 945326980

View in Genome Browser
Species Human (GRCh38)
Location 2:208493367-208493389
Sequence GCTGCTGGTGCTGTGCGTCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 234}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945326980_945326986 8 Left 945326980 2:208493367-208493389 CCGTGACGCACAGCACCAGCAGC 0: 1
1: 0
2: 0
3: 18
4: 234
Right 945326986 2:208493398-208493420 GGTGGCGGCCAGCACACGCATGG 0: 1
1: 0
2: 2
3: 11
4: 146
945326980_945326984 -7 Left 945326980 2:208493367-208493389 CCGTGACGCACAGCACCAGCAGC 0: 1
1: 0
2: 0
3: 18
4: 234
Right 945326984 2:208493383-208493405 CAGCAGCCAGTCACAGGTGGCGG 0: 1
1: 0
2: 4
3: 34
4: 266
945326980_945326982 -10 Left 945326980 2:208493367-208493389 CCGTGACGCACAGCACCAGCAGC 0: 1
1: 0
2: 0
3: 18
4: 234
Right 945326982 2:208493380-208493402 CACCAGCAGCCAGTCACAGGTGG 0: 1
1: 0
2: 1
3: 26
4: 275
945326980_945326988 21 Left 945326980 2:208493367-208493389 CCGTGACGCACAGCACCAGCAGC 0: 1
1: 0
2: 0
3: 18
4: 234
Right 945326988 2:208493411-208493433 ACACGCATGGTGCTTATCTCTGG 0: 1
1: 0
2: 2
3: 3
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945326980 Original CRISPR GCTGCTGGTGCTGTGCGTCA CGG (reversed) Exonic
900626595 1:3611399-3611421 GCTGCAGGTGCGGAGCGTCCCGG + Exonic
901825562 1:11858882-11858904 GCTGCTGCTGCGATGCGTCCGGG + Exonic
902920431 1:19663404-19663426 GCTGCTGGTGATCTGGGGCAAGG + Intergenic
904945554 1:34196409-34196431 ACTGCTGGTGCTGTACATGAAGG + Intronic
905310328 1:37044475-37044497 GCTGGTGGTGCTGTGGGGAAAGG - Intergenic
905381006 1:37561600-37561622 GCTGCTGCTGCTGCGAGTCCGGG + Exonic
907050553 1:51327105-51327127 ACTGCTGCTTCTGTGCCTCATGG + Intronic
907291184 1:53413946-53413968 GCTTCTGGGGCTGTGGGTTAGGG - Intergenic
915319097 1:155046398-155046420 GCTGGTGGTGCTGTGTGGCTTGG + Exonic
919085964 1:192920187-192920209 GCTGCTGGTGCTGCTAGTCCGGG + Intergenic
921762873 1:218937294-218937316 GCTGCAGATGCTGTGGGTGATGG + Intergenic
922565171 1:226596989-226597011 GCTGTTGGTGCTGCGCCTCCTGG + Intronic
923490274 1:234478395-234478417 GCTGCTGGTCCTGAGCGCCCTGG - Exonic
923724152 1:236491874-236491896 GCTGCGGGGGCTGTGAGGCATGG + Intergenic
923778348 1:236999482-236999504 GCTGCTGCTGCCGTGAGTTAAGG + Intergenic
924350168 1:243107135-243107157 GCTGCTGCTGCTGCGGTTCACGG + Intergenic
1063962483 10:11318468-11318490 TCTGCTGGTGCTGTGCATGTAGG - Intronic
1064030603 10:11880459-11880481 CCTGAGGGTGCTGTGCGTGATGG - Intergenic
1064838692 10:19564042-19564064 GTTGCTGGTGCTGTGCTTCCTGG + Intronic
1065727272 10:28677933-28677955 GCAGCTGGAGCTCTGCGCCATGG + Exonic
1067295794 10:44974643-44974665 GCTGCCGGTGCTGCGGGTGAGGG - Intronic
1067432773 10:46254773-46254795 GATGCTGGTCCTGGGCCTCAGGG - Intergenic
1072633836 10:97164808-97164830 GCTGCGGGTGCTGTGAGTATGGG - Exonic
1073204074 10:101759516-101759538 GCTGCTGGAGCAGTCAGTCATGG - Intergenic
1074516360 10:114174051-114174073 GCTGCTGGAGCTCTGGCTCAGGG + Exonic
1075138534 10:119809602-119809624 GGTGCTGGTGATGTGCAGCAAGG + Intronic
1075706459 10:124504882-124504904 GATGCTGGGGCAGTGCGTCTGGG + Intronic
1077105943 11:842705-842727 GCTCCTGGGCCTGTGCGTCCCGG + Intergenic
1077187559 11:1242192-1242214 GCTGGTGGTGGTGTTAGTCAAGG - Exonic
1079380613 11:19934127-19934149 GCTGCTGATGCTGTGGTTCAGGG - Exonic
1080304945 11:30826056-30826078 GCTGCTGCTGCTCTGAGTCTGGG + Intergenic
1081772891 11:45660702-45660724 GGGGCTGGTGCTGTCCTTCAAGG - Intronic
1083883031 11:65557839-65557861 GCTGCTGGGCCTGGGCGGCAGGG - Exonic
1084148462 11:67277259-67277281 ACTGCGGATGCTGTGGGTCAGGG - Exonic
1084468532 11:69341601-69341623 GGTGCTGCTGCTGTGGGTCCAGG - Intronic
1084701187 11:70787245-70787267 GCTGCTGGTGGTGGTGGTCACGG - Intronic
1090682618 11:129077617-129077639 GCTGCAGGTGCTGTGGGGGATGG - Intronic
1091845214 12:3650606-3650628 GATCCTGGTGCTGTGCTTTAGGG + Intronic
1098462864 12:70752188-70752210 GTTGCTGGTGCTGTGGGCAAAGG - Intronic
1103561911 12:121797335-121797357 GCTGCTGGCGCTGGGCCCCAGGG - Intronic
1104301822 12:127571311-127571333 GCTGCTGCTCCTGTCTGTCAAGG + Intergenic
1104906342 12:132215454-132215476 GCTGCTTGTGCTCTCCGTCGAGG - Intronic
1105420913 13:20251585-20251607 GCTGCTGCTGCTGCTGGTCAGGG + Intergenic
1105432614 13:20350962-20350984 GCTGCTGGGGCTGGGCCTCGGGG + Intergenic
1106025666 13:25953283-25953305 GCTGCAGGTGCTGTGGGGAAGGG + Intronic
1107017498 13:35719487-35719509 GCAGGTGGTGCTGAGCCTCATGG + Intergenic
1110881545 13:80578116-80578138 GCTGCTGCTGCTGTGGGGGATGG - Intergenic
1111748232 13:92296423-92296445 GCTGCTGCTGCTGTGGGGGATGG + Intronic
1112430878 13:99349295-99349317 GCTTTAGGTGCTGTGTGTCAGGG - Intronic
1112558482 13:100491058-100491080 GCTGCTGCTGCTGCTGGTCAGGG + Intronic
1113534958 13:111058751-111058773 GCTGCAGATGCTGTGGGTGATGG + Intergenic
1113574795 13:111387624-111387646 GTTGCTGGGGCTGTGCGTCGTGG + Intergenic
1114189330 14:20429057-20429079 GCTGCAAGTGCTGTGCTGCAGGG - Exonic
1114406174 14:22458438-22458460 CCCACTGGTGCTGTGTGTCATGG - Intergenic
1118162323 14:63302396-63302418 GCTGCTGCTGCTGTGGGGGATGG - Intergenic
1118348358 14:64956069-64956091 GATGCTGATGCTGTGGGTCCAGG - Intronic
1119234180 14:73005771-73005793 GCTGCTGCTGCTGTGCACCTGGG - Intronic
1119408658 14:74414340-74414362 GCAGCTGGGGCTGTGGGTCTGGG + Intronic
1119741643 14:77017616-77017638 GGGGCTGGTGCTGTGAGTCTTGG + Intergenic
1119912896 14:78367155-78367177 TCTGCTGGTTCTGTGCTTCTGGG + Intronic
1120888286 14:89469243-89469265 CCTCCTGGTGCTGTGGGTCTGGG - Intronic
1121098576 14:91234288-91234310 GCTGCTGGTGCGCAGCGTCTGGG - Exonic
1122034131 14:98935264-98935286 GCTGCTGGGGTTGTTGGTCAGGG - Intergenic
1122290366 14:100677606-100677628 GCTGCTGGTGCTGGGTGCCCCGG + Intergenic
1122860799 14:104581596-104581618 CCTGCTGGTGCTGTACCTCCGGG - Intronic
1127007379 15:54585421-54585443 GATGCTGGTGCTGTGCTTCTTGG + Intronic
1127264026 15:57346798-57346820 GCGGCTGGTGCTGGGGGGCAAGG + Intergenic
1127289365 15:57556674-57556696 GCTGCTGTTGCTATGGGTCATGG + Intergenic
1127289570 15:57557980-57558002 GCTGCTGTCGCTATGGGTCATGG + Intergenic
1129468845 15:75738946-75738968 GCTGCAGGTGCAGAGCGTCCCGG - Intergenic
1129973979 15:79805620-79805642 GTTCCTGGGGCTGTGCTTCAGGG + Intergenic
1130737772 15:86568645-86568667 GCTGCTGATGCTCTGCTCCAGGG - Intronic
1131091861 15:89629540-89629562 GCTGCTGGTGCTGCTCCTCTCGG + Exonic
1132170665 15:99650793-99650815 GCTGCTGCTGCTGCTGGTCAGGG - Intronic
1132285835 15:100661649-100661671 GCTGCTGCTACTGTGGGTCCTGG + Intergenic
1132309869 15:100849671-100849693 CCTGCTGGTTCTGTACGTCCAGG - Intergenic
1132703001 16:1229915-1229937 GCTGCTGGCGCTGCCCGTCCTGG - Exonic
1132705322 16:1240953-1240975 GCTGCTGGCGCTGCCCGTCCTGG + Exonic
1132708451 16:1256316-1256338 GCTGCTGGCGCTGCCCGTCCTGG + Exonic
1133464365 16:6016105-6016127 GTGGCTGGTGCTGTGCATCAGGG + Intergenic
1134542064 16:15075679-15075701 GAAGCTGGTGCTGTGAGTCTTGG - Intronic
1135027056 16:19006669-19006691 TCTGCTGATTCTGTGCATCAGGG + Intronic
1135258856 16:20963867-20963889 GCTCTTCGTGCTGTGGGTCAAGG + Exonic
1136003757 16:27314567-27314589 GTGGCCGGTGCTGTGCGTCATGG + Intronic
1137403279 16:48170777-48170799 GCTGCTGCTGCTTCGGGTCATGG - Intronic
1137789619 16:51164129-51164151 GCTGCTGTGGCTGTGGATCACGG + Intergenic
1138599243 16:58045335-58045357 GCTGCTGCTGCTCTGCGTCCTGG + Exonic
1139474464 16:67195881-67195903 GCTGCTGCTGCTGTCCAGCAGGG - Exonic
1140378583 16:74465550-74465572 GCTGCTGCTGCTGCTCGTCTAGG + Intronic
1140834858 16:78783934-78783956 GATGCTGGTGCTGTTGGTGATGG + Intronic
1140972868 16:80030125-80030147 GCTGCTGATGCTGTGTGTCCAGG - Intergenic
1141454003 16:84126316-84126338 GCTGATGCTGCTCTGCTTCAGGG + Intronic
1141801634 16:86313570-86313592 GGAGCTGGTGCTGTGAGTCTAGG - Intergenic
1142005470 16:87687735-87687757 GCTGGTGGTGCTGGGAGTCGGGG + Intronic
1142193101 16:88726882-88726904 GCTGGTGGTGGTGTTTGTCACGG - Exonic
1142423679 16:89989190-89989212 GTTGCAGGTGGTGTGGGTCAGGG + Intergenic
1144215007 17:13047626-13047648 GCTCCTGGTGCTTTGCTGCATGG + Intergenic
1144419888 17:15086923-15086945 GCCTCTGGTGCTGTGTGTCCAGG + Intergenic
1145250874 17:21296384-21296406 GCTGCTGGCCCTGTGTGCCATGG + Intronic
1145274054 17:21419641-21419663 TCTGCTGGTGCTGTGCTGCGTGG + Exonic
1145311917 17:21705540-21705562 TCTGCTGGTGCTGTGCTGCCCGG + Intergenic
1146022931 17:29293978-29294000 GCTGCTGCTGCTGAGGGTGATGG + Exonic
1146265364 17:31449297-31449319 GGTGCGGGTGCTGTGGGTGAGGG - Intronic
1147292014 17:39451148-39451170 ACTGCTGGTGCCCTGCGTCCCGG - Exonic
1147980853 17:44273037-44273059 GGTGCTGGTGATGAGGGTCACGG - Intergenic
1148189592 17:45669258-45669280 GCTGCTGCTGCTGTGAGTTTTGG + Intergenic
1150143812 17:62751573-62751595 GATTCTGATGCTGTGGGTCAGGG + Intronic
1151267439 17:72967604-72967626 GCTGTTGGAGCTTTTCGTCACGG - Intronic
1151318571 17:73338743-73338765 GGTGCTGGTGCTGTTGGTGACGG + Exonic
1151380810 17:73724539-73724561 GCTGCAGGCGCTGTGGGGCATGG + Intergenic
1152115588 17:78385026-78385048 GCTGCGCGTGCTCTGCTTCATGG - Intronic
1152231619 17:79116866-79116888 GCTGCTGATGCTGTGGGCCCAGG - Intronic
1152407819 17:80107661-80107683 CCAGCTGGTGCTGAGCATCAGGG - Intergenic
1154416780 18:14179571-14179593 GCTGCTTGTCCAGGGCGTCAAGG - Intergenic
1157294511 18:46433142-46433164 GCCGCTCGTGCTGGTCGTCATGG + Intronic
1159196691 18:65124885-65124907 GCCGCTGGTTCTGTACGTCTTGG + Intergenic
1159535365 18:69707974-69707996 TCTGCCTGTGCTGTGCGTCGTGG - Intronic
1160659100 19:290197-290219 GCTGTTGCTGCTGTGTGCCAGGG - Intronic
1161761101 19:6173266-6173288 TCTGGTGGTGCAGTGGGTCAAGG + Intronic
1163406887 19:17128449-17128471 GGAGCTGGGGCTGTGCTTCACGG - Intronic
1163442841 19:17330230-17330252 GGAGCTGGTGCTGAGCGTGAAGG - Exonic
1163678699 19:18668618-18668640 GCTGAACGTGCTGTGCGGCATGG + Exonic
1163762465 19:19145261-19145283 GCTCCCGGCGCTGTGGGTCATGG - Intergenic
1164388313 19:27795126-27795148 GCTGCTGGGCCTTAGCGTCAGGG + Intergenic
1164497207 19:28777478-28777500 TCTACTGGTGCAGTGGGTCAAGG - Intergenic
1164578748 19:29421358-29421380 GCTGCACGTCCTGTGAGTCATGG - Intergenic
1165786319 19:38463884-38463906 GCTGCTGGTGCGGTGGGGGAGGG + Intronic
1167725763 19:51211792-51211814 GATGCTGGGCCTGTGGGTCAGGG - Intergenic
925714668 2:6773080-6773102 GCTCCTGGGGCTGTGGGTCTGGG + Intergenic
927636776 2:24822384-24822406 GGTGCTGGTGGTGTGTGTCTGGG + Intronic
932270374 2:70403767-70403789 GCTGCAGCTGCTGTGCGGGATGG - Intergenic
932493330 2:72134721-72134743 GGTGCTGGTGCTGCCCGTGAGGG + Intronic
932640503 2:73441031-73441053 CCTGCTGGTGCTGTGTGGGAAGG + Intronic
932876960 2:75462412-75462434 GCTGATGGTGCCGTGCTCCAAGG + Intergenic
933621118 2:84542557-84542579 GCTGATGGTGCTGTGCGAAGTGG - Intronic
935788995 2:106573896-106573918 GATGCTGATGCTGTCAGTCAAGG - Intergenic
939407080 2:141772448-141772470 GATGCTGATGCTGTGGATCAGGG - Intronic
940902326 2:159137232-159137254 GTTGCTGGTGCTGTATGGCAGGG + Intronic
942891261 2:180991722-180991744 GCTGCTGCTGCTGTGGCCCAGGG + Intronic
943950002 2:194121348-194121370 ACTGCAGGAGCTGTGCTTCATGG + Intergenic
945073010 2:206009746-206009768 GCTGCTGGTGCTGAACTTTACGG + Exonic
945326980 2:208493367-208493389 GCTGCTGGTGCTGTGCGTCACGG - Exonic
1170044761 20:12073192-12073214 GCTGCTGATGCAGTGTATCATGG + Intergenic
1171255871 20:23688747-23688769 GCTGCAGGTGCTGCGAGCCAGGG - Exonic
1172245640 20:33443566-33443588 GCTGCTGGAGCTGCGCGCCGGGG - Exonic
1174501484 20:50988382-50988404 GCTGCTGGGACAGTGAGTCAAGG + Intergenic
1174662196 20:52223296-52223318 GATGCTGATGCTGTGGGTCATGG + Intergenic
1179530852 21:42018584-42018606 GCTGCTGGGCCTGTGCTCCAAGG - Intergenic
1182577574 22:31283357-31283379 GCTGCTCTTGCTGAGCCTCAGGG - Intronic
1183102574 22:35593033-35593055 AGTTCTGGTGCTGTGGGTCATGG - Intergenic
1183692757 22:39400057-39400079 GCTGCTGCTGCCGGGCGTCGAGG + Intronic
1184519693 22:44985996-44986018 GCTGCTGGTGATGGTTGTCATGG - Intronic
1184519709 22:44986113-44986135 GCTGCTGGTGATGGTTGTCATGG - Intronic
1184519745 22:44986370-44986392 GCTCCTGGTGATGGGTGTCATGG - Intronic
1185265528 22:49900686-49900708 GCTGCTGTTGCTGGGGGCCAGGG + Exonic
950052436 3:10002813-10002835 GTTGCTGGTGCTCTGCGTGGAGG - Intronic
950054410 3:10013059-10013081 GCTGCTGGTGGTGTGGGTGGAGG - Intergenic
950304241 3:11906015-11906037 GCTGCTGGTGCTCTGGGTGAAGG - Intergenic
950304262 3:11906102-11906124 GCTGCTGGTGTTCTGGGTGAAGG - Intergenic
950304614 3:11908303-11908325 GCTGCTGGTGCTCTGGGTAGAGG - Intergenic
950304633 3:11908390-11908412 GCTGCTGGTGCTCTGGGTGAAGG - Intergenic
950724414 3:14907259-14907281 TCTGCAGGTGCTGTGTTTCATGG + Intronic
954487153 3:50863221-50863243 TCTGGTGGTGCTGTGACTCAAGG + Intronic
958775946 3:98483143-98483165 GCTGCAGCTGCTGTGGGTGATGG + Intergenic
959128811 3:102325383-102325405 GCTGCTGCTGCTGCTCTTCAGGG + Intronic
959279776 3:104323448-104323470 GCTGCTGCTGCTGTGGGGGATGG - Intergenic
961452776 3:127009827-127009849 GCAGCTGGTGCTGTGTGCCAGGG + Intronic
962034449 3:131636463-131636485 GCTGCAGCTGCTGTGGGTGATGG - Intronic
962416451 3:135186978-135187000 GCTTCTGATGCTGTGGGTCTAGG + Intronic
962688256 3:137868217-137868239 GCTGCTGCTGCTGGGGGTCAGGG - Intergenic
962764573 3:138549532-138549554 GCTGCAGCTGCTGTGGGGCATGG - Intronic
962897566 3:139729994-139730016 GCTGCTGGTGCTGCTTGTCTGGG + Intergenic
963904421 3:150762478-150762500 GTTCCTGATGCTGGGCGTCAGGG + Exonic
963906699 3:150779114-150779136 CCTGCTGGAGCTCTGCGTGACGG - Intergenic
966817758 3:183903382-183903404 GGTGCTGATGCTGTGAGTCCAGG - Intergenic
968952346 4:3701634-3701656 GATGCTGGTGCTGTCCTCCAGGG + Intergenic
972245868 4:37244893-37244915 CCGGCGGGTGCTGTGCGCCACGG + Exonic
974033259 4:56795182-56795204 GCTGCTGATGCTGCTGGTCAGGG - Intergenic
976856480 4:89610244-89610266 GCTGCAGCTGCTGTGGGGCATGG - Intergenic
977019996 4:91746879-91746901 GCTGCTGCTGCTGTGGGGGATGG + Intergenic
977895912 4:102364963-102364985 GCTCTTGGTGCTGTACGTCAGGG - Intronic
979251772 4:118573412-118573434 GCTGCTGCTGCTGCGGTTCACGG - Intergenic
980688537 4:136261146-136261168 TCTGGTGGTGCAGTGGGTCAAGG - Intergenic
981240537 4:142471646-142471668 ACTGCTGATGCTGGGCCTCAGGG - Intronic
985678897 5:1245919-1245941 GCTGCCCGTGCTGTGGGTCCCGG + Exonic
985964565 5:3330103-3330125 GCTGCTGGTGCTGAGGGTGGAGG - Intergenic
988598951 5:32621714-32621736 GCTGCATGTGCTTTGCTTCACGG + Intergenic
988894264 5:35655167-35655189 AATGCTGGTGCTGTTCGTCCAGG - Intronic
989009695 5:36856201-36856223 GCTGCCTGTGCCGTGCGTTAGGG - Intergenic
989323727 5:40165840-40165862 TCTGGTGATGCAGTGCGTCAAGG - Intergenic
991245720 5:64506579-64506601 GCCGCTGGTGCAGTGCGCCCCGG - Exonic
992816135 5:80441117-80441139 ACTGCTGGTGCTGTTAGCCAAGG + Intronic
997302258 5:132814275-132814297 GCTGCCGGTGCGCTGCGTCCCGG + Exonic
998349092 5:141489305-141489327 GCTGCTGGGGCTGGGTGTCTGGG + Exonic
998625446 5:143840825-143840847 GCTGATGGTTTTGTGGGTCAGGG + Intergenic
998940866 5:147280608-147280630 GCTGCTGCTGCTGTGGGGAATGG - Intronic
1001271043 5:170311966-170311988 GCTGCTACTGCTGTCTGTCAGGG - Intergenic
1002081814 5:176741844-176741866 GATGCAGGTGCTGTGCTGCAGGG - Intergenic
1002814775 6:669433-669455 GCTGCTGGTGCTGTGGGTGGAGG + Intronic
1004096176 6:12556679-12556701 GCTGCTGCTGCTTTGCTCCAGGG + Intergenic
1006808035 6:36801352-36801374 GATGCTGATGCTGTGGGTCTGGG + Intronic
1007513358 6:42391626-42391648 GCTGCTGGTCCTGTGGGCCTCGG + Intronic
1011329070 6:86183859-86183881 GATGCTGGTGCTGTGGGAGATGG + Intergenic
1012922681 6:105235442-105235464 GCTGCAGCTGCTGTGGGTGATGG - Intergenic
1014336825 6:120147477-120147499 GCTGCAGCTGCTGTGGGGCATGG - Intergenic
1016990581 6:149925408-149925430 GCTCCAGATGCTGTGTGTCAAGG - Intergenic
1018435138 6:163752456-163752478 GATGCTGGTTCTGTGGGGCAGGG + Intergenic
1022265150 7:28746420-28746442 CCCGGTGGTGCTGTGGGTCAAGG - Intronic
1023567653 7:41539548-41539570 GATGCTGATGCTGTTTGTCAAGG - Intergenic
1023995708 7:45157870-45157892 GCTGCTGCTGCTCTGCGGTAAGG + Exonic
1028941842 7:96530288-96530310 GCTGCTGGTGGTGGAGGTCAAGG + Intronic
1029506486 7:100966497-100966519 GCTGCTGGCGCTGGGCGTCCGGG + Exonic
1031868564 7:127067111-127067133 GCTGTTGGTGCTGTGTGGAATGG - Intronic
1032854594 7:135823921-135823943 GATGCTGCTGCTGTGGGTCCAGG + Intergenic
1034415340 7:150961676-150961698 AGTGGTGGTGCTGTGAGTCAAGG + Intronic
1035352982 7:158259400-158259422 GCAGCTGCTGCTGTGCTGCAGGG + Intronic
1035353599 7:158264150-158264172 GCTGCTGCGGCTGTTCGTTAGGG - Intronic
1036090295 8:5657834-5657856 GATGCTGGAGCTGTCCCTCATGG + Intergenic
1043515234 8:80989838-80989860 GCTGCTGCTGCTGTGGGTGGAGG + Intronic
1046330438 8:112707685-112707707 GCTCCTGGGGCTGTGTGTCCAGG + Intronic
1047627097 8:126667320-126667342 ACTGCTGTTGCTGTGCCTCCTGG + Intergenic
1047807240 8:128373243-128373265 GCTGCTGGTGCTGTTGGTACTGG + Intergenic
1048037643 8:130692758-130692780 TCTGCTGATGCAGTGGGTCAAGG + Intergenic
1048094588 8:131277718-131277740 GCTGCTGCTGCTGATGGTCATGG + Intergenic
1049183395 8:141235160-141235182 ACTGCTGCTGCTGTGGGTCGGGG - Intronic
1049426553 8:142540494-142540516 GCAGCTGGTGCTGAGCGCCTGGG + Intronic
1049681210 8:143919224-143919246 GCTGCTGGAGCGGTGCGTGGAGG - Exonic
1049815496 8:144597281-144597303 GCTGCTGGTGCAGAGTGTCCTGG - Intronic
1049853184 8:144845284-144845306 CCTGCTGGGCCTCTGCGTCATGG - Intronic
1050702739 9:8359210-8359232 GCTGCTGATGCTGCTGGTCATGG - Intronic
1052496976 9:29239600-29239622 GATGCTGATGCTGTGGGTCTGGG - Intergenic
1055270600 9:74553962-74553984 GATGCTGACGCTGTGGGTCAGGG - Intronic
1055971757 9:81918934-81918956 GCTCCTGCTGCTGTGCCACACGG - Intergenic
1055973509 9:81934006-81934028 GCTCCTGCTGCTGTGCCACACGG - Intergenic
1055975263 9:81949098-81949120 GCTCCTGCTGCTGTGCCACACGG - Intergenic
1060390869 9:123275598-123275620 GCTGGTTGTGCTGTGGGTGAGGG + Intergenic
1060729199 9:126026591-126026613 GCTCCTCCTGGTGTGCGTCAGGG + Intergenic
1061774087 9:132948983-132949005 GCAGCAGGAGCTGTGCCTCACGG - Intronic
1185589368 X:1263911-1263933 GCTGCTGGAACTGGGCATCATGG - Intergenic
1185589381 X:1264025-1264047 GCTGCTGGAACTGGGCATCATGG - Intergenic
1185589394 X:1264139-1264161 GCTGCTGGAACTGGGCATCACGG - Intergenic
1185589406 X:1264253-1264275 GCTGCTGGAACTGGGCATCACGG - Intergenic
1185589418 X:1264367-1264389 GCTGCTGGAACTGGGCATCATGG - Intergenic
1185589430 X:1264481-1264503 GCTGCTGGAACTGGGCATCATGG - Intergenic
1185589442 X:1264595-1264617 GCTGCTGGAACTGGGCATCATGG - Intergenic
1185761656 X:2693301-2693323 GCTGCTGATGCTTTGAGTAAAGG + Intronic
1189129098 X:38479939-38479961 GCTGGTGGTGCTGTTCTTCAGGG - Intronic
1190448930 X:50558075-50558097 GCTGCAGCTGCTGTGGGTGATGG - Intergenic
1193541262 X:82775422-82775444 GCTGCAGCTGCTGTGCGGGATGG + Intergenic
1196117579 X:112014135-112014157 GCTGCTGGTGCTGCTGGTCCAGG + Intronic
1196231891 X:113233647-113233669 GCTGCAGCTGCTGTGGGTGATGG + Intergenic
1202124023 Y:21553795-21553817 TCAGCTGGTGCTGTGCCTCCAGG + Intergenic
1202154985 Y:21875585-21875607 TCAGCTGGTGCTGTGCCTCCAGG - Intergenic