ID: 945333004

View in Genome Browser
Species Human (GRCh38)
Location 2:208561117-208561139
Sequence ACAGTAGGTGGGAATCTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 250}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945332994_945333004 16 Left 945332994 2:208561078-208561100 CCTACACTCAAAGGGAGGGGATT 0: 4
1: 33
2: 142
3: 333
4: 761
Right 945333004 2:208561117-208561139 ACAGTAGGTGGGAATCTTGGGGG 0: 1
1: 0
2: 0
3: 25
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945333004 Original CRISPR ACAGTAGGTGGGAATCTTGG GGG Intronic