ID: 945335213

View in Genome Browser
Species Human (GRCh38)
Location 2:208583820-208583842
Sequence GACATTTGCAGAGACTGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 176}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945335213_945335217 -1 Left 945335213 2:208583820-208583842 CCCAAGCAGTCTCTGCAAATGTC 0: 1
1: 0
2: 0
3: 15
4: 176
Right 945335217 2:208583842-208583864 CCATGAAACCTTGGTGTTATAGG 0: 1
1: 0
2: 0
3: 13
4: 174
945335213_945335220 21 Left 945335213 2:208583820-208583842 CCCAAGCAGTCTCTGCAAATGTC 0: 1
1: 0
2: 0
3: 15
4: 176
Right 945335220 2:208583864-208583886 GAATCTACTCTGATGCTGTAGGG 0: 1
1: 0
2: 1
3: 8
4: 103
945335213_945335215 -10 Left 945335213 2:208583820-208583842 CCCAAGCAGTCTCTGCAAATGTC 0: 1
1: 0
2: 0
3: 15
4: 176
Right 945335215 2:208583833-208583855 TGCAAATGTCCATGAAACCTTGG 0: 1
1: 0
2: 1
3: 20
4: 179
945335213_945335219 20 Left 945335213 2:208583820-208583842 CCCAAGCAGTCTCTGCAAATGTC 0: 1
1: 0
2: 0
3: 15
4: 176
Right 945335219 2:208583863-208583885 GGAATCTACTCTGATGCTGTAGG 0: 1
1: 0
2: 0
3: 9
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945335213 Original CRISPR GACATTTGCAGAGACTGCTT GGG (reversed) Intronic
900434447 1:2621999-2622021 AACATTTGCAGAGATTTATTCGG - Intronic
902048600 1:13544139-13544161 GACATTTGCAGTGACTGTCCTGG - Intergenic
905451309 1:38058594-38058616 GAGTTTTGAAGAGACTGCATCGG + Intergenic
906176242 1:43775587-43775609 GACATTTGCAAACACTTCGTGGG + Intronic
908833098 1:68200872-68200894 GGCAATTGCAGAGTGTGCTTTGG + Intronic
908900326 1:68949332-68949354 GACATGTGCCGAGAGTGATTTGG + Intergenic
909061678 1:70886100-70886122 GACATTTGGAGATAGAGCTTTGG + Intronic
909352024 1:74665251-74665273 GACATTTGCAGGGTCTGGTGAGG - Intronic
909508096 1:76417921-76417943 GTCATTTTCAAAGACTGTTTAGG + Intronic
916290771 1:163164051-163164073 GAAATGTGCAGAGCCCGCTTGGG + Intronic
916839567 1:168585583-168585605 AACATTTGAACAGACTGCTGAGG + Intergenic
916966465 1:169949424-169949446 AAAAATTGCAGAGACTGCTTAGG - Intronic
917085320 1:171299157-171299179 AACACTAGCACAGACTGCTTGGG + Intergenic
917085426 1:171299940-171299962 AACACTAGCACAGACTGCTTAGG + Intergenic
918868728 1:189937960-189937982 GACATTTCCAGCAACTGCTCTGG + Intergenic
919916550 1:202143168-202143190 GTCATTTGCAGAGCATGTTTGGG + Intronic
920695264 1:208176948-208176970 TGCCTTTGCACAGACTGCTTTGG + Intronic
920774014 1:208918149-208918171 GGCATTAGCAGAGATTGCTCAGG - Intergenic
924898900 1:248373386-248373408 GACATTTCTAGACACTCCTTGGG - Intergenic
1065236179 10:23654818-23654840 GACTTCTGCAGTGACTGTTTGGG - Intergenic
1069200997 10:65616627-65616649 GCCATTTGCAAAGCTTGCTTAGG - Intergenic
1071742786 10:88379822-88379844 GACATTTACAGAGGCTTCATAGG + Intronic
1074177125 10:111019195-111019217 GACATTTACAATGCCTGCTTTGG - Intergenic
1075555992 10:123432787-123432809 GACATTTGTAGAGCCTGCCAAGG + Intergenic
1076757818 10:132582885-132582907 GATTCTTGCAGAGGCTGCTTTGG + Intronic
1079886273 11:25993240-25993262 GACATTTACAGATGCTACTTAGG + Intergenic
1080108639 11:28540565-28540587 GACAGTGGCAGAGACTGGCTAGG + Intergenic
1081350254 11:42043456-42043478 GTCATTTGCAGAGGGTTCTTTGG - Intergenic
1081506253 11:43720170-43720192 GCCAGTTGTAGAGACTGTTTTGG + Intronic
1081720472 11:45285344-45285366 GACGTCTGCAGAGACATCTTGGG + Intronic
1082500548 11:53671906-53671928 AACATTCTCAGAAACTGCTTTGG + Intergenic
1083160430 11:60850887-60850909 GGCTTCTGCAGAGACTGGTTTGG - Exonic
1085749479 11:79148371-79148393 GAAACTTGCAGGGACTGGTTTGG - Intronic
1087115416 11:94519604-94519626 GATATTTGAAAAGATTGCTTAGG - Intergenic
1089560813 11:119342239-119342261 CGCGTTTGCAGGGACTGCTTGGG + Intronic
1089936370 11:122368485-122368507 CATATTTTCAGAGAGTGCTTTGG - Intergenic
1090344333 11:126056128-126056150 GGCATTTGCAAAGGCTGCTGTGG - Intronic
1090990307 11:131811338-131811360 GACATTAGCAATCACTGCTTGGG - Intronic
1095035232 12:37357796-37357818 CACATTTGTAGAGTCTGCTGTGG - Intergenic
1095227485 12:39694976-39694998 GACATTTCTAGACACTCCTTGGG + Intronic
1096116606 12:49059125-49059147 GAGTTTTCCAGGGACTGCTTTGG + Intronic
1098251038 12:68569856-68569878 GACATTTCTAAAGACTGCTTGGG - Intergenic
1104091750 12:125523515-125523537 CACACTTGCAGAGATTCCTTTGG + Intronic
1106905568 13:34405749-34405771 GACATCTGAAAGGACTGCTTAGG - Intergenic
1106924761 13:34602069-34602091 GACATTTGGAGAGAATGACTGGG - Intergenic
1107630496 13:42337824-42337846 GACATTTGCAGAATCTGTTGTGG + Intergenic
1107843176 13:44481260-44481282 GACATCTGCAGAAAAAGCTTGGG + Intronic
1109155641 13:58906210-58906232 GACATTGGCAGTAACTGCCTTGG + Intergenic
1112679927 13:101751988-101752010 GAGATTTGCAGAGACTACTGTGG + Intronic
1115584769 14:34799470-34799492 GCCATTTTCAGAGATTTCTTGGG - Intronic
1116259992 14:42612920-42612942 GACATTTTCAGAGACTAATTTGG + Intergenic
1118654505 14:67932667-67932689 AACATTAGCACATACTGCTTGGG - Intronic
1121584546 14:95054424-95054446 GATACTTGCAGAGACTGCGCCGG + Intergenic
1122197350 14:100098609-100098631 GACATTTGCAGTGGTAGCTTTGG + Intronic
1122378824 14:101287114-101287136 GACATTTGGAAAGACTGGTGCGG - Intergenic
1127311223 15:57753847-57753869 GACATTTGCAGAGTGAGCTGGGG + Intronic
1128137928 15:65277760-65277782 GAATTTTTAAGAGACTGCTTTGG + Intronic
1130342915 15:83014273-83014295 GTCATTTGTAGAATCTGCTTTGG + Intergenic
1131848713 15:96515187-96515209 ACCATGTGCTGAGACTGCTTAGG + Intergenic
1133379160 16:5315504-5315526 AACACCTGCAGAGACAGCTTGGG - Intergenic
1134228098 16:12407744-12407766 GACCTTGTCAGAGACTGCTTTGG - Intronic
1135777051 16:25266096-25266118 GACATTTGCTGAAACTACTGGGG - Intergenic
1139371421 16:66471752-66471774 GAGACTTGCAGAGACTGGGTGGG - Intronic
1139373956 16:66485275-66485297 GACATTTGCTCAGACAGCTTTGG + Intronic
1139374409 16:66487804-66487826 GAGATCTGCAGGGGCTGCTTTGG - Intronic
1140661477 16:77194146-77194168 GACATTTGCAGAGACATGATGGG - Intronic
1142806649 17:2374875-2374897 GACACATACAGAGACTGTTTGGG - Intronic
1148671709 17:49415339-49415361 GACGTTTGCAGACAGGGCTTTGG - Intronic
1149166019 17:53753258-53753280 GACAGTTTCAGAGACTTCTAAGG - Intergenic
1152943269 17:83183965-83183987 GACATTTGCTCAGCCTGCCTGGG - Intergenic
1153719310 18:7885329-7885351 TACAGTTTCAGAGACAGCTTAGG + Intronic
1155246952 18:23919832-23919854 GGCATTTTCAAAGACTGCTCTGG + Intronic
1156229446 18:35139587-35139609 GACATCTACTTAGACTGCTTGGG - Intronic
1156286930 18:35705985-35706007 GACATAAGCAGAGCCTGCTAAGG - Intronic
1156703912 18:39857166-39857188 GACATTTGCAAAGTCTGTATAGG - Intergenic
1158234848 18:55301383-55301405 GAAATTTGCAGAGATTTGTTTGG + Intronic
1158832699 18:61297544-61297566 GACTTTTTAAGAGAGTGCTTTGG - Intergenic
1159524310 18:69568147-69568169 CACATTTGCAGAGACCACTCTGG + Intronic
1162439612 19:10684418-10684440 GACTTTTTCACAGACTGCTACGG + Intronic
1165940161 19:39410856-39410878 GACATTTGCAGAAACAGTCTTGG + Intergenic
1166903621 19:46087228-46087250 AACATCAGCACAGACTGCTTGGG - Intergenic
926351536 2:11999834-11999856 GACATTTACAGAGCCAGGTTGGG + Intergenic
927430451 2:23022547-23022569 GAAATCAGCAGAGACTGTTTTGG - Intergenic
929320991 2:40543251-40543273 GATATTTGCTGAGGATGCTTTGG - Intronic
930066598 2:47332515-47332537 GCCAGGTGCTGAGACTGCTTTGG - Intergenic
931689551 2:64823491-64823513 GGCATTGGCAGAGGCTGCTTGGG - Intergenic
932291809 2:70587595-70587617 GACATATGCAGAGGCTGCTGCGG - Intergenic
932910317 2:75799800-75799822 GTCATTTGCAGAAACTGGTCTGG + Intergenic
933892998 2:86788534-86788556 GACATTTGCAAACACGTCTTCGG + Exonic
935832083 2:107010771-107010793 GACATTTACAGAGCCTTCCTGGG + Intergenic
939921772 2:148124341-148124363 CACATTTGCTTACACTGCTTGGG + Intronic
940394480 2:153172438-153172460 GACTTTTGGACAGACTACTTAGG + Intergenic
940561068 2:155297973-155297995 GAAATTTACAGTGACTGCCTTGG + Intergenic
940650678 2:156436991-156437013 TAGATTTGCAAAGAGTGCTTTGG + Intronic
943211015 2:184966017-184966039 AATATTTGCAGAAACAGCTTTGG + Intergenic
944114209 2:196170792-196170814 GACGTTTTCAGTTACTGCTTGGG - Intronic
945335213 2:208583820-208583842 GACATTTGCAGAGACTGCTTGGG - Intronic
945578822 2:211566390-211566412 AATATCTGCGGAGACTGCTTGGG + Intronic
945763962 2:213950239-213950261 TACATTTGCAAAGACTGCTGCGG - Intronic
947227794 2:227857030-227857052 GACATTTGCGGTCCCTGCTTTGG - Intergenic
1169502052 20:6170234-6170256 GACATTTGCAGAGAATCCCATGG + Intergenic
1169596051 20:7200137-7200159 GACATTTGTAGACACTTCTCTGG - Intergenic
1170287240 20:14723388-14723410 GCCATTTTCAGTCACTGCTTTGG + Intronic
1170436110 20:16330981-16331003 GACTGCTCCAGAGACTGCTTGGG + Intronic
1172920370 20:38476286-38476308 GACATGTGCAAAGACTTTTTGGG + Intronic
1174163190 20:48566090-48566112 GACATTTGAAGAGAGAGCTGAGG + Intergenic
1174523934 20:51156416-51156438 GCCATTTGCTGAGAATGCTTTGG + Intergenic
1174803019 20:53581089-53581111 GACATTGCCAGATACTGATTGGG + Intronic
1175062836 20:56259292-56259314 GACATTTTCTGAGTCTGCTTTGG - Intergenic
1176402878 21:6331237-6331259 GAAGTTTGAAGAGACAGCTTAGG - Intergenic
1176434279 21:6657867-6657889 GAAGTTTGAAGAGACAGCTTAGG + Intergenic
1176458541 21:6984937-6984959 GAAGTTTGAAGAGACAGCTTAGG + Intergenic
1179126931 21:38599122-38599144 GAAGTTTGCAGAGGCTGCCTGGG + Intronic
1182392351 22:30009270-30009292 GATACTTGCAGAGACTGGTCTGG - Intronic
950500569 3:13360975-13360997 GATCTTTGCGAAGACTGCTTTGG - Intronic
954068245 3:48124216-48124238 AACGTTTGCAGAGCCTACTTTGG - Intergenic
956967500 3:74479062-74479084 GAAATTTGAAGAGACTGTCTGGG + Intronic
957256925 3:77849019-77849041 GAAATTTGCCCAGACTACTTTGG - Intergenic
960545375 3:118908131-118908153 GACATTTCCAGAGACAATTTGGG + Intronic
963864976 3:150350825-150350847 GAGATTTGCAGAGACCATTTGGG + Intergenic
965001136 3:162955275-162955297 GTGATTTTCAGAGTCTGCTTGGG + Intergenic
968981264 4:3850917-3850939 GCCATCTGCAGAGAATGCTCCGG - Intergenic
970280719 4:14451994-14452016 GACAACTGCAGAGACTGGCTCGG + Intergenic
974755427 4:66200258-66200280 GACATTTGCTCATATTGCTTTGG - Intergenic
981658019 4:147134132-147134154 GATATTTCAAGAGAATGCTTAGG + Intergenic
983663934 4:170161215-170161237 GAAATTTGCATATACTGTTTTGG - Intergenic
983963439 4:173781834-173781856 GACACTTCCAGAGACTACTGTGG - Intergenic
986762969 5:10896862-10896884 GACATTTTTAAAGACTTCTTGGG + Intergenic
987090385 5:14504350-14504372 ACCATTTGCAGAGGCTGCTGAGG - Intronic
987944604 5:24588161-24588183 GACATTGACAGAGACTCCTTTGG - Intronic
988115406 5:26881915-26881937 CACATTTGGAAAGACTGCTGAGG - Intronic
990685362 5:58294819-58294841 GTCATTTCCAGAGGCTGCTAAGG + Intergenic
991468798 5:66945188-66945210 TAAATTTGCAGAGACTGATTGGG + Intronic
992006391 5:72482427-72482449 GACATTTGCTGGGACTCCTCTGG + Intronic
992052470 5:72954274-72954296 GCCCATTTCAGAGACTGCTTTGG - Intergenic
993623803 5:90199283-90199305 TACATTTTCTGAGACTGCTTTGG - Intergenic
995035366 5:107527948-107527970 AACATTTGTAGAGAATGTTTGGG - Intronic
995736496 5:115306238-115306260 GCCATGTTGAGAGACTGCTTAGG + Intergenic
996421468 5:123267583-123267605 GACATTCCCAGCTACTGCTTTGG + Intergenic
996775635 5:127129486-127129508 GACATTTGTAGAGCCTGTTCTGG - Intergenic
997587618 5:135052887-135052909 GATCTTTGCAGTGACTCCTTGGG + Intronic
999429008 5:151510157-151510179 GACATTTGCAGACATAGCCTAGG + Exonic
999474837 5:151889066-151889088 GACACTTGCAGGGACTGGGTGGG - Intronic
999847433 5:155499973-155499995 GACATTAGCAGAGACAGATCTGG + Intergenic
1000530256 5:162410546-162410568 GGCATGTGCAGAGACTGGATGGG - Intergenic
1005567364 6:27110091-27110113 GACATATGCACAGACTGGGTTGG + Intergenic
1008642060 6:53474306-53474328 GACATTTCTAGATACAGCTTGGG - Intergenic
1010280664 6:74019165-74019187 GACATTTGCAGACACATCCTGGG + Intergenic
1012193998 6:96316774-96316796 GATATTTGCAGAGACAGAATTGG - Intergenic
1015733720 6:136375314-136375336 CTCATTTGCAGCCACTGCTTTGG - Intronic
1019088090 6:169500821-169500843 GAGCTGTGCAGAGGCTGCTTAGG - Intronic
1020630567 7:10634494-10634516 TACATTTGCAGTGACCGGTTAGG + Intergenic
1021821587 7:24503537-24503559 GAAATTTGTAGAGGGTGCTTTGG - Intergenic
1023287705 7:38636571-38636593 TATATTGGCAGAGACTTCTTTGG + Intergenic
1026427396 7:70310284-70310306 AACAGGTGCAGAGACTGCATAGG - Intronic
1027568692 7:79832988-79833010 GTCATTTGCAGTGTCTGTTTTGG - Intergenic
1028445256 7:90914973-90914995 GACATATGCAGAGGCTGCCCTGG + Intronic
1028698712 7:93750205-93750227 GATATTTGAAGATACTTCTTTGG - Intronic
1034991684 7:155551486-155551508 GACAGAGGCAGAGACTGCGTTGG + Intergenic
1036100962 8:5784406-5784428 GAGATTTACAGCGACTACTTAGG - Intergenic
1036787310 8:11696930-11696952 GGCATCTGCAGAGACTTCCTGGG + Intronic
1037296788 8:17410207-17410229 GACATTTGCAAGGTCTGTTTTGG + Intronic
1037810820 8:22086037-22086059 GAAATCTGCAGAGACTGAATTGG + Intergenic
1039106696 8:33997853-33997875 GAGATTTCCAGACATTGCTTGGG - Intergenic
1040324110 8:46332884-46332906 GACATTTGCAGTGAGTGTTACGG - Intergenic
1044366064 8:91347194-91347216 GACATTAGAAGAGACTGGTCAGG + Intronic
1044805832 8:96007084-96007106 AAGAGTTGCAGAGACAGCTTTGG - Intergenic
1044808113 8:96029652-96029674 GAAATTTACAGAGAAGGCTTTGG - Intergenic
1045172572 8:99687130-99687152 GACATTTGTAGACACACCTTGGG - Intronic
1052022709 9:23543236-23543258 GACATTTGCAGCAGCTTCTTGGG - Intergenic
1052800690 9:32965137-32965159 GAGATTTACAGAGACTGCCTTGG - Intergenic
1055685163 9:78765629-78765651 GACATTTGAAGAAACTCATTGGG + Intergenic
1056338562 9:85601580-85601602 AACACTAGCACAGACTGCTTAGG + Intronic
1059691700 9:116691154-116691176 GAGACTAGCAGAGACTACTTAGG - Intronic
1061099779 9:128483990-128484012 GGCATTTGCAGGCACAGCTTCGG + Exonic
1185495948 X:554770-554792 GACATATGGAGAGGCTGCTCTGG + Intergenic
1185495962 X:554828-554850 GACATATGGAGAGGCTGCTCTGG + Intergenic
1185496012 X:555059-555081 GACATATGGAGAGGCTGCTCTGG + Intergenic
1185496018 X:555088-555110 GACATATGGAGAGGCTGCTCTGG + Intergenic
1185496065 X:555291-555313 GACATATGGAGAGGCTGCTCTGG + Intergenic
1185496088 X:555393-555415 GACATATGGAGAGGCTGCTCTGG + Intergenic
1185496102 X:555451-555473 GACATATGGAGAGGCTGCTCTGG + Intergenic
1185496113 X:555509-555531 GACATATGGAGAGGCTGCTCTGG + Intergenic
1185529823 X:808724-808746 CACATATGCAGAGACGTCTTTGG + Intergenic
1186933493 X:14420988-14421010 GATATTTGCAGACACAACTTTGG + Intergenic
1187035145 X:15530413-15530435 GGCACATGGAGAGACTGCTTGGG - Intronic
1187518532 X:19993049-19993071 TACATTTCCAAACACTGCTTGGG + Intergenic
1188413362 X:29901476-29901498 GACATTTGAATAAACTGCTAGGG + Intronic
1190580589 X:51889918-51889940 GTCTTTTGCAAAGAATGCTTTGG + Intronic
1195564546 X:106325614-106325636 GGCTGTTGCTGAGACTGCTTAGG + Intergenic
1195577019 X:106462707-106462729 GACTTCTGCTAAGACTGCTTAGG - Intergenic
1200344985 X:155439277-155439299 TACATTTGCAAAGACTGCAGGGG - Intergenic