ID: 945330246

View in Genome Browser
Species Human (GRCh38)
Location 2:208530490-208530512
Sequence GGCTGCACACTCTGTGGAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 443
Summary {0: 1, 1: 15, 2: 42, 3: 89, 4: 296}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945330246_945330254 12 Left 945330246 2:208530490-208530512 CCGGCTCCACAGAGTGTGCAGCC 0: 1
1: 15
2: 42
3: 89
4: 296
Right 945330254 2:208530525-208530547 CCCTGCTGCAGCTGGTATGATGG 0: 1
1: 29
2: 60
3: 112
4: 400
945330246_945330251 4 Left 945330246 2:208530490-208530512 CCGGCTCCACAGAGTGTGCAGCC 0: 1
1: 15
2: 42
3: 89
4: 296
Right 945330251 2:208530517-208530539 CTGTGCCTCCCTGCTGCAGCTGG 0: 5
1: 17
2: 35
3: 107
4: 437

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945330246 Original CRISPR GGCTGCACACTCTGTGGAGC CGG (reversed) Intronic
900183067 1:1320859-1320881 GGCTGCACCCTGTGGGGAGCAGG - Intronic
900228562 1:1544301-1544323 GGATGGACCCTGTGTGGAGCTGG - Intronic
900295524 1:1947209-1947231 GGCTGCACCCTCTCTGGGCCTGG - Intronic
901691036 1:10973641-10973663 GGTCGAACACTCTATGGAGCTGG + Intronic
902296436 1:15470228-15470250 GGCTGCACACACTGTGTCCCTGG - Intronic
902299237 1:15489515-15489537 GGCTGCACACACTGTGTCCCTGG - Intronic
902327206 1:15709136-15709158 GAGTGCACACTCTGTGCATCAGG - Intronic
902644904 1:17791240-17791262 GGCTGTACACTCCGTGGAGCTGG - Intronic
903189569 1:21649210-21649232 GGCTGCCCTCTCTTTGGAGGAGG - Intronic
903672273 1:25043432-25043454 GGCTGCATTCTCCATGGAGCTGG - Intergenic
903750247 1:25616940-25616962 GGCTGCGCGCTCCGCGGAGCCGG + Intergenic
904551650 1:31324375-31324397 GGCTGCATGTTCTATGGAGCTGG + Intronic
905001147 1:34671165-34671187 GGCTGCACACTCCGTGAGGCAGG + Intergenic
905684469 1:39898902-39898924 GGCTGCAAAATGTGTGGAGCAGG - Intronic
907369783 1:53993188-53993210 GGCTGCACACTCTGTGAAGCCGG - Intergenic
907603521 1:55793800-55793822 GGATGCACACTCTGTGGAGCTGG + Intergenic
907761655 1:57367680-57367702 GGTTCCACACTCCGTGGAGCTGG + Intronic
908902321 1:68969825-68969847 GGCTGCTCCATTTGTGGAGCAGG + Intergenic
909054031 1:70802180-70802202 GGCATCACACTCTGAGGAGTAGG - Intergenic
909054764 1:70807506-70807528 GGCTGCATGCTCCATGGAGCTGG - Intergenic
911227560 1:95323750-95323772 GGCAGCACACTCTTTGGATGAGG - Intergenic
912722095 1:112028838-112028860 GCTTCCACACTCTGGGGAGCTGG + Intergenic
912881954 1:113424162-113424184 AGCTGCACACTCCTTGGAGCTGG - Intronic
915079686 1:153343557-153343579 GGCAGCACACACTTTGGAGGAGG - Intronic
915095616 1:153460244-153460266 CCCTCCACCCTCTGTGGAGCTGG + Intronic
916667514 1:166979789-166979811 GGCTGCCCCCACTGTTGAGCAGG - Intronic
917848937 1:179043459-179043481 GGCTGCACACTCCACGGAGCTGG - Intronic
919513554 1:198494700-198494722 GGCTGCAGGCTCCATGGAGCCGG - Intergenic
919559672 1:199101250-199101272 GGAGAGACACTCTGTGGAGCGGG + Intergenic
919653997 1:200180186-200180208 GGCTTCACACTCTGAGGGGTAGG - Intergenic
920685183 1:208103896-208103918 GGCTACACTCTCTGGGGGGCAGG - Intronic
921181725 1:212636781-212636803 GGCAGCACACTGTGTGGATGAGG - Intergenic
921255012 1:213331290-213331312 GGGTGCCCACTCTGTGCAGGAGG + Intergenic
921767051 1:218983994-218984016 GGCTGCATACTCAATGGAGCTGG - Intergenic
921984597 1:221298663-221298685 GGCAACACACTCTGGGGAACAGG - Intergenic
922503565 1:226113769-226113791 AGCTGCACACTGTGAGGAGAAGG - Intergenic
923157250 1:231289757-231289779 GGCTCCACACTCGGAGCAGCCGG - Intergenic
923918090 1:238530756-238530778 GGCTACTCACTCTGTGGAGATGG - Intergenic
924672885 1:246147499-246147521 GGCTGCACACTCCATGGAGGCGG + Intronic
1064674556 10:17748225-17748247 GGCTGGACACTCTATGGCCCAGG + Intergenic
1064684284 10:17843808-17843830 TGCTCCAGACTTTGTGGAGCAGG + Intronic
1065830208 10:29608383-29608405 GATTGTGCACTCTGTGGAGCTGG + Intronic
1066659899 10:37728641-37728663 GGCTGCACACCTTGGGGAACAGG - Intergenic
1066695160 10:38070722-38070744 GCCTGCACGCTCTCTTGAGCAGG + Intergenic
1068300503 10:55132100-55132122 GGCTACACACTCCATGGAGCTGG - Intronic
1068474304 10:57506581-57506603 GGCTGCACGCTCCATGGAGCTGG + Intergenic
1069731905 10:70622555-70622577 GGCTGCACACTCCATAAAGCTGG + Intergenic
1070401517 10:76056911-76056933 GGCTGCTTGCTCTATGGAGCTGG - Intronic
1070684843 10:78472694-78472716 AGCTGCACACTCATTAGAGCGGG - Intergenic
1072871459 10:99124866-99124888 GGCTGCACACTCCATGGAGCTGG - Intronic
1073207500 10:101776472-101776494 GGCTGCAAACTCTGCGGGCCGGG + Intronic
1074991660 10:118713412-118713434 GGCTGCATGCTCCATGGAGCCGG - Intronic
1075488990 10:122850055-122850077 GGCTGCAGATTCTGTGGGGGAGG - Intronic
1075614699 10:123882818-123882840 GGCTGCCCAGGCTGTGGAGTTGG - Intronic
1076062900 10:127427498-127427520 TGCCTCACACTCTGTGAAGCAGG + Intronic
1076361118 10:129889516-129889538 GGCTGCAGAGTTTGGGGAGCAGG - Intronic
1076648794 10:131972824-131972846 GGCTGGACACTCAGCTGAGCGGG - Intronic
1076655352 10:132019937-132019959 GGCTGCACACTCCACAGAGCCGG - Intergenic
1077476686 11:2793806-2793828 GGCTGTACATTCTAAGGAGCAGG - Intronic
1077912596 11:6586589-6586611 GGCTGCATGCTCCATGGAGCCGG + Intronic
1078042911 11:7884616-7884638 GGCTGCATGCTCCATGGAGCTGG - Intergenic
1078315327 11:10289410-10289432 GGCTGCACACTCCACGGACCTGG - Intronic
1079733141 11:23961765-23961787 GGCTGCACACTCCATGGAGCTGG + Intergenic
1079733201 11:23962044-23962066 TCCTGCTCGCTCTGTGGAGCAGG - Intergenic
1080209921 11:29773848-29773870 GGCTGCATGTGCTGTGGAGCAGG - Intergenic
1083272168 11:61578077-61578099 GGCTGGACAGAGTGTGGAGCTGG + Intronic
1083652488 11:64211429-64211451 GGGTGCACCTGCTGTGGAGCTGG - Exonic
1087036095 11:93758185-93758207 GGCTACACACTCTATGGAGCGGG + Intronic
1088704413 11:112448406-112448428 GGCTGCACACTCCATGGAGCTGG - Intergenic
1089823011 11:121246054-121246076 GGCTGTACACTCCATAGAGCTGG + Intergenic
1090611337 11:128473765-128473787 AGCTGCTCACTCTCTGCAGCAGG + Intronic
1092604040 12:10099828-10099850 AGCTGCACTCTCTGTAGAGGAGG + Intronic
1093183165 12:15989210-15989232 GGCTGCACACTCCGTGGAGCTGG - Intronic
1093525852 12:20102665-20102687 GGCTGCATGCCCTGTGGAGCTGG - Intergenic
1094427145 12:30327802-30327824 GGCTGCACACTCCATGGAGCTGG + Intergenic
1095767446 12:45912690-45912712 GACTTCACACACTTTGGAGCAGG + Intergenic
1096687669 12:53299623-53299645 TGCTGCTCACTCTGCAGAGCTGG + Intergenic
1096782018 12:53997065-53997087 GCCTGCCCACTCTGCGGAGGCGG - Intronic
1096944857 12:55392694-55392716 AGGTGCACGCTCAGTGGAGCCGG - Intergenic
1098218643 12:68245589-68245611 CACTGCACAGCCTGTGGAGCAGG + Intergenic
1099049884 12:77768806-77768828 GGTTGCACACTCCATGGAGCTGG - Intergenic
1100388346 12:94124244-94124266 GGCTGAACATTCTCTGGAGATGG + Intergenic
1100847730 12:98678360-98678382 GGCTGCATGCTCTGTGGAGCTGG + Intronic
1103177413 12:118876772-118876794 GGCTGCACACTGACTGGGGCTGG + Intergenic
1104937863 12:132376112-132376134 GGGGCCACACTCTGAGGAGCAGG - Intergenic
1105419886 13:20242618-20242640 GGCTGAACACTCTATGATGCTGG - Intergenic
1105424324 13:20282283-20282305 GGCTGCACACTCTATGGAGCTGG + Intergenic
1108975835 13:56442258-56442280 GGATGCCCACTCAGTGCAGCAGG - Intergenic
1109633793 13:65086184-65086206 TCCTGCATGCTCTGTGGAGCTGG + Intergenic
1110730927 13:78877453-78877475 AGCTGTGCATTCTGTGGAGCTGG - Intergenic
1110785547 13:79520870-79520892 GCCTGCACAATCTGCGGTGCTGG - Exonic
1110980230 13:81888998-81889020 GGCTACACACTCCGAAGAGCTGG + Intergenic
1110999861 13:82165232-82165254 GGCTCCACACTCGGAGCAGCTGG - Intergenic
1111202959 13:84962578-84962600 GGCTGCATGCTCTGAGGAGCCGG - Intergenic
1111354569 13:87080715-87080737 AGCTGCACACTCCGCAGAGCAGG - Intergenic
1111800627 13:92975404-92975426 GGTTGCACACTCCATGGAGCTGG - Intergenic
1112741030 13:102472675-102472697 GGCTGCATGCTCTGTGGAGCTGG - Intergenic
1113537782 13:111081930-111081952 GGCTGCAGCCCCTGTGGAGGGGG - Intergenic
1113868597 13:113544681-113544703 GGAGGCACCATCTGTGGAGCAGG - Intronic
1114280897 14:21192002-21192024 GGCTGCATGCTTAGTGGAGCCGG + Intergenic
1115058991 14:29168276-29168298 GGTTGTCCACTCAGTGGAGCAGG + Intergenic
1115310712 14:31975213-31975235 GGCTGTACACTCTGTGGAGCCGG - Intergenic
1115327248 14:32153815-32153837 GGCTCAACACTTTGGGGAGCTGG + Intronic
1115484839 14:33900856-33900878 GGCTGTGCACTCCATGGAGCTGG + Intergenic
1116130725 14:40854028-40854050 GGCTGCACACTACTTGGAGCTGG + Intergenic
1116257103 14:42570891-42570913 GGCTACACATTCCATGGAGCTGG + Intergenic
1118192743 14:63594989-63595011 GTCTGCAGGCTCTTTGGAGCTGG - Intergenic
1118323999 14:64769325-64769347 AGGTGCACACACTTTGGAGCTGG - Intronic
1119147112 14:72327275-72327297 AGCTGCCTTCTCTGTGGAGCAGG + Intronic
1119618005 14:76111579-76111601 GGCTGTGCACTCCATGGAGCTGG + Intergenic
1119680881 14:76591486-76591508 GTGAGCACACGCTGTGGAGCAGG - Intergenic
1121824768 14:97001081-97001103 GGCTGCACGTTCCATGGAGCAGG - Intergenic
1122078841 14:99253235-99253257 GGCGGTGCACTCTGAGGAGCCGG - Intronic
1123422751 15:20145177-20145199 GGCTGCACTCCTTGGGGAGCAGG + Intergenic
1123531975 15:21151717-21151739 GGCTGCACTCCTTGGGGAGCAGG + Intergenic
1124650408 15:31469679-31469701 GGCTGCACACTCCATGGAGCTGG - Intergenic
1124655038 15:31500701-31500723 AGCTGCACACTCAGTGGAAAAGG + Intronic
1125771623 15:42171322-42171344 GGCTGCACACACTCATGAGCTGG - Intronic
1128790797 15:70432114-70432136 GGCTGCACACTCCATGGAGCTGG - Intergenic
1128934598 15:71734592-71734614 GGGTGCACATTCTGTGGGTCTGG - Intronic
1129796628 15:78382346-78382368 GGCTGCACACTCCGTGGAGCTGG + Intergenic
1130015345 15:80181630-80181652 AGCAGCACACTCTTTAGAGCTGG + Intronic
1130029183 15:80296245-80296267 GGCTGCACACTCCATGGAGCTGG - Intergenic
1130183011 15:81651101-81651123 GACTACACACTCCGTGGAGCTGG + Intergenic
1131467518 15:92667645-92667667 GGCTCCACACTGTGGGGAACAGG - Intronic
1132305202 15:100807230-100807252 GGCTGCACACTCCGTGGAGCTGG + Intergenic
1132426709 15:101724177-101724199 GGCTGCACAGGCGGTGGCGCAGG + Exonic
1132864888 16:2088361-2088383 GGCTGCCCAAGCTGTGGGGCGGG + Intronic
1134078575 16:11309157-11309179 GGCTGCACATTCTCTGGAGGTGG - Intronic
1134232175 16:12437800-12437822 GGCTGCACCATCAGTGAAGCAGG + Intronic
1135114359 16:19712741-19712763 GGCCGGACACTGTCTGGAGCAGG + Intronic
1135345760 16:21687215-21687237 GGCTCCACAGTGAGTGGAGCAGG + Intronic
1137238422 16:46633976-46633998 GGCTGCACACTCCATGGAGCTGG - Intergenic
1137291691 16:47055819-47055841 GGCTGCACACTCCATGGAGCCGG - Intergenic
1137334519 16:47534123-47534145 GGCTGCATGCTCTGTGGGGTTGG - Intronic
1137588496 16:49679262-49679284 GGCTGCGCCCTCCGTGGAGCTGG + Intronic
1138454410 16:57113070-57113092 GGCTGGACAGCTTGTGGAGCAGG - Intronic
1139354581 16:66359995-66360017 GGCTGCACCATCTGTGGGGCAGG - Intergenic
1139390114 16:66601963-66601985 GGCTGCACACTCCATGGAGCAGG - Intergenic
1139571612 16:67816475-67816497 GGCCACACACTTTGTGGGGCTGG + Intronic
1140923899 16:79564906-79564928 GGCTGCACACTCTCTGCCTCTGG + Intergenic
1141125459 16:81397797-81397819 GGCTGTAGCGTCTGTGGAGCAGG - Intergenic
1142131509 16:88433550-88433572 GACTGCACCCTCGGTGGGGCCGG - Exonic
1142940812 17:3378603-3378625 GGCTGCGTGCTCGGTGGAGCTGG - Intergenic
1143209567 17:5175126-5175148 GGTTGGAAACTCTGTAGAGCAGG + Intergenic
1144386166 17:14751110-14751132 GGCAGCTTACTCTGTAGAGCAGG - Intergenic
1144617839 17:16792595-16792617 GGTTGGAAACTCTGTAGAGCAGG - Intronic
1144619047 17:16804586-16804608 GGTTGGAAACTCTGTAGAGCAGG + Intergenic
1144632168 17:16879807-16879829 GGCTGCCCACACTGTGGAGAAGG - Intergenic
1144637965 17:16923117-16923139 GGCCGCCCACACTGTGGAGGGGG - Intergenic
1144714353 17:17423975-17423997 GACTGCACACTCCATGGAGCTGG + Intergenic
1144893654 17:18511109-18511131 GGTTGGAAACTCTGTAGAGCAGG - Intergenic
1144894865 17:18523087-18523109 GGTTGGAAACTCTGTAGAGCAGG + Intergenic
1145137359 17:20421147-20421169 GGTTGGAAACTCTGTAGAGCAGG - Intergenic
1145138569 17:20433165-20433187 GGTTGGAAACTCTGTAGAGCAGG + Intergenic
1145208839 17:20998376-20998398 GGCTGCCCACACTGTGGAGAGGG + Intergenic
1145312473 17:21708131-21708153 GGCTGCGAGCTCTGTGGGGCAGG + Intergenic
1146086789 17:29837827-29837849 GGCTGCGCACTCCATGGAGCTGG + Intronic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146878139 17:36429073-36429095 GCCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1146912095 17:36655414-36655436 GCCTGCTCACTCAGGGGAGCTGG + Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147628601 17:41915806-41915828 GGCTGCACTCTCTTTGGAAGGGG - Intronic
1147692044 17:42322056-42322078 TCATGCACTCTCTGTGGAGCAGG + Intronic
1149085299 17:52709658-52709680 GGCTGCACACTACATGGAGCGGG + Intergenic
1149160588 17:53687540-53687562 GGCTGCACACTCCATGGAGCTGG - Intergenic
1149330701 17:55577960-55577982 GGCTGCACACTCCGTGGAGCTGG - Intergenic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1149870574 17:60177078-60177100 GGTTGGAAACTCTGTAGAGCAGG - Intergenic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1151497171 17:74465983-74466005 GTCTGCACTCTGTGTGGATCAGG + Intergenic
1151895064 17:76974644-76974666 GGCTGTACACTCTACAGAGCAGG + Intergenic
1152722507 17:81929859-81929881 GGCTGCACCTTCTGTGGGACTGG + Intergenic
1153975009 18:10261520-10261542 CACTGTAAACTCTGTGGAGCAGG - Intergenic
1154175590 18:12085988-12086010 GGCTGCACTCCTTGTTGAGCAGG - Intergenic
1155120861 18:22817001-22817023 GGCTGCACACTCCATGGAGCGGG - Intronic
1155425725 18:25704906-25704928 TTTTGCACATTCTGTGGAGCTGG - Intergenic
1155830975 18:30514264-30514286 GGCTGCACACTCCATGGAGCAGG - Intergenic
1156298984 18:35818473-35818495 GGCTGCACGCTCCGTGGAGCTGG - Intergenic
1158045133 18:53146381-53146403 GGCTGCATCCTCTATGGAGCAGG + Intronic
1158632879 18:59131773-59131795 GGCTGCACACCCCATGGAGCTGG + Intergenic
1159186557 18:64983540-64983562 GGCTGCACCCTCCATGAAGCTGG + Intergenic
1160474265 18:79168060-79168082 GGCTGCATGCTCCATGGAGCTGG - Intronic
1160751675 19:737321-737343 AGCTGCCCACACTGTTGAGCAGG - Intronic
1161055011 19:2186561-2186583 GGCTTGACTCTCTGTGGAGAGGG - Intronic
1163145443 19:15376798-15376820 GGCTCCACAGTCTCTGTAGCAGG - Intronic
1165027105 19:32969949-32969971 GGCTGCACACTTCATGGAGCCGG - Intronic
1166179291 19:41095666-41095688 GGCTGCACTCTCTAGGGAGGAGG - Intronic
1166322083 19:42024785-42024807 GCCTGTCCACTCTGTAGAGCTGG + Intronic
1166519752 19:43472557-43472579 GGCTGCCCACGTTGTGGGGCAGG - Intergenic
1167013016 19:46821513-46821535 GGCTACACACTCCATGGAGCCGG + Intergenic
1167013062 19:46821708-46821730 TCTTGCTCACTCTGTGGAGCTGG - Intergenic
1167234918 19:48308628-48308650 GGCTGCACACTCCATGGAGCCGG + Intronic
926267883 2:11343693-11343715 GCCTGCCCACTCTGGGGAGGTGG - Intronic
926859428 2:17292417-17292439 GGCTGCACACTCCATGGAGCTGG - Intergenic
927596727 2:24403367-24403389 GGCACCAAACGCTGTGGAGCAGG - Intergenic
928088519 2:28360250-28360272 GGTGGCACCTTCTGTGGAGCGGG + Intergenic
930800429 2:55437980-55438002 GACTGCACATTCCATGGAGCTGG + Intergenic
931890046 2:66661753-66661775 GGCTGCACTCTCACTGTAGCAGG + Intergenic
932113445 2:69022793-69022815 GGCAGCACACACCTTGGAGCTGG + Intronic
932414079 2:71563439-71563461 AGCTGCACACTCTGGAGAGCAGG - Intronic
932501742 2:72188174-72188196 GGCTGCAGACTCCATGGAGCTGG - Intronic
933420720 2:82042724-82042746 GGCTGTGCACTCCCTGGAGCTGG + Intergenic
935667430 2:105525101-105525123 GGCTGCATGCTCTGGGGAGTTGG + Intergenic
936111768 2:109670879-109670901 GGCTGCACTCCTTGGGGAGCAGG - Intergenic
938169866 2:129065686-129065708 GGCTGCCCACTCTGTGGCCTGGG - Intergenic
938195072 2:129319553-129319575 GTCAGCACACTCCATGGAGCTGG - Intergenic
938210911 2:129465078-129465100 GACTGCTCACTCTGTGGATGTGG + Intergenic
938234981 2:129698751-129698773 AGCTGCCCCTTCTGTGGAGCTGG - Intergenic
938287126 2:130128085-130128107 GGCTGCACTCCTTGGGGAGCAGG + Intronic
938428467 2:131210785-131210807 GGCTGCACTCCTTGGGGAGCAGG - Intronic
938469369 2:131544803-131544825 GGCTGCACTCCTTGGGGAGCAGG - Intergenic
938722196 2:134076715-134076737 GGCTGCATGCTCCATGGAGCCGG - Intergenic
939059691 2:137405757-137405779 GGCTTCACAGTTCGTGGAGCAGG - Exonic
940423908 2:153509346-153509368 GTCTGCGCACTCCGTGGAACTGG - Intergenic
941151288 2:161918827-161918849 AGCTGCATGCTCTGTGGAGCAGG + Intronic
943526158 2:189020385-189020407 GGCTGCACACTCCATGGAGCTGG + Intergenic
943526179 2:189020488-189020510 GGTCTCCCACTCTGTGGAGCAGG + Intergenic
943961062 2:194264646-194264668 GGCTACACACTCCATGGAGCAGG + Intergenic
944483693 2:200181957-200181979 GACTGCACGCTCAGTGGAGCTGG + Intergenic
944586456 2:201177983-201178005 GGGTGCACACTCCACGGAGCTGG + Intergenic
945330246 2:208530490-208530512 GGCTGCACACTCTGTGGAGCCGG - Intronic
945770528 2:214035888-214035910 GGCTGTGCACTCCATGGAGCTGG - Intronic
946074295 2:217061326-217061348 GTCTTCCAACTCTGTGGAGCTGG + Intergenic
947707733 2:232290197-232290219 GGCTGCACTCTCTCTCCAGCTGG + Intronic
947751454 2:232534924-232534946 GGCTGATCACTCTGTTGAGGAGG - Intronic
948316232 2:237030460-237030482 GGCTGACCCCTCAGTGGAGCAGG + Intergenic
1168845062 20:938841-938863 GGCTGCACAGCCTTTGTAGCAGG - Intergenic
1168983537 20:2027435-2027457 GGCTGCACACTCCATGGAGCTGG - Intergenic
1170407094 20:16049929-16049951 AGCAGCACACGCTGTGGAGGAGG + Exonic
1172439013 20:34952336-34952358 GGCTGAACATTCTGGGGAGCTGG + Intronic
1172676537 20:36676841-36676863 GGCTGCACACGCCATGGAGCTGG + Intronic
1172852294 20:37975334-37975356 AGCTGCACACTCTGTCGAAGAGG - Intergenic
1173524620 20:43722043-43722065 AGCTGCACACTCCATGGATCTGG - Intergenic
1174668648 20:52284731-52284753 GGCTGCACAGTCTCTGGACCTGG + Intergenic
1175064292 20:56272311-56272333 TGCTGCACACTCCATGAAGCTGG + Intergenic
1175782688 20:61693531-61693553 GGCAGCAGGCACTGTGGAGCAGG - Intronic
1176085232 20:63292834-63292856 GGCTGCCCACTGTGGGGAGCAGG - Intergenic
1176104459 20:63379389-63379411 GGCTGTGCGCTCTGTGGAGCTGG + Intergenic
1177511337 21:22091652-22091674 GGCCACAGACTCTGTGGACCAGG - Intergenic
1177736101 21:25092477-25092499 GGCTGCACACTCCATGGAGATGG - Intergenic
1178486014 21:33020590-33020612 GGCTGCACACGTTGAAGAGCTGG - Intergenic
1178632158 21:34271401-34271423 GGCTGCACACTCTCCTGAGAAGG - Intergenic
1178817487 21:35945020-35945042 GGCTGCACTCTCTGTTGGGGAGG - Intronic
1179000412 21:37452474-37452496 GTCTGCACAGGCTGGGGAGCAGG - Intronic
1179407251 21:41136344-41136366 GGTTGCACACTCTGCAGGGCTGG + Intergenic
1179657416 21:42853815-42853837 GGCTGCACCGTCTGGGGTGCTGG - Intronic
1180216468 21:46326500-46326522 GACAGCGCACTCTGTGGAGGAGG + Exonic
1180228331 21:46411725-46411747 GGCGGCCCACTCTGCCGAGCTGG + Exonic
1181463926 22:23100708-23100730 CTCTGCAGACTTTGTGGAGCGGG + Intronic
1183254574 22:36754102-36754124 GGGTGGACACACTGTGGGGCCGG - Intergenic
1183451350 22:37897181-37897203 GTCTGCAGAGGCTGTGGAGCTGG + Intergenic
1183573078 22:38668879-38668901 AGCTGGGCATTCTGTGGAGCAGG + Intronic
1184665594 22:45987315-45987337 GGCCGCATACTCCATGGAGCAGG + Intergenic
1184718644 22:46296422-46296444 AGCTGCACAGCCTGTGGGGCTGG - Intergenic
949870384 3:8583062-8583084 GGATGTAAACTCCGTGGAGCAGG + Intergenic
950968855 3:17166597-17166619 GGCTGTGCACTCTGTGCTGCAGG - Intronic
951509029 3:23480514-23480536 GGCTGCACCCTCCATGGAACCGG - Intronic
951509777 3:23487447-23487469 GGCTGCATGCTCTGTGAAGCTGG - Intronic
952269552 3:31817783-31817805 GGCTGCACACTCCATGGAGCTGG - Intronic
953610428 3:44443173-44443195 GGCAGAACACTCTGGGGGGCTGG + Exonic
954595199 3:51818648-51818670 GACTCCAAACTGTGTGGAGCAGG + Intronic
954775157 3:53010434-53010456 GACTGAACCCTCTGTGGGGCTGG + Intronic
955241625 3:57183117-57183139 TGCTGCACACTCCATGGAGCCGG - Intergenic
955446624 3:59017917-59017939 GGCTGCACTCTGTTTGTAGCTGG - Intronic
956990136 3:74752471-74752493 GGCTACACATTCTGTGGAGTCGG - Intergenic
960634413 3:119768818-119768840 GGCTGCACCCTCCATGGAGCTGG - Intergenic
960690441 3:120341714-120341736 GGCTGCACATTCCATGGAGCTGG + Intronic
961493460 3:127273919-127273941 GGATGCACACTCCATGGAGCCGG + Intergenic
961629451 3:128285366-128285388 GGGTGCTCACACTGTGGGGCTGG + Intronic
962105419 3:132383727-132383749 GGCTGCATGCTCCATGGAGCCGG - Intergenic
962786093 3:138769138-138769160 GGCTGCATGCTCTGTGGAGCTGG - Intronic
962824689 3:139089260-139089282 GGCTGCACACTCCATGGAGCTGG - Intronic
963346155 3:144098823-144098845 GGCTGCTGGCTCTATGGAGCTGG + Intergenic
964032302 3:152152495-152152517 GGCCGCGCACTCTGAGCAGCCGG + Intergenic
964075337 3:152685187-152685209 GGCTGTGCTCTCTATGGAGCTGG - Intergenic
965118748 3:164522693-164522715 GGCAGCACACTCCTTGAAGCCGG - Intergenic
965118898 3:164524478-164524500 GGCTGCACATTTACTGGAGCTGG - Intergenic
965168411 3:165227363-165227385 TGCTGCCCACTCAGGGGAGCAGG - Intergenic
965205314 3:165713729-165713751 GGTTGCACACTCCATGGAGCCGG - Intergenic
965272401 3:166635635-166635657 GGCTGCAAAATATTTGGAGCAGG + Intergenic
965541941 3:169879828-169879850 GACTGCACAATCCATGGAGCTGG + Intergenic
965813538 3:172614873-172614895 GGCTGCACACTCCATGGAGCTGG - Intergenic
966491314 3:180531447-180531469 GGCTGCCCACTCCATGGAGCTGG + Intergenic
966875664 3:184320326-184320348 GGCTGCACACCCTGGGGCCCAGG - Intronic
967480405 3:189966243-189966265 GGCTGCCCACTCCCTGGTGCTGG + Intronic
967650013 3:191974081-191974103 AGCTGCACACTCCATGAAGCTGG - Intergenic
968980914 4:3848910-3848932 GGCTGCAGGCTGCGTGGAGCTGG - Intergenic
969972304 4:11060464-11060486 GGCTGTACACTCAGTGCAGTAGG - Intergenic
972203734 4:36747331-36747353 GGCCACACACTCCATGGAGCCGG + Intergenic
972931194 4:44072742-44072764 GGCTACACATTCTGTGGAGCTGG - Intergenic
974514879 4:62896850-62896872 TGCTGCACACTTTGTGGAGCTGG + Intergenic
978347774 4:107789119-107789141 GGCTGCATGCTCTGCAGAGCTGG - Intergenic
978663546 4:111155145-111155167 GGCTGCGCACTCCATGGAGCTGG - Intergenic
978964697 4:114726073-114726095 GGCTGCACACTCCATGGAGCTGG - Intergenic
980174965 4:129333430-129333452 GCCTGGATACTCTGTGGAGAGGG + Intergenic
980740629 4:136946326-136946348 GGCTGCACACTCCACGGAGCTGG + Intergenic
980877942 4:138680762-138680784 GGCTGATCATTTTGTGGAGCTGG - Intergenic
981580090 4:146242356-146242378 GGCTGCCCAAGCTGTGAAGCTGG + Intergenic
982158173 4:152541028-152541050 GCCTGCACACTCCATGCAGCAGG - Intergenic
982773687 4:159420980-159421002 GGCTGCGCACTCGGCGCAGCTGG + Intergenic
983914937 4:173281836-173281858 GGCTCCACATTCTGTGGAGGAGG - Intronic
984375215 4:178921746-178921768 GGCTGCATGCTCCGTGGAGTTGG + Intergenic
985114004 4:186573402-186573424 GGGGTCTCACTCTGTGGAGCAGG - Intergenic
985780344 5:1867591-1867613 GGCTGCAGACTTTGTTGACCAGG - Intergenic
985916023 5:2919792-2919814 GGCTGCATACTCTGTGGAGCTGG + Intergenic
986449312 5:7850294-7850316 GGCTGGACAGCCTGTGGAGGGGG - Intronic
988073857 5:26326567-26326589 GGCTGCATGCTCCATGGAGCGGG - Intergenic
992029794 5:72709515-72709537 GGCTGTACACTCCATGGAGCTGG - Intergenic
993254556 5:85572641-85572663 TGATGCTGACTCTGTGGAGCTGG + Intergenic
994245532 5:97471703-97471725 GGCTGCATGCTCCATGGAGCTGG - Intergenic
994660060 5:102642260-102642282 GGCTCCACAGTCTGTGGAAAGGG + Intergenic
996681962 5:126237667-126237689 GGGAACAAACTCTGTGGAGCAGG - Intergenic
998792168 5:145777617-145777639 GGCTGCACACTCCATGAAGCTGG + Intronic
999217598 5:149948280-149948302 AGCTGCACACTCTTTGGACCTGG - Intergenic
1002761019 6:202357-202379 GGCTGCACACTTTGTTTACCTGG + Intergenic
1002897936 6:1389977-1389999 GGCTGCACGCGCGGCGGAGCGGG - Exonic
1003002239 6:2347048-2347070 GTCTGCACACTCTGTTGTCCTGG + Intergenic
1003192481 6:3886806-3886828 GGCCGAACACTCAGTGGTGCTGG - Intergenic
1003242047 6:4353516-4353538 AACTGCAAACACTGTGGAGCAGG - Intergenic
1003339660 6:5207407-5207429 TGTTGCACCCTCTGTGGTGCAGG - Intronic
1004128154 6:12893906-12893928 AGCTGCACTCTCTGCTGAGCAGG + Intronic
1004520667 6:16358613-16358635 TGCTGCATACTCCATGGAGCTGG + Intronic
1004696891 6:18042557-18042579 GGCAGCACACTCCATGGAGCTGG + Intergenic
1005021622 6:21423887-21423909 GGCTGCACACTCCATGGAGCCGG - Intergenic
1006500747 6:34457572-34457594 GGCTGCACACTCCATGGAGCTGG + Intergenic
1006867794 6:37222833-37222855 GGTTACACACTCCATGGAGCCGG - Intronic
1006979534 6:38135886-38135908 GGCTCCCTTCTCTGTGGAGCAGG + Intronic
1009241821 6:61193984-61194006 GGCTACATGTTCTGTGGAGCTGG - Intergenic
1009582887 6:65558547-65558569 GGATGTGCAATCTGTGGAGCTGG - Intronic
1012052423 6:94361911-94361933 TGCTGCACACTCCACGGAGCAGG - Intergenic
1012718123 6:102702196-102702218 GACTACATGCTCTGTGGAGCTGG - Intergenic
1012749634 6:103140827-103140849 GGCTGCACACTCCACAGAGCTGG - Intergenic
1012789689 6:103677395-103677417 GGCCCCACACTCGGTGCAGCTGG - Intergenic
1014227280 6:118862308-118862330 GGCTGTACGCTCCATGGAGCTGG - Intronic
1014384592 6:120785606-120785628 GGTTGTGCCCTCTGTGGAGCAGG + Intergenic
1015455806 6:133424870-133424892 GGCTGCACACTCCATGGAGCGGG - Intronic
1015826976 6:137324241-137324263 GTCTGCAGCCTGTGTGGAGCAGG + Intergenic
1016915174 6:149237950-149237972 GGGTGCACACACTGTGGGGCTGG - Intronic
1016957774 6:149643081-149643103 GGCAGCTCACTCTGTGGAGCTGG - Intronic
1017562095 6:155639132-155639154 GGCTGGACACTCTGGGATGCTGG + Intergenic
1017993830 6:159513619-159513641 GGCTGCACGCTCCATGGGGCTGG + Intergenic
1018660042 6:166077156-166077178 GGCTGCACACTCTGTAGAGCTGG - Intergenic
1018950863 6:168378031-168378053 GACGGCACACTCTGTGGAGAAGG - Intergenic
1019624949 7:2011284-2011306 GGCTGCACCCTCTGTGCACAGGG - Intronic
1019643989 7:2119434-2119456 GGGCGCACACTCTCTGTAGCTGG + Intronic
1020381703 7:7554932-7554954 GGCAGCACAGCCTGAGGAGCTGG + Intergenic
1021561568 7:21972718-21972740 GGCTGCATACTCCATGGAGCCGG - Intergenic
1023041133 7:36174110-36174132 GGCTGCACAGGCTGTGGCACTGG + Intronic
1023790629 7:43750343-43750365 GGCTGCACACTCCATAGAGCTGG - Intergenic
1024254642 7:47531739-47531761 GGCTGCACTCTCCATGGAGCCGG + Intronic
1024997672 7:55285905-55285927 TGATACACACTCTTTGGAGCTGG - Intergenic
1026392158 7:69912421-69912443 GGCTGTATGCTCTGAGGAGCCGG - Intronic
1027128239 7:75572622-75572644 GGCTGCACACTCCATGGAACAGG + Intronic
1028402069 7:90434431-90434453 GGTTGCGCACTCTGCAGAGCTGG - Intronic
1029084242 7:97998774-97998796 TGTTGCACACACTGTGAAGCAGG - Intergenic
1029205726 7:98868417-98868439 GGCTGCACATGCTGTGTTGCTGG - Intronic
1029901305 7:104043151-104043173 GGCTGCACATTATGTGCATCAGG + Intergenic
1030106593 7:105992510-105992532 GCTTGCACAATCTGTGGGGCTGG + Intronic
1030388985 7:108902194-108902216 GGCTACATACTCTGTGTAGGGGG - Intergenic
1032607718 7:133374879-133374901 CGCTGCACACTCTGTGGTCCTGG + Exonic
1034445371 7:151111311-151111333 TGCTCCACACCCTGCGGAGCTGG + Intronic
1035259610 7:157653105-157653127 GGCTGCACCGTCTGGGGGGCAGG - Intronic
1035434698 7:158850467-158850489 GGCTGCACACTGCGTGGAGCTGG - Intergenic
1037477873 8:19275489-19275511 GGCTGCACTGGCTCTGGAGCAGG + Intergenic
1039210264 8:35205080-35205102 GGCTGAACACTCCCAGGAGCTGG - Intergenic
1039921213 8:41895913-41895935 GGCTGCAGGCTCCGGGGAGCGGG - Intronic
1040520185 8:48169697-48169719 GGCTGCACCCACTGTGTAACTGG + Intergenic
1041357430 8:57014854-57014876 GGCTGCACACTCCGTGGAGCTGG - Intergenic
1041652365 8:60313523-60313545 GGCTGCTCTGTCTGTGGAGTAGG - Intergenic
1042395919 8:68292362-68292384 GGCTGGACACTCCATGGAGCCGG + Intergenic
1043087294 8:75850056-75850078 GGCTGCACACTCTGTGGCACAGG - Intergenic
1044259349 8:90098837-90098859 GGCTGCACGCACCATGGAGCCGG - Intergenic
1044525114 8:93242321-93242343 GGCTGCATGCTCCATGGAGCTGG - Intergenic
1044962200 8:97542478-97542500 GGCTGCACACTCCATGGAGCCGG + Intergenic
1045586156 8:103539602-103539624 GCCTGTATGCTCTGTGGAGCAGG - Intronic
1048548079 8:135405301-135405323 GGCTGCACACTCCATGGAGCTGG - Intergenic
1049601664 8:143510594-143510616 CGCTGCACACCCTGGGGAACAGG - Intronic
1049823849 8:144654605-144654627 GGCTGCACACTCCATGGAGCTGG + Intergenic
1050130360 9:2406337-2406359 GGCTGCACACTCCGTGGAGCTGG + Intergenic
1050947846 9:11549291-11549313 GGCTGCACGCTCCATGGAGCTGG + Intergenic
1052437017 9:28443354-28443376 GGCTGCACACTCTGTTGAGCTGG + Intronic
1052707376 9:32010340-32010362 GGCTGCACACTCCACAGAGCTGG + Intergenic
1052774994 9:32724214-32724236 GGCCCCAGACACTGTGGAGCAGG - Intergenic
1053077909 9:35150730-35150752 GGCTACACACTCCATGGAGCCGG + Intergenic
1053614043 9:39745102-39745124 GGCGGCGCACTTTGTGGAGCCGG - Intergenic
1053649864 9:40156571-40156593 GGTAGCACATTCTCTGGAGCTGG - Intergenic
1053755883 9:41307371-41307393 GGTAGCACATTCTCTGGAGCTGG + Intergenic
1054239473 9:62597291-62597313 GGCGGCGCACTTTGTGGAGCCGG + Intergenic
1054260968 9:62864622-62864644 GGCCGCGCGCTTTGTGGAGCCGG - Intergenic
1054330372 9:63748333-63748355 GGTAGCACATTCTCTGGAGCTGG - Intergenic
1054534717 9:66219632-66219654 GGTAGCACATTCTCTGGAGCTGG + Intergenic
1054553605 9:66631818-66631840 GGCGGCGCACTTTGTGGAGCCGG + Intergenic
1057468378 9:95337029-95337051 GGCTGCATGCTCCGTGGAGCTGG + Intergenic
1057548356 9:96034652-96034674 GGCTGCACACTCCATGAAGCTGG + Intergenic
1059104657 9:111501241-111501263 GGCTGCATCCTCTGTGGAGCTGG + Intergenic
1059401094 9:114071068-114071090 GGCTGCACACCCCATTGAGCTGG + Intronic
1059992895 9:119881984-119882006 GGCTGCGCCCTCTGTTCAGCTGG + Intergenic
1062255332 9:135618121-135618143 GGCTACACCCTCAGTGGTGCTGG - Intergenic
1062329004 9:136028591-136028613 GGCTGCACGCTCCATGGAGCTGG + Intronic
1062618702 9:137409709-137409731 CGCTGCACACTCTCTGTAACTGG + Intronic
1202797750 9_KI270719v1_random:141222-141244 GGTAGCACATTCTCTGGAGCTGG - Intergenic
1186203805 X:7180563-7180585 GTATGCTGACTCTGTGGAGCAGG - Intergenic
1187319686 X:18228213-18228235 GGCTGCAGACTCTGTTGAACTGG - Intergenic
1187871370 X:23767426-23767448 GGCTGCGTGCTCCGTGGAGCTGG - Intergenic
1188727908 X:33607532-33607554 GGCTGCATGCTCCATGGAGCTGG - Intergenic
1189083453 X:37997218-37997240 GGCTGCACACTTTGTGGAGCTGG + Intronic
1189360022 X:40343327-40343349 AGCTGTACACTCCATGGAGCCGG + Intergenic
1189416136 X:40815428-40815450 GGCTCCACACTTAGTGGAGCTGG + Intergenic
1190445033 X:50515303-50515325 GGCTGCACACTCCCTGGAGCTGG - Intergenic
1190621038 X:52287517-52287539 GGCTGTGCACTCCCTGGAGCTGG + Intergenic
1193580789 X:83260222-83260244 GACTGCACACTCGCTGCAGCAGG - Intergenic
1194380129 X:93181183-93181205 GGCTGCACACCCCATGAAGCTGG + Intergenic
1195454430 X:105051689-105051711 AGCTGCACACTCCATGCAGCCGG - Intronic
1195656975 X:107341093-107341115 TTCTGAAGACTCTGTGGAGCAGG - Intergenic
1195696704 X:107672933-107672955 GGCTGCAAGCTCAGTGGACCAGG - Intergenic
1196883846 X:120224176-120224198 GGCTGCACATTCCATGGAGCTGG - Intergenic
1197342084 X:125287035-125287057 GACTGCACACTCCATGGAGCTGG + Intergenic
1197796152 X:130300107-130300129 GGCTGCCCACTCCATGGAGCAGG - Intergenic
1197951950 X:131907825-131907847 TGCTGCACACTCCGTGGAGCCGG + Intergenic
1199103627 X:143837149-143837171 GACTGTACACTCCATGGAGCAGG + Intergenic
1199599313 X:149532527-149532549 GGCTGCACGCTGGGTGCAGCAGG - Intronic
1199651318 X:149947678-149947700 GGCTGCACGCTGGGTGCAGCAGG + Intergenic
1199689778 X:150299881-150299903 GGCTGCAGACTCTCTGTTGCAGG + Intergenic
1199861238 X:151801776-151801798 GGCTGCACACTGTGTGGAGCTGG - Intergenic
1200252666 X:154562004-154562026 GGGTGCTCCCTCTGTGGGGCTGG + Intronic
1200265101 X:154642412-154642434 GGGTGCTCCCTCTGTGGGGCTGG - Intergenic
1200972078 Y:9163586-9163608 GGCTCTTCACTCTGTGAAGCTGG + Intergenic
1201189642 Y:11436000-11436022 GGCTGCACTCCTTGGGGAGCAGG - Intergenic
1201576660 Y:15468441-15468463 GAATGCTGACTCTGTGGAGCAGG - Intergenic
1201983210 Y:19930438-19930460 GGCTGCATGCTCTGTGGAGCTGG + Intergenic
1202138946 Y:21700705-21700727 GGCTCTTCACTCTGTGAAGCTGG - Intergenic
1202340605 Y:23861071-23861093 AGCTGTACACTCTGTGAAACTGG + Intergenic
1202530161 Y:25809011-25809033 AGCTGTACACTCTGTGAAACTGG - Intergenic