ID: 945335113

View in Genome Browser
Species Human (GRCh38)
Location 2:208582967-208582989
Sequence TTGTCTTTGCATGAAGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945335111_945335113 12 Left 945335111 2:208582932-208582954 CCATATCTGTGAAATGTGTTTGT 0: 1
1: 0
2: 4
3: 70
4: 669
Right 945335113 2:208582967-208582989 TTGTCTTTGCATGAAGTGGCTGG 0: 1
1: 0
2: 0
3: 11
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945335113 Original CRISPR TTGTCTTTGCATGAAGTGGC TGG Intronic
900803408 1:4751672-4751694 TGCTCTTTGGATGCAGTGGCTGG - Intronic
901889342 1:12249051-12249073 TTGTGTTTGTATAAAGTGCCTGG + Intronic
903523688 1:23975638-23975660 TTGTCTTCCCATGCAGTGGAAGG - Intronic
906857938 1:49328741-49328763 TTCACTTTACATGAAGTGGAAGG - Intronic
907845340 1:58200698-58200720 TTGTTTTTGCTTTAAGTGGCAGG + Intronic
909604146 1:77491949-77491971 TTGTTTTTTCTTGAAGTGACAGG + Intronic
909800418 1:79800070-79800092 ATGTCTTTGTATTAAGTGTCTGG - Intergenic
915842441 1:159225452-159225474 TTGTCATTGCTTGAAGTGGGAGG + Intergenic
920284812 1:204871743-204871765 TTGGTTTAGCATGAAGTGACAGG - Intronic
1063736041 10:8756203-8756225 TTGTTTTTGTTTGAAGGGGCGGG - Intergenic
1065441701 10:25759386-25759408 TTGGCTTTGCACTAACTGGCTGG - Intergenic
1065482874 10:26212663-26212685 TTGTGTTTGTCTGAAGTGGCTGG - Intergenic
1066057332 10:31694483-31694505 TTATCTTTACAGGAAGAGGCAGG - Intergenic
1066343978 10:34564003-34564025 TTTTATTTGCATTAAGTGTCAGG - Intronic
1067531781 10:47079521-47079543 TTTTATTTGTATGAAATGGCTGG - Intergenic
1067958417 10:50819417-50819439 ATCTCTTTGCAAGAAGTTGCTGG - Intronic
1068471090 10:57464812-57464834 TTGGCTTTACTTGAAGTGACTGG - Intergenic
1074143786 10:110699062-110699084 TTGCCTGTGCATGACTTGGCTGG - Intronic
1074273477 10:111978445-111978467 TGCTCCTTGCATGCAGTGGCTGG - Intergenic
1081645719 11:44788878-44788900 TCTTCTCTCCATGAAGTGGCAGG - Intronic
1081659737 11:44880702-44880724 TCATCTGTGCATGAAGTGGTTGG + Intronic
1083763636 11:64832055-64832077 CTGTCTTTGCACGAAATTGCCGG - Intronic
1085874309 11:80387577-80387599 TTGTCTCTGCATTGAGTGGAAGG - Intergenic
1088017079 11:105073938-105073960 TTATCTTAGGAGGAAGTGGCAGG + Intronic
1088691850 11:112335071-112335093 TTGTCTTGGGGAGAAGTGGCAGG + Intergenic
1088745128 11:112798621-112798643 GTGCCCTTGCATGAAGTGGGGGG + Intergenic
1089202364 11:116732066-116732088 CAGTCTTTGCCTGAAGGGGCAGG + Intergenic
1089717362 11:120374140-120374162 ATGTCTTTCCATCTAGTGGCTGG + Intronic
1091874288 12:3920738-3920760 TTTTCTTTGGAAGAAGCGGCCGG + Intergenic
1092938452 12:13385828-13385850 CTTTCTTTGCATGCATTGGCAGG + Intronic
1094455660 12:30630075-30630097 TTTTCTTGGCAGCAAGTGGCAGG - Exonic
1096485107 12:51974929-51974951 GTGGCTCTGCATGAAGTGGGGGG + Intronic
1097292952 12:57934793-57934815 TTATTTTTGCAAGAATTGGCTGG + Intergenic
1099261254 12:80385606-80385628 TTTTCTTTGCATGAAGATGAAGG + Intergenic
1100295694 12:93258825-93258847 TTGTGTATGCATGAAGAGGAAGG - Intergenic
1101987978 12:109462204-109462226 TATTCTTTGCATGAATTGCCAGG + Intronic
1102913207 12:116734571-116734593 TTGGATTCCCATGAAGTGGCTGG + Intronic
1103893575 12:124257883-124257905 ATCTCTTTTCATTAAGTGGCAGG - Intronic
1104138556 12:125963783-125963805 TTCCCTTTGCATGAAGTATCTGG + Intergenic
1104808882 12:131608027-131608049 CTCACTTTGCATGCAGTGGCTGG + Intergenic
1105924697 13:24997262-24997284 TTGTCCTTGAAGGAAATGGCTGG + Intergenic
1106339779 13:28817735-28817757 CTTTCTTTGCATGAAGTGGGTGG - Intergenic
1108821567 13:54357239-54357261 TTTGCTTTGCATTAGGTGGCAGG + Intergenic
1111558571 13:89913265-89913287 TTGTCTTTGGTGGAAGTGGGGGG + Intergenic
1114283529 14:21217892-21217914 TTGTCTTCCCATGAAATGTCTGG - Intronic
1117543635 14:56772446-56772468 TTCCCCTTGCATGAAGTGGTTGG + Intergenic
1123874587 15:24610980-24611002 TTGTATTTGCATGACATGGGTGG - Intergenic
1127896075 15:63300014-63300036 TTATATGTGCATGAAATGGCAGG + Intronic
1128542899 15:68549401-68549423 TTGTCTTTTTATGGATTGGCTGG + Intergenic
1129936610 15:79456328-79456350 TTGTCTTTGAATAGCGTGGCTGG - Exonic
1132064983 15:98723497-98723519 TTATCTTTGCATTAAGTACCAGG - Intronic
1133535779 16:6701159-6701181 TTGTCTTGGGCTGAAATGGCTGG + Intronic
1133816406 16:9200677-9200699 TTCTCTTTGCATTAATTGGGAGG + Intergenic
1134408039 16:13979787-13979809 TTATTTTTGCATGAAGTAGATGG - Intergenic
1137394448 16:48106877-48106899 TTGTCTCTGCATGAACAGGATGG - Intronic
1138620396 16:58206551-58206573 CTGTCTCTGCATAAATTGGCTGG - Intergenic
1139279848 16:65761022-65761044 TTGTCTTTTCAAAAAGTGTCAGG + Intergenic
1139628826 16:68214476-68214498 TGGTATTTGCATGCAGTGGCTGG + Intronic
1144416027 17:15048109-15048131 TTGGCATTGCATGAAGTGGGTGG - Intergenic
1148999565 17:51743114-51743136 TAGATCTTGCATGAAGTGGCTGG + Intronic
1152053418 17:78000881-78000903 ATTGTTTTGCATGAAGTGGCTGG + Intergenic
1152385541 17:79972125-79972147 TTGTCCCTGCATGCAATGGCAGG + Intronic
1154997191 18:21652194-21652216 TTAACTTTACATGATGTGGCTGG + Intronic
1155503280 18:26507793-26507815 TTGTATTTACATGAAGTGACAGG + Intronic
1156180996 18:34604103-34604125 TTTTCTTTGAATGGAGTTGCTGG - Intronic
1156580863 18:38373456-38373478 TTGTCCTTACATTAAGTGGTAGG + Intergenic
1156856215 18:41784149-41784171 ATGTCTTTGAATGAACTGACAGG - Intergenic
1160452665 18:78976238-78976260 TTTTTTTTGCATTAAGTGGTTGG + Intergenic
1165984885 19:39759233-39759255 TTCTTTTTACATGAAGTGTCTGG - Intergenic
1167650443 19:50725643-50725665 GTGTCTTTCCTTGAAGGGGCGGG + Exonic
1168092024 19:54091992-54092014 TTGTCATTGCTTTAAGAGGCAGG + Intergenic
928646464 2:33357712-33357734 TTCAATTTGCATGAAGAGGCTGG - Intronic
931871955 2:66470276-66470298 TGGCCTTTGCATGCAGTGGCAGG + Intronic
931960106 2:67472997-67473019 GTGTCTTGGGATGAAGTGGGAGG - Intergenic
932772019 2:74505756-74505778 TTGTCTTTGCCAGAACTGGGGGG + Exonic
933030843 2:77326781-77326803 TTGTCTTTCCATTCATTGGCTGG - Intronic
933475851 2:82789896-82789918 TTGCCTTTTCATTAAGTAGCTGG + Intergenic
936052619 2:109236284-109236306 TTGTTTCTGCATGCAGTGTCGGG + Intronic
938708188 2:133952113-133952135 TTGTCCATACATGAAGTGTCAGG - Intergenic
939421401 2:141975387-141975409 TTGTCTTTCCATGAAGGAGGAGG - Intronic
939837179 2:147144853-147144875 TTTTCTTTGCATTAGATGGCAGG - Intergenic
941592660 2:167438993-167439015 TTGTCCTTGGATAAAGTGTCAGG - Intergenic
944197696 2:197072880-197072902 GAGATTTTGCATGAAGTGGCAGG - Intronic
945335113 2:208582967-208582989 TTGTCTTTGCATGAAGTGGCTGG + Intronic
947494680 2:230626220-230626242 TTGTCTCTGCATAGAGTGCCAGG - Intergenic
1169590793 20:7139884-7139906 TTGACTTTGCATGAAGAGATAGG + Intergenic
1170138413 20:13101250-13101272 CTGTGTTTGCATGAAGAAGCTGG + Intronic
1173710782 20:45153767-45153789 TTGTCTGTGCAGGAACTTGCTGG + Intergenic
1173748661 20:45458384-45458406 TTTTCTTTGCAGGATGTGGGCGG - Intergenic
1173835357 20:46121832-46121854 TTTTCTCTGCATGCAGTGGGTGG - Exonic
1174091218 20:48049782-48049804 TTCTCTTGGCTTGAAATGGCAGG + Intergenic
1178714761 21:34954275-34954297 CTGTCTTTGACTGAAGTGGGAGG + Intronic
1179883177 21:44301878-44301900 TAGTCTGTGCATGGGGTGGCAGG - Intronic
1180238855 21:46484639-46484661 ATGTCCTTCCATGAAGTGTCTGG - Intronic
1184312211 22:43653771-43653793 CTGTCTTTGGAGGAAGGGGCAGG + Intronic
1185155762 22:49192516-49192538 TTGTCTTTGCGTTGAGTGGAGGG + Intergenic
950771072 3:15311606-15311628 ATGTCTTTGCATAAAGTCACAGG + Intronic
951889814 3:27558018-27558040 ATTTCTTTGGATGAAGTGGAGGG - Intergenic
954334983 3:49911069-49911091 TAGTCTTTGAAGCAAGTGGCAGG - Intronic
954451844 3:50575932-50575954 TAGTCCTTGCAGGCAGTGGCTGG + Intronic
960836778 3:121914904-121914926 ATGTCTTTGCATTAAATGTCTGG - Intronic
961090812 3:124111150-124111172 TGGTCTTTTCTTGTAGTGGCAGG - Intronic
962508655 3:136076133-136076155 ATGAGTTTGTATGAAGTGGCTGG - Intronic
963539661 3:146568813-146568835 TTTTTTTTGCATGAAGTGAATGG + Intergenic
964549646 3:157872701-157872723 CTGACATTGCATGAAGTGGGTGG - Intergenic
964630846 3:158808727-158808749 TTGTCTTTGCCTCTAGTGTCTGG + Intronic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
964814869 3:160706260-160706282 TTTTCTTTGCATGTGGTGCCTGG + Intergenic
967272880 3:187745097-187745119 TTGTCTTTGAGTGAATCGGCCGG - Intronic
968964141 4:3761037-3761059 TTGTCTTGTCAGGATGTGGCAGG - Intergenic
970587972 4:17532336-17532358 TTGACTTTGCATGGACTGGTCGG - Intergenic
975454570 4:74575130-74575152 TTGTCTTTGCTGCAAGTGGATGG - Intergenic
986361259 5:6980491-6980513 CTGTCTTTCCGTGAAGTGTCTGG + Intergenic
986361675 5:6984320-6984342 TTCTCTTTGCACAAAGTTGCAGG - Intergenic
986646181 5:9918438-9918460 ATATCTTTGCATGCAGAGGCTGG - Intergenic
988559089 5:32264131-32264153 TTGTCCTAGCAGGTAGTGGCAGG - Intronic
989581465 5:43037308-43037330 TGGTCGTTTCATGGAGTGGCCGG - Intergenic
990190505 5:53254722-53254744 CTGTCTTTTCATCAAGTGGATGG - Intergenic
990252093 5:53926427-53926449 TGTGCTTTGGATGAAGTGGCTGG - Intronic
990978181 5:61577181-61577203 TAGTCTTTGGATGGGGTGGCAGG + Intergenic
991954743 5:71983409-71983431 CTTTATTTGCAAGAAGTGGCAGG - Intergenic
994777278 5:104050137-104050159 TTGTCGGTGCTTGGAGTGGCTGG + Intergenic
995332584 5:110961682-110961704 TGGTCCTTCCAAGAAGTGGCAGG + Intergenic
996405162 5:123096873-123096895 TTGTCTATGGAGGTAGTGGCTGG + Intronic
1000187138 5:158870134-158870156 TTGCCTTTGGTTGAAGTGGAGGG - Intronic
1001524245 5:172417303-172417325 TTCTCTTTCCCTGAAGTCGCTGG + Intronic
1004084275 6:12429266-12429288 TTGTGTGTGCATGAAGAGGGTGG + Intergenic
1011998820 6:93627632-93627654 CTGTCTCTGCATGAAATGACTGG - Intergenic
1015037558 6:128675233-128675255 TTTGCTTTGCAGGAAGTGTCAGG - Intergenic
1018773431 6:166992522-166992544 TGCTCTGTGCAAGAAGTGGCAGG - Intergenic
1019563700 7:1669798-1669820 TTGGCTTTGCTTGAGGTGGTGGG + Intergenic
1020670942 7:11111278-11111300 TTGTCTTTTCATGAAGTAGATGG + Intronic
1021063964 7:16149346-16149368 CTGTCTTTCCATGCAGTGGCAGG - Intronic
1023168843 7:37370614-37370636 TTGTTTTTTCATGAAATGCCTGG - Intronic
1027484943 7:78749813-78749835 TTTTCTTTGGAGGAAGTAGCAGG - Intronic
1028353464 7:89878617-89878639 TTCTCTTTTCATCAAGTGGAAGG + Intergenic
1032013822 7:128363487-128363509 TTGATTTTACATGAATTGGCGGG - Intergenic
1036494104 8:9253718-9253740 TTGTCTTTGCATGAGTAGGCTGG + Intergenic
1037513640 8:19608601-19608623 TTGTCTTTGCCCGAAAAGGCTGG - Intronic
1040903434 8:52440331-52440353 TTGTCATTGTGTGAAATGGCAGG - Intronic
1042092175 8:65170547-65170569 TTCTCTTTACATGAAGAAGCAGG - Intergenic
1044118514 8:88364990-88365012 TGGTCTTTGGATGAAGCAGCAGG + Intergenic
1046803625 8:118455906-118455928 TTGCCTTTGAATGAGGTGGAAGG - Intronic
1048150573 8:131889585-131889607 TAGTCCTCTCATGAAGTGGCTGG - Intergenic
1050655842 9:7828030-7828052 TTGTTTATGGATGAAGTGGTAGG - Intronic
1057760929 9:97873845-97873867 TTGTCTTTGTATGAGGGAGCTGG + Intergenic
1058169216 9:101659085-101659107 TTATCTGTGTATGAAGTTGCAGG - Intronic
1058865067 9:109154320-109154342 TTGTCTAAGCAAGAAGTTGCGGG - Intronic
1062333313 9:136053988-136054010 GTGTCCTTACAGGAAGTGGCTGG - Intronic
1062651837 9:137581777-137581799 TGATTTATGCATGAAGTGGCTGG - Intergenic
1186124833 X:6401921-6401943 TTGTCTTGGCATCATTTGGCTGG + Intergenic
1186584179 X:10853948-10853970 TTCTATTTGCATGATGTGGAAGG - Intergenic
1187792828 X:22969565-22969587 ATGTCTTTTCATGAAATTGCTGG - Intergenic
1192024705 X:67437106-67437128 TTGTCTATGCATAGAGTAGCTGG + Intergenic