ID: 945333004

View in Genome Browser
Species Human (GRCh38)
Location 2:208561117-208561139
Sequence ACAGTAGGTGGGAATCTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 250}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945332994_945333004 16 Left 945332994 2:208561078-208561100 CCTACACTCAAAGGGAGGGGATT 0: 4
1: 33
2: 142
3: 333
4: 761
Right 945333004 2:208561117-208561139 ACAGTAGGTGGGAATCTTGGGGG 0: 1
1: 0
2: 0
3: 25
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945333004 Original CRISPR ACAGTAGGTGGGAATCTTGG GGG Intronic
901568277 1:10137281-10137303 ACAGTAGTTTTGAATGTTGGGGG + Intronic
901642053 1:10697602-10697624 AGTGTAGGTGGGCAACTTGGGGG - Intronic
901889970 1:12254671-12254693 ACATTAGCTGGGCATGTTGGTGG - Intronic
902165467 1:14567899-14567921 CCAGGAGGTGAGAATCTTAGGGG - Intergenic
902335350 1:15751304-15751326 CCAGGAGGTGGGGATCCTGGGGG + Intergenic
903178515 1:21594091-21594113 AGAGCAGGTGGGCAGCTTGGTGG - Intergenic
903389139 1:22952055-22952077 GGAGTAGGGGGAAATCTTGGGGG + Intergenic
903535305 1:24062865-24062887 AGGGAAGGTGGGAACCTTGGCGG - Intronic
903711831 1:25331715-25331737 AAATTAGCTGGGCATCTTGGCGG - Intronic
903776308 1:25796294-25796316 ACAGGACGTCGGAATCTTGCAGG - Intergenic
903965483 1:27086440-27086462 ACAAAAGGCAGGAATCTTGGAGG + Intergenic
904594250 1:31633081-31633103 ACAGTAGGTGGGTAGGTGGGTGG - Intronic
906651191 1:47514086-47514108 ACTGTGGGTGGGATTCTTGGGGG + Intergenic
907631594 1:56088830-56088852 AAAGTATGATGGAATCTTGGAGG - Intergenic
908079671 1:60562668-60562690 ACAGTAGGTGGAAAAGTTGGGGG + Intergenic
909723953 1:78811360-78811382 ACAAGAGGTGGAAATCTTGGGGG - Intergenic
909727519 1:78853312-78853334 ACTTTAGGTGGGGATCTTGGGGG + Intergenic
911823681 1:102451713-102451735 TCAGGAGGTGGGAATTTTAGAGG + Intergenic
913213079 1:116597845-116597867 AAAGTGGTTGGGAATCTTGATGG - Intronic
913602710 1:120437373-120437395 AAAGTAGATGGGCATCGTGGCGG + Intergenic
913603458 1:120443726-120443748 AAAGTAGATGGGCATCGTGGCGG + Intergenic
913640312 1:120806441-120806463 AAAGTAGATGGGCATCGTGGCGG + Intronic
914278165 1:146143897-146143919 AAAGTAGATGGGCATCGTGGCGG - Intronic
914627467 1:149476783-149476805 AAAGTAGATGGGCATCGTGGCGG + Intergenic
915141531 1:153771350-153771372 AGAGGAAGTGGGAAGCTTGGAGG + Intronic
918266831 1:182850443-182850465 ATATTAGGTGGGAATGGTGGTGG + Intronic
920149487 1:203893041-203893063 ACAGTGGGTAGGAACCTGGGTGG + Intergenic
921282789 1:213583992-213584014 ACAGCACGTGGGAATTATGGGGG - Intergenic
922272065 1:224043584-224043606 AGGGGAGGTGGGAATGTTGGAGG - Intergenic
923130003 1:231066793-231066815 ACAGAAGCTGGGACTCTTGATGG + Intergenic
924240793 1:242038412-242038434 AAATTAGCTGGGCATCTTGGCGG - Intergenic
924333508 1:242964364-242964386 ACATTAGCTGGGCATGTTGGTGG - Intergenic
924847791 1:247790374-247790396 ACAGGAGGTGGGAATCTAAAAGG + Intergenic
1063894581 10:10666532-10666554 TCCTTAGGTGAGAATCTTGGCGG - Intergenic
1066556036 10:36614125-36614147 TCAGTGGGTTGGAATTTTGGGGG + Intergenic
1069043695 10:63721031-63721053 ACAGTAGGTGGGGATCCTTGGGG + Intergenic
1069317350 10:67122850-67122872 ACATTAGGTAGGAATATTGATGG - Intronic
1070392255 10:75981700-75981722 ACATTAGCTGGGAATGGTGGTGG + Intronic
1070554052 10:77514543-77514565 TCAGTAGTTGGGAAGCCTGGGGG - Intronic
1070690511 10:78521545-78521567 ATAGTAGGTTGGCATTTTGGGGG - Intergenic
1072356283 10:94614796-94614818 AAAGGAGGTGGGAATCACGGAGG + Intergenic
1073543096 10:104328174-104328196 ACCGGAGATGGGAATCCTGGAGG - Intronic
1073634261 10:105181314-105181336 GCAGTAGGTGCAAATCATGGGGG + Intronic
1074739036 10:116466318-116466340 ACAGTAGCTGGGATTGCTGGAGG + Intronic
1074895384 10:117773060-117773082 ACTGGAGGTGGGAAATTTGGGGG - Intergenic
1075538277 10:123289769-123289791 CCAGGGGGTGGGAATCTTAGAGG + Intergenic
1075772616 10:124952758-124952780 AAATTAGCTGGGAATGTTGGCGG - Intronic
1076216556 10:128698201-128698223 TCAGCAGGTGGGAGACTTGGTGG - Intergenic
1076264432 10:129098736-129098758 CCCAAAGGTGGGAATCTTGGGGG + Intergenic
1076827603 10:132977123-132977145 TTAGTAGGTGGGCACCTTGGGGG + Intergenic
1077418414 11:2436626-2436648 ACTGGGGGTGGGAAGCTTGGCGG + Intergenic
1078390847 11:10934190-10934212 ATAGTAGGTGGGCAGCTTTGTGG + Intergenic
1079986211 11:27203189-27203211 CCAGCAGGTGGGGATCATGGGGG - Intergenic
1081859145 11:46322379-46322401 CCAGTGGATGGGAATCTTAGAGG - Intergenic
1084108883 11:67000160-67000182 TGAGTAGGTGGGACTCTAGGCGG - Intergenic
1084662912 11:70557664-70557686 CCAGACTGTGGGAATCTTGGAGG - Intronic
1084686055 11:70696077-70696099 AGAGTTGGTGGGGATCTTGGAGG + Intronic
1084759889 11:71263670-71263692 GCAGCAGGAGGGAATTTTGGGGG + Intergenic
1088368777 11:109066378-109066400 AAGGAAGGTGGGAATCTGGGTGG + Intergenic
1090687485 11:129139926-129139948 CCATGGGGTGGGAATCTTGGGGG - Intronic
1090836397 11:130457361-130457383 GCAGCTGGTGGGAATCGTGGTGG + Intronic
1091813213 12:3416936-3416958 ACAGTATGTGAGATTTTTGGTGG + Intronic
1091939932 12:4470091-4470113 ACAGTGAAAGGGAATCTTGGTGG + Intergenic
1094199079 12:27779570-27779592 ACAGTTGGTGGCAATGTTGGTGG - Intergenic
1094751813 12:33418267-33418289 AAAGTAGGAGGGAAGCTGGGAGG - Intronic
1095628379 12:44344625-44344647 ATACTATTTGGGAATCTTGGTGG + Intronic
1095694710 12:45131593-45131615 TCAGTAGGTGGGACTCTGGCTGG + Intergenic
1096101984 12:48975118-48975140 AAATTAGGTGGGAGTGTTGGTGG + Intergenic
1096222041 12:49836376-49836398 AAAGGAGGTGGACATCTTGGGGG + Exonic
1096916444 12:55038625-55038647 GCAGTAGGTGGGAATTTCTGAGG + Intergenic
1097632448 12:62080392-62080414 ACAGGGGGTGAAAATCTTGGGGG + Intronic
1098908883 12:76189167-76189189 ACAGGAAGTGTGAATTTTGGGGG - Intergenic
1103240468 12:119409101-119409123 CCAGGAGGTGGGTATCATGGGGG + Intronic
1104020783 12:124990713-124990735 AAATTAGATGGGCATCTTGGTGG - Intergenic
1105825234 13:24116440-24116462 GCAGCAGGTGGGGATCGTGGGGG + Intronic
1106679004 13:31990531-31990553 ACATTAGCTGGGAATGGTGGTGG + Intergenic
1108284187 13:48889883-48889905 TTAGGAGGTGGGAATCTTGGAGG - Intergenic
1109056162 13:57551967-57551989 CCAGGAGGTGGAAATCATGGGGG - Intergenic
1110076574 13:71252774-71252796 ACAGAAGGTGGGAATATTTACGG - Intergenic
1110462142 13:75756967-75756989 CCAGGAGGTGAGAATCATGGAGG - Intronic
1112228014 13:97559500-97559522 ACTGTACGTGGGATTCTTGTTGG - Intergenic
1112917454 13:104569209-104569231 AAAGGAGGAGGCAATCTTGGAGG - Intergenic
1114202551 14:20536136-20536158 ACAGTGGGTGGTAATGGTGGTGG - Intergenic
1114251673 14:20967137-20967159 ACATTGGCTGGGAATGTTGGGGG + Intergenic
1114891548 14:26930435-26930457 AAAGTAGGTGGGAATTTGGAAGG - Intergenic
1115849790 14:37582213-37582235 AAAATAGGTTTGAATCTTGGTGG - Intergenic
1115859792 14:37671393-37671415 TCAGGAGGTGGGAATCATTGGGG + Intronic
1116644566 14:47510088-47510110 ACAGGAGGTGGGACTTTGGGAGG + Intronic
1118144712 14:63123122-63123144 GCAGTAGTTGGCACTCTTGGAGG - Intergenic
1118634780 14:67737610-67737632 ACCATAGGAGGGAATCTGGGTGG + Intronic
1119227970 14:72958643-72958665 TCAGTAGGCGGGCATCGTGGAGG - Exonic
1119777990 14:77260057-77260079 GCAGAAGATGGGAATCTTGTGGG + Intergenic
1120026311 14:79588803-79588825 ACAGTAGGTGTAAATATTTGTGG + Intronic
1122852412 14:104543782-104543804 ACAGTAGTTTGGGCTCTTGGAGG - Intronic
1122976596 14:105173400-105173422 ACACCAGGTGGGAATCCGGGTGG - Intronic
1125041754 15:35195844-35195866 CCAGTAGGTGGGGATCTCTGTGG - Intergenic
1126684989 15:51240768-51240790 ACAGAAAGTGGGAATGTAGGGGG - Intronic
1127236282 15:57056288-57056310 AAAGTAGCTGGGAATGGTGGTGG - Intronic
1127300658 15:57650470-57650492 ACAGAAGCTGGGAAACTTAGTGG + Intronic
1128623386 15:69172981-69173003 ATACAAGATGGGAATCTTGGAGG + Intronic
1128870819 15:71154106-71154128 ACAGAAGGTGAGAATGTTTGAGG + Intronic
1130656855 15:85797706-85797728 ACAGTAGGAAGGAATAATGGCGG + Intergenic
1131379930 15:91955108-91955130 ACTGAAGGTGGGAATGTTTGTGG - Intronic
1131721311 15:95171760-95171782 AAAGTACTTGGGAATCTTGCTGG - Intergenic
1132871062 16:2115976-2115998 ACAGCAGGTGGGACTCTGGGTGG - Exonic
1137791718 16:51180608-51180630 ACAGAAGAGGAGAATCTTGGGGG - Intergenic
1138311579 16:56028183-56028205 ACAGTAGGTAGATATTTTGGAGG - Intergenic
1139036656 16:62955636-62955658 CCAGGGAGTGGGAATCTTGGGGG - Intergenic
1139205217 16:65022549-65022571 ACAGAAGGTGGGAATTTTCAGGG - Intronic
1139833870 16:69822679-69822701 ACAGCATGTGGGAAGCTTTGAGG + Intronic
1140710100 16:77669822-77669844 GCAGTATGGGGGAATTTTGGTGG - Intergenic
1140723839 16:77794351-77794373 ACAGTATGTGGGATGCTTTGGGG + Intronic
1141761432 16:86031205-86031227 ACAGTAGGTGGGCATCACAGAGG - Intergenic
1142694697 17:1627448-1627470 ACAGCAGGTGGGGTTCTGGGTGG + Intronic
1142813394 17:2407153-2407175 ACAGTGGGTCAGAAGCTTGGTGG + Intronic
1143399842 17:6637087-6637109 ACAGGAGGTGGGAATATTTTGGG - Intronic
1143436370 17:6930765-6930787 CCAGTAGGTTATAATCTTGGGGG + Intronic
1143911443 17:10253176-10253198 ACAGGAGGTGGGGATCCTTGAGG + Intergenic
1144142027 17:12358973-12358995 ATAGTAGGTGGAAGTCTCGGAGG + Intergenic
1149323818 17:55509361-55509383 AAAGTATGTTGGAATCTTGAAGG - Intergenic
1150239679 17:63621956-63621978 ACGGGAGGTGGGAATGTGGGCGG + Intergenic
1150375964 17:64681813-64681835 AAATTAGCTGGGAATGTTGGTGG + Intergenic
1150694089 17:67389312-67389334 CCAATCAGTGGGAATCTTGGGGG + Intronic
1151035134 17:70789927-70789949 ACAGGAGATGGGAAACTTGGGGG + Intergenic
1151466840 17:74291084-74291106 GGAGTACGTGGGAATCTTTGGGG - Exonic
1152984343 18:308171-308193 ACAACATGTGGGAATCATGGGGG - Intergenic
1155450031 18:25953672-25953694 ACAGTAAGTGGGTATCGTCGGGG + Intergenic
1157579807 18:48767068-48767090 AGAGAAGTTGGGAACCTTGGTGG - Intronic
1157998226 18:52585931-52585953 AAATTAGCTGGGAGTCTTGGCGG + Intronic
1160410132 18:78670121-78670143 GCAATAGGTTGAAATCTTGGGGG - Intergenic
1161614961 19:5264968-5264990 ACAGGACGTGGGAGCCTTGGAGG - Intronic
1163000796 19:14365524-14365546 TCAGGAGGTGGGAATCATGGAGG - Intergenic
1164739459 19:30565688-30565710 ACAGAAGGTGGGGATGTGGGAGG - Intronic
1164966504 19:32489446-32489468 TCAGGCAGTGGGAATCTTGGGGG + Intergenic
1165178467 19:33947464-33947486 ACAGTGGGTGGGAATGTGGCTGG + Intergenic
1166641580 19:44498888-44498910 TCAGTAGGAGGGAGTCTAGGTGG - Intronic
1168071389 19:53954124-53954146 CCAGGCGGTGGGAATCTTGGAGG + Intergenic
1168503871 19:56916464-56916486 ACAGTATGTGGGAATGTTGATGG + Intergenic
925089686 2:1143721-1143743 ACATTAGCTGGGAATGGTGGCGG + Intronic
925464647 2:4096060-4096082 ATAGTTGGTGAGAATTTTGGGGG + Intergenic
927428399 2:23006167-23006189 ACAGGAGCTGGGGATCATGGAGG + Intergenic
927442506 2:23129148-23129170 CCAGCGGGTGGGAATCTTGGGGG + Intergenic
928094750 2:28397351-28397373 TCAGTTGGTGGGAATGTGGGAGG + Intronic
932503159 2:72202817-72202839 ACAGGAGGTGGGAAAGTTTGGGG - Intronic
932948736 2:76268332-76268354 ACAGGAGATGTGAATTTTGGTGG - Intergenic
935340648 2:102057058-102057080 ACTCTAGCTGGGATTCTTGGAGG + Intergenic
936265183 2:110999527-110999549 TCAGGAGGTGGGATTCTTGGGGG - Intronic
936992760 2:118383571-118383593 CCAGAAAGTGAGAATCTTGGGGG - Intergenic
937089246 2:119194886-119194908 ACAGCAAGGGGGAATTTTGGGGG + Intergenic
940693894 2:156955437-156955459 ACAGGAAGTGAAAATCTTGGTGG + Intergenic
941068952 2:160934369-160934391 ACAGTAGGTGGGAGCCTGTGAGG - Intergenic
941791755 2:169559542-169559564 TGAGTAGCTGGGAATCTAGGTGG + Intronic
944327564 2:198424811-198424833 ACACTAGGTGGGCATGGTGGTGG + Intronic
944661240 2:201923619-201923641 ACAGTAGGTGGGCAATTTGCTGG - Intergenic
945333004 2:208561117-208561139 ACAGTAGGTGGGAATCTTGGGGG + Intronic
945431280 2:209769041-209769063 ACAGGACATGGGAATCTTGGGGG + Intergenic
945519577 2:210807882-210807904 ATAATAGGTGAGAATTTTGGAGG + Intergenic
945756506 2:213853947-213853969 AAAGTAGTTGCTAATCTTGGGGG - Intronic
946100642 2:217317630-217317652 ACATTAGGTCGGCATCCTGGTGG + Intronic
947001833 2:225465564-225465586 AAAGTAGGTGGGCATGGTGGCGG + Intronic
1169185434 20:3612480-3612502 TCAAGAGGTGGAAATCTTGGGGG + Intronic
1169813375 20:9631180-9631202 CCAGGAGGTGGGAATCATTGAGG - Intronic
1170635742 20:18102627-18102649 ACAGTAGGTGAGAGTTTTTGGGG + Intergenic
1171464542 20:25318448-25318470 ACAGTTGCTGGGAATCCAGGGGG + Intronic
1172185594 20:33029196-33029218 AGAGTGGCTGGGAATCCTGGTGG - Intergenic
1173258823 20:41415182-41415204 ACTTCAGGCGGGAATCTTGGTGG - Exonic
1173528562 20:43751157-43751179 ACAGTTGGTGTCAATATTGGGGG + Intergenic
1173760937 20:45559946-45559968 TCAGAAGATGGGAATCTTGAGGG - Intronic
1175078458 20:56396158-56396180 GCAGTAGGTGGGAAGTGTGGAGG - Intronic
1175316451 20:58051521-58051543 ACAGTAGGTGTGAATGTGTGTGG - Intergenic
1177000524 21:15606771-15606793 ACAGCAGGTGAGGATCTTAGAGG + Intergenic
1177296464 21:19182656-19182678 AGTGGAGCTGGGAATCTTGGAGG - Intergenic
1178229835 21:30769255-30769277 CCAGTAGGTAGGAATCATGAGGG - Intergenic
1178535018 21:33403721-33403743 AGAGTGGGTGGGAATCTGCGGGG + Intronic
1181432385 22:22889186-22889208 AGGGTAGGTGGGGATCCTGGAGG + Intronic
1182498665 22:30729486-30729508 ACATTAGCTGGGCATATTGGTGG + Intronic
1184248646 22:43248242-43248264 ACAGTGGGAGGGAAGCTGGGGGG + Intronic
949857375 3:8474244-8474266 ACAATAGGTGGGAATATGAGGGG - Intergenic
951914392 3:27784448-27784470 GTAGTAGGTAGGAATTTTGGAGG - Intergenic
954150512 3:48654909-48654931 AGAGGAGAGGGGAATCTTGGTGG + Intronic
954733043 3:52681585-52681607 ACATAAGGAGGGAATCTTTGTGG + Intronic
955232362 3:57110374-57110396 AGAGAAGATGGTAATCTTGGAGG - Intronic
956156557 3:66304284-66304306 TCAGGGAGTGGGAATCTTGGGGG + Intronic
956816287 3:72911371-72911393 ACAGAAGGTGGGACCATTGGGGG - Intronic
957322767 3:78653518-78653540 CCAGCAGGTGGGAATCCAGGTGG - Intronic
959987253 3:112588137-112588159 ACTGTTGGTGGGAATGTTGGTGG + Intergenic
960705029 3:120473495-120473517 AGAGAAGCTGGGAATATTGGAGG + Intergenic
961741091 3:129033534-129033556 ACAGTAGGTGGGAACGCCGGTGG + Intronic
962781291 3:138720300-138720322 ACAGTAAGTTGGAATCAGGGTGG - Intronic
962949572 3:140205496-140205518 ACAAAAGGTGGGAATATGGGAGG + Intronic
963821573 3:149901031-149901053 ACTGTATGAGGGAATTTTGGTGG + Intronic
967331694 3:188296492-188296514 ACAGTAGGTGATAATTTAGGAGG + Intronic
968451248 4:677041-677063 ACAGCAGGTGGGATCCCTGGGGG - Intronic
968812176 4:2805065-2805087 ACAGTGGGTGTGAAGGTTGGGGG - Intronic
968901562 4:3434522-3434544 ACAGAAGGTGAGCATTTTGGAGG - Intronic
970162279 4:13200996-13201018 CCAGGAGGTGGGAATCATTGGGG - Intergenic
970507176 4:16743376-16743398 ACCAGGGGTGGGAATCTTGGAGG - Intronic
970812879 4:20116302-20116324 AAATAAGGTGAGAATCTTGGGGG + Intergenic
974896870 4:67950599-67950621 ACCGGAGGGGGGAATCTTGGGGG + Intronic
975264342 4:72344006-72344028 ACAGTAATTGGGAAACTAGGGGG - Intronic
975954627 4:79822676-79822698 TCAGAAAGTGGAAATCTTGGAGG + Intergenic
978506414 4:109462713-109462735 ACAGGAGGTGGGGATCATTGGGG + Intronic
978941298 4:114438803-114438825 TCAGTAGGTAGGAATATTGAAGG + Intergenic
981103644 4:140856863-140856885 AAAGAAGGTGGGAATGTTAGAGG + Intergenic
981613655 4:146623328-146623350 TCAGAAGGTGGGAATCCTGCTGG - Intergenic
982660540 4:158201425-158201447 CCAGGAGGTGGGGATCATGGGGG - Intergenic
984345714 4:178522168-178522190 CCAGAGGGTGGGAATCTTGAGGG - Intergenic
987897421 5:23965572-23965594 TCAGTAGGTATGAATCTTGAGGG - Intronic
988307339 5:29509569-29509591 CCAGAAGATGGGAATATTGGAGG - Intergenic
989323092 5:40159790-40159812 AAAGTAGGTGGGCATGGTGGTGG - Intergenic
991052113 5:62284392-62284414 ACAGGAGGTGAGAATCTTTGGGG - Intergenic
993384377 5:87246867-87246889 TCAGAGGCTGGGAATCTTGGAGG - Intergenic
996084487 5:119290644-119290666 TCAGGAGGTGGGAATCATTGGGG + Intronic
996584716 5:125072496-125072518 ACAGGAAGTGGGAATCATAGGGG + Intergenic
997150619 5:131490988-131491010 ACAGTAGTTGGGAAGATTGAAGG + Intronic
998707724 5:144782940-144782962 GCAGGAGGTGGGAATGTGGGCGG + Intergenic
999135791 5:149317919-149317941 GCAGGAGGTGGCCATCTTGGAGG + Exonic
1004891125 6:20101653-20101675 ACAGTAGCTGGAAATCATGCAGG + Intergenic
1005566646 6:27102292-27102314 ACAGGAGCTGGGTATCGTGGGGG + Intergenic
1005579500 6:27220292-27220314 ACATTAGCTGGGAATGGTGGTGG - Intergenic
1005786185 6:29248106-29248128 AAAGTAGGTGGGAGTGTTGGAGG + Intergenic
1006707371 6:36032456-36032478 ACAGAAGGGGAGAATCTTTGTGG + Intronic
1006715277 6:36114632-36114654 AAAGTAGCTTGGCATCTTGGAGG + Intergenic
1006952340 6:37833337-37833359 ACAGGAAGAGGGATTCTTGGGGG - Intronic
1008810028 6:55485203-55485225 ACAGAAGATGGGAAATTTGGAGG - Intronic
1011110477 6:83832627-83832649 ACAACAGGTGGGAATTATGGGGG - Intergenic
1011714237 6:90087759-90087781 ACAGTAGGTGTGTATATTTGTGG + Intronic
1014415523 6:121178585-121178607 CCAGGAGGTGGGGATCTTGGGGG - Intronic
1015971726 6:138749178-138749200 ACAGGAGGTGGACATCTTTGGGG + Intergenic
1018185583 6:161263150-161263172 AAGGTGGCTGGGAATCTTGGTGG - Intronic
1019765815 7:2849377-2849399 ACAGTCTGGGGGAATCATGGGGG - Intergenic
1020406464 7:7840862-7840884 ACAGTTGTTGTGAAGCTTGGAGG + Intronic
1021816152 7:24449430-24449452 CCAGAAGGTGGGGATCTTGGAGG - Intergenic
1021997413 7:26193679-26193701 ATAATAGGTGGCAATTTTGGAGG - Exonic
1022691549 7:32661122-32661144 ACAGTTGGTGGTAATATTGCAGG - Intergenic
1026200782 7:68212896-68212918 AAATTAGCTGGGAATGTTGGTGG - Intergenic
1028770169 7:94610322-94610344 ACATTAGGTGTTACTCTTGGCGG - Intronic
1031097725 7:117441316-117441338 ACAATATGTGGGAATTATGGGGG + Intergenic
1034212866 7:149380587-149380609 CCAGGGGGTAGGAATCTTGGTGG - Intergenic
1034334520 7:150312184-150312206 AGAGTAGGTGGGAGTCATAGAGG - Intronic
1035036292 7:155897403-155897425 CAAGTAGGTGGGAAGTTTGGGGG + Intergenic
1037481811 8:19313002-19313024 ACAGTTAGAGGAAATCTTGGAGG - Intergenic
1038456826 8:27677462-27677484 ACAGTGGTGGGGAATTTTGGAGG + Intergenic
1044799169 8:95935816-95935838 ACAGTATGTGGTAATCCTGGAGG - Intergenic
1046061437 8:109144653-109144675 GCAGGGGGTGGGACTCTTGGGGG - Intergenic
1047710031 8:127542462-127542484 CCAGTAGGTGGGAATCATTGGGG - Intergenic
1048220978 8:132541742-132541764 ACAATAGCATGGAATCTTGGGGG + Intergenic
1049486101 8:142863641-142863663 CCAGTAGGTGGGTCTCTTGTAGG + Intronic
1050140846 9:2514295-2514317 AGAGTAGGTGGGAATGATAGAGG - Intergenic
1050538559 9:6650626-6650648 ACAGTAGCTGGGCATGGTGGCGG - Intergenic
1052390634 9:27875272-27875294 GCAGTAGGTGGGAAAATTAGTGG + Intergenic
1053097017 9:35337533-35337555 ACAGTAAGAGGGAAGCATGGTGG - Intronic
1054962831 9:70988560-70988582 TCACTGGCTGGGAATCTTGGAGG - Intronic
1058180663 9:101794382-101794404 CCAGGAGATGGGAATCATGGGGG - Intergenic
1059733732 9:117081460-117081482 GCAGGGGGTGGGAATGTTGGAGG - Intronic
1059828464 9:118062206-118062228 ACAGTATGAGGAAATGTTGGGGG - Intergenic
1062269241 9:135701138-135701160 ACAGCTCGTGGGCATCTTGGGGG - Intergenic
1186149502 X:6659200-6659222 CTAGTGGGTGGGAATCTTAGAGG + Intergenic
1187373358 X:18728507-18728529 ACAACACGTGGGAATTTTGGGGG + Intronic
1188356523 X:29198443-29198465 ACATTAGGTGGGTGTCGTGGCGG - Intronic
1189385718 X:40535157-40535179 TCTGGGGGTGGGAATCTTGGGGG + Intergenic
1189788976 X:44585256-44585278 CCAGGAGGTGGAAATCATGGAGG - Intergenic
1189811470 X:44784787-44784809 AAATTAGCTGGGCATCTTGGTGG - Intergenic
1189885537 X:45540759-45540781 ACTGTAGGTGGAAATGTGGGTGG + Intergenic
1190640190 X:52476916-52476938 ACATTAGGTGGGCATGGTGGCGG + Intergenic
1190647482 X:52535949-52535971 ACATTAGGTGGGCATGGTGGCGG - Intergenic
1192859184 X:75047925-75047947 ACAGTGGATGGAGATCTTGGTGG - Intergenic
1195334914 X:103843107-103843129 ACATTATGTGGAAATTTTGGTGG - Intergenic
1195403248 X:104484348-104484370 ACAGTATATGGGAATCTTGTTGG + Intergenic
1196752586 X:119131207-119131229 CCAGGGGGTGGGAATCTTGTGGG - Intronic
1196829327 X:119763782-119763804 AAGGTAGTTGGGAATCATGGAGG + Intergenic
1198627822 X:138598781-138598803 AAAGTATATCGGAATCTTGGGGG - Intergenic
1198767560 X:140094418-140094440 AGAGCAGGTGGGGATCTGGGGGG + Intergenic
1198989807 X:142499146-142499168 CCAGGAGGTAGGAATCATGGGGG - Intergenic
1202391295 Y:24373037-24373059 ACATTAGCTGGGCATGTTGGTGG + Intergenic
1202479490 Y:25297080-25297102 ACATTAGCTGGGCATGTTGGTGG - Intergenic