ID: 945335541

View in Genome Browser
Species Human (GRCh38)
Location 2:208588574-208588596
Sequence GGGGACAAACCACCAGAAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 210}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945335536_945335541 -3 Left 945335536 2:208588554-208588576 CCGAGAAGAGACCAAAGACTGGG 0: 1
1: 0
2: 4
3: 14
4: 214
Right 945335541 2:208588574-208588596 GGGGACAAACCACCAGAAGCGGG 0: 1
1: 0
2: 0
3: 21
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945335541 Original CRISPR GGGGACAAACCACCAGAAGC GGG Intronic
901556077 1:10032661-10032683 GGGGAAGATCCACCAGAAGGTGG - Intergenic
901675880 1:10884306-10884328 TGTGACAAAACACCAGCAGCAGG + Intergenic
901933892 1:12615050-12615072 TGGGACAAACCCCCAGAGCCAGG - Intronic
902205580 1:14865903-14865925 GCCAAGAAACCACCAGAAGCTGG + Intronic
903252907 1:22069549-22069571 GGGGAGAAACCACCTGAGCCAGG - Intronic
903827443 1:26156239-26156261 GGGGACCCACAACCAGAAACAGG + Intergenic
906052614 1:42887540-42887562 GGGGGCCGACCACCAGAGGCAGG + Intergenic
907053631 1:51345532-51345554 GGGCACAGAGCACCAGCAGCAGG + Intergenic
908027554 1:59968703-59968725 GGGGACCAACCAGCACATGCAGG + Intergenic
913662323 1:121015406-121015428 GTGGACTAAACTCCAGAAGCTGG + Intergenic
914044698 1:144081195-144081217 AGAGAGAAGCCACCAGAAGCTGG + Intergenic
914133412 1:144879491-144879513 AGAGAGAAGCCACCAGAAGCTGG - Intergenic
914380028 1:147107388-147107410 GGGGACAAAGACCCAGAAGCTGG - Intergenic
915357431 1:155263880-155263902 GGGGGCAAACCACCCTAAGAAGG + Intronic
916706560 1:167356937-167356959 GGGGGCACACCACCAGAAAAGGG - Intronic
917505626 1:175624564-175624586 GTCTGCAAACCACCAGAAGCTGG + Intronic
917581122 1:176378942-176378964 GGGGACTCATCACCAGAAGAAGG - Intergenic
917584857 1:176416295-176416317 GGGGAGAAACCAGCAGAAAAAGG - Intergenic
917979550 1:180260475-180260497 GTGGACAAATCAACAGCAGCAGG + Intronic
918906685 1:190505494-190505516 GGGGAGAAACCACCACAAAAAGG - Intergenic
919592363 1:199520657-199520679 GGGGAGAAACCAGCAGAGGGTGG - Intergenic
921519044 1:216136827-216136849 GCCAGCAAACCACCAGAAGCTGG + Intronic
922873975 1:228925499-228925521 GGGAGCAATCCCCCAGAAGCAGG + Intergenic
1063159254 10:3407956-3407978 GGGAACAAACAAACAAAAGCAGG + Intergenic
1063453608 10:6167912-6167934 AGGGACAAAGGACCAGAAACAGG - Intronic
1064122182 10:12629473-12629495 GGGGACAACACACAAGAATCTGG - Intronic
1066528178 10:36305364-36305386 GGGGAAAAAACAGCAGATGCTGG + Intergenic
1066956820 10:42180874-42180896 AGAGAGAAGCCACCAGAAGCTGG + Intergenic
1068128244 10:52867301-52867323 GGCAGCAAACCACCAGAAGCTGG - Intergenic
1074358388 10:112805762-112805784 GCTGACAACCCACCAGAAGCTGG + Intronic
1076822218 10:132945208-132945230 GGGGACAGGCAAGCAGAAGCCGG + Intergenic
1078673051 11:13382024-13382046 GGGCACAAACCATCAAAAGCAGG + Intronic
1079246964 11:18759813-18759835 ATGGACAAACCTCCAGAAGATGG - Intronic
1080826053 11:35850395-35850417 AGGCACTAACCACCGGAAGCAGG - Intergenic
1084342506 11:68515398-68515420 TGGGACAAAGAACCAGGAGCTGG + Intronic
1084356798 11:68644256-68644278 TGGGACAAAGAACCAGGAGCTGG + Intergenic
1085618947 11:78023028-78023050 GGGGACAGCGCGCCAGAAGCAGG + Intronic
1087013221 11:93532721-93532743 GGCCAGCAACCACCAGAAGCTGG + Intronic
1090306723 11:125697745-125697767 GAGGAAAAACCCCCAGCAGCAGG - Intergenic
1093232729 12:16567484-16567506 GAAGACAAACCAGCTGAAGCAGG + Intronic
1095287955 12:40438777-40438799 GGGCACAAACCACTAGAAGGAGG + Intronic
1099492170 12:83300788-83300810 GGGGAGAAACCACCACAAAAAGG + Intergenic
1099716768 12:86304854-86304876 GGCAGCAAACCACCAGTAGCTGG + Intronic
1099932982 12:89095022-89095044 GCTAGCAAACCACCAGAAGCTGG + Intergenic
1101469016 12:104977704-104977726 GGTGACCAAGAACCAGAAGCTGG - Intergenic
1101558291 12:105831445-105831467 GGTGACAAAACACCATAGGCTGG - Intergenic
1101849881 12:108393545-108393567 GGGAAGAAACCACCAGCAGGTGG + Intergenic
1103700945 12:122848476-122848498 GGGCACACACCACGAGAAGGGGG + Exonic
1107299109 13:38947051-38947073 GGGCAGAAACCAACAGAAACAGG - Intergenic
1110079481 13:71292437-71292459 TGGGACACACCACCAGAAAAGGG - Intergenic
1110340900 13:74388850-74388872 GGGGAAAGACCACCAGATGGGGG + Intergenic
1110494657 13:76152962-76152984 GCCAGCAAACCACCAGAAGCTGG - Intergenic
1110942143 13:81363563-81363585 GGGGAGAAACCAGCACAAACAGG + Intergenic
1111946283 13:94669017-94669039 GCCAGCAAACCACCAGAAGCAGG + Intergenic
1114015197 14:18422187-18422209 AGGGACAAACAAGCAGAACCCGG + Intergenic
1114281407 14:21195631-21195653 GGGGACGCACCACCAGAAAAAGG + Intergenic
1116366747 14:44076412-44076434 GTGGTCAAAGCATCAGAAGCAGG + Intergenic
1120092087 14:80343764-80343786 GCAGACAAACTACCAGAAGCTGG - Intronic
1120840993 14:89084608-89084630 GCCGGCAAACCACCAGCAGCTGG - Intergenic
1121012493 14:90528897-90528919 TGGGTCACACCACCAGAAACAGG - Exonic
1121398448 14:93649009-93649031 GGGGAGAAAGAACCAGAAGAGGG + Intronic
1122595852 14:102891324-102891346 GGGGACAAACCAGCAGATCAAGG + Exonic
1202936293 14_KI270725v1_random:90906-90928 AGAGAGAAGCCACCAGAAGCTGG - Intergenic
1126772268 15:52070278-52070300 GGTGAGAAAGGACCAGAAGCTGG - Intergenic
1126829930 15:52591476-52591498 GCGGACAGATCACCTGAAGCTGG - Intronic
1129136370 15:73555900-73555922 TGTGACAAATCATCAGAAGCTGG + Intronic
1129297104 15:74605545-74605567 GCTGGCAAAGCACCAGAAGCTGG + Intronic
1129612974 15:77075026-77075048 AGGCACAAACCACCACAAGCAGG - Intronic
1136548574 16:30969345-30969367 GGGGACCAAGCCCCCGAAGCGGG + Exonic
1138307512 16:55990651-55990673 GCCAGCAAACCACCAGAAGCTGG - Intergenic
1140536205 16:75712084-75712106 GGGGACACTCCACCAGAAAGGGG + Intronic
1141390894 16:83662552-83662574 GGAGATGAACCACCAGGAGCAGG + Intronic
1141625616 16:85259598-85259620 GGGGACAAAACCCCAGCAGCAGG - Intergenic
1145861612 17:28215930-28215952 GGGGATAAACCACTAAGAGCAGG - Intergenic
1148953843 17:51337264-51337286 GGGGACAAACAGGCAGAAGAAGG + Intergenic
1150318809 17:64192562-64192584 TGGGACAAAATACCACAAGCTGG - Intronic
1151750858 17:76036758-76036780 GGGGACAGAGCGCCAGATGCAGG - Intergenic
1153212892 18:2787373-2787395 GGGGACAAACCAACCATAGCAGG + Intronic
1155535484 18:26811991-26812013 GGGGGAAAACCATGAGAAGCAGG + Intergenic
1157755088 18:50210573-50210595 GTGGGCAGACCCCCAGAAGCTGG - Intergenic
1159338935 18:67109648-67109670 AGTGAAAAACCAACAGAAGCAGG - Intergenic
1159622154 18:70651033-70651055 GGGGACAAAACCACAGAAGGTGG + Intergenic
1159666037 18:71161849-71161871 AGGGCCAAACCATCAGAACCAGG - Intergenic
1159891258 18:73955346-73955368 GGGGACACTCCACCAGAAAAGGG + Intergenic
1160324692 18:77933850-77933872 AGGGATAAACGACTAGAAGCTGG + Intergenic
1161747173 19:6068121-6068143 GAGGTCAAATCACCAGCAGCTGG + Intronic
1162925166 19:13927202-13927224 GGGGACAGCCCAGCTGAAGCTGG + Exonic
1165406173 19:35632691-35632713 GGGGACACACCAACAGACCCAGG - Intronic
1167605530 19:50479872-50479894 GGGGAAAAGCCACCACAAGGAGG - Intronic
1168410030 19:56134047-56134069 GGGGAAGAACCAGCAGAAGGGGG - Intronic
1202684256 1_KI270712v1_random:34600-34622 AGAGAGAAGCCACCAGAAGCTGG + Intergenic
925614702 2:5734406-5734428 GCCGGCAAACCACCAGAAGGTGG + Intergenic
927098856 2:19771330-19771352 GTCAGCAAACCACCAGAAGCTGG - Intergenic
927358556 2:22204657-22204679 GCCAGCAAACCACCAGAAGCTGG + Intergenic
928653231 2:33423464-33423486 GGGGACAAATGACCACAAACTGG + Intergenic
933761343 2:85674320-85674342 TGGAACAAAGCACCACAAGCTGG - Intergenic
934247464 2:90320248-90320270 AGAGAGAAGCCACCAGAAGCTGG - Intergenic
934261861 2:91482355-91482377 AGAGAGAAGCCACCAGAAGCTGG + Intergenic
934304901 2:91813344-91813366 AGAGAGAAGCCACCAGAAGCTGG + Intergenic
934328356 2:92039404-92039426 AGAGAGAAGCCACCAGAAGCTGG - Intergenic
934466735 2:94269945-94269967 AGAGAGAAGCCACCAGAAGCTGG - Intergenic
935668628 2:105536275-105536297 GCCAGCAAACCACCAGAAGCTGG + Intergenic
935945738 2:108285056-108285078 GCCTGCAAACCACCAGAAGCTGG + Intergenic
936528890 2:113261354-113261376 GGCCAGAAACCCCCAGAAGCTGG + Intronic
936598458 2:113872441-113872463 GCCAGCAAACCACCAGAAGCTGG + Intergenic
936814881 2:116447741-116447763 GGAGAAGAACCACAAGAAGCTGG - Intergenic
938568955 2:132544786-132544808 GAGGACAGACCACCTGAAGTTGG + Intronic
939977694 2:148737980-148738002 GGGGACAGACAACAGGAAGCAGG - Intronic
940647733 2:156409068-156409090 AAGAAAAAACCACCAGAAGCCGG + Intergenic
940724860 2:157325578-157325600 GGGGATAAACCACCTGAAAACGG - Exonic
941367709 2:164627431-164627453 GGGGAATAACCACCGGGAGCGGG + Intergenic
941595831 2:167475863-167475885 GCAGGCAAACCACCAGAAGCTGG - Intergenic
941845419 2:170126943-170126965 GGGGAGAAACCAGCAGAAAAAGG + Intergenic
942869332 2:180715963-180715985 GGGGATAAAGGAACAGAAGCAGG + Intergenic
944451397 2:199846731-199846753 AGTCACAAACCACCAAAAGCTGG - Intronic
945335541 2:208588574-208588596 GGGGACAAACCACCAGAAGCGGG + Intronic
947076354 2:226349941-226349963 GACAGCAAACCACCAGAAGCTGG + Intergenic
947990499 2:234484024-234484046 GCCAGCAAACCACCAGAAGCTGG + Intergenic
948041244 2:234903356-234903378 GCAGGCAATCCACCAGAAGCTGG + Intergenic
1170997780 20:21380840-21380862 GTGGACAAACTACCTGAAGGAGG - Intronic
1174482757 20:50842801-50842823 GGGGGCAAGTCACCAGAAACAGG - Intronic
1175850019 20:62085274-62085296 TGTGACAAATCACCACAAGCTGG - Intergenic
1176430369 21:6571644-6571666 TGTGACAAACGACCACAAGCTGG + Intergenic
1176587205 21:8598699-8598721 AGAGAGAAGCCACCAGAAGCTGG + Intergenic
1179239130 21:39573347-39573369 GGAGACAAACCACCATATGATGG + Intronic
1179705763 21:43179106-43179128 TGTGACAAACGACCACAAGCTGG + Intergenic
1180235410 21:46456558-46456580 GCCAGCAAACCACCAGAAGCTGG + Intergenic
1180270036 22:10575696-10575718 AGAGAGAAGCCACCAGAAGCTGG + Intergenic
1180587867 22:16909120-16909142 AGAGAGAAGCCACCAGAAGCTGG - Intergenic
1180879101 22:19191342-19191364 GGGGTGAAAGCACCAGCAGCAGG + Exonic
1181890695 22:26061072-26061094 GGGGCCAAGCCAACAGTAGCTGG - Intergenic
1182823650 22:33242863-33242885 GCCAGCAAACCACCAGAAGCTGG - Intronic
1184085734 22:42262691-42262713 GAGGACAAACAACCAGAGGTGGG + Intronic
1184107122 22:42374359-42374381 GGGAACAGAGCCCCAGAAGCAGG - Intergenic
1185179831 22:49352906-49352928 GGGGACAAGCCGGCAGAGGCAGG + Intergenic
949167339 3:958472-958494 GGGGTCAAAGCATCAGGAGCAGG + Intergenic
950020646 3:9785257-9785279 GGAGAGAAGCCAACAGAAGCGGG + Intronic
951431937 3:22618315-22618337 GGGGACAAAACAACAGAAAAGGG + Intergenic
951993604 3:28702783-28702805 TGTGTTAAACCACCAGAAGCTGG - Intergenic
953050202 3:39334761-39334783 GGTGCCAAACAACCACAAGCTGG + Intergenic
953123111 3:40065134-40065156 GTTGTCAAACCACCAGAAGCTGG - Intronic
953759263 3:45673978-45674000 GGGGACAAATCAGCACAAGAAGG - Intronic
954662878 3:52235349-52235371 TGGGACAACCCACCAGAAGATGG + Intronic
955928961 3:64036657-64036679 AGTGACAATCCTCCAGAAGCAGG + Intergenic
958263132 3:91405742-91405764 GCCAACAAACCACCAGAAGCTGG + Intergenic
959067777 3:101676175-101676197 GGGGACGAGTCACCCGAAGCCGG - Intronic
960708069 3:120500408-120500430 GGGGTCAAAGCATCAGGAGCAGG + Intergenic
961089517 3:124098301-124098323 GTGGACAGCCCAACAGAAGCAGG - Intronic
961205882 3:125081201-125081223 GATCACAAGCCACCAGAAGCTGG + Intergenic
967188773 3:186967528-186967550 GGGAACAAACCAGCAGATGGGGG + Intronic
968048535 3:195637654-195637676 GGTGACAAACCACGTGAACCTGG - Intergenic
968098872 3:195951973-195951995 GGTGACAAACCACGTGAACCTGG + Intergenic
968161539 3:196431731-196431753 GGGGACAGGCCGCCAGAAGCGGG - Intronic
968294961 3:197569327-197569349 GTGGATAATCCAACAGAAGCTGG + Intronic
968306077 3:197652271-197652293 GGTGACAAACCACGTGAACCTGG + Intergenic
968634465 4:1670829-1670851 GGGGAAAAACCACCAGTAACTGG + Intronic
970030750 4:11671585-11671607 GGGGATAGACCAGCAGAAACAGG + Intergenic
973829431 4:54743338-54743360 GCCAGCAAACCACCAGAAGCTGG - Intergenic
974664273 4:64937572-64937594 GGGGACACTCCACCAGAAAAGGG - Intergenic
974691024 4:65298234-65298256 GGGGACAATCCACCAGAAATAGG + Intergenic
985505012 5:274135-274157 GGTGACAAACCACTTGAACCTGG - Intronic
988692023 5:33581942-33581964 GACGTCAAACCACCAGAAGCTGG + Intronic
988783698 5:34546524-34546546 GGCCAAAAACCAACAGAAGCTGG + Intergenic
988801387 5:34699405-34699427 GCCAGCAAACCACCAGAAGCTGG - Intronic
990929447 5:61072154-61072176 GGAGACAAAACAGCAGCAGCTGG + Intronic
991289817 5:65022819-65022841 GGGCAAAAAACACAAGAAGCAGG - Intergenic
997030993 5:130127748-130127770 GGAGAAAAAGCACCAGAAACAGG - Intronic
997926601 5:138035911-138035933 GGGGAGAAACCACCAGAGAAGGG - Intronic
999273618 5:150313698-150313720 GCCAACAAACCACCAGAGGCTGG + Intronic
999706067 5:154273301-154273323 GTGGAGAAACCACCAGAATCAGG - Intronic
1001916104 5:175561441-175561463 GGGGACACTCCACCAGAAAAGGG + Intergenic
1003358695 6:5402107-5402129 GGAGAAAAACAACCAGAAGGAGG - Intronic
1004361725 6:14977190-14977212 GGCCAGCAACCACCAGAAGCTGG - Intergenic
1004743094 6:18482147-18482169 GGGGACAGTCAACCAGAACCAGG - Intergenic
1006469414 6:34218609-34218631 GCAGGCAAGCCACCAGAAGCTGG + Intergenic
1006721403 6:36154425-36154447 GGGAGTAAACCACCAGAAGAAGG + Intergenic
1008494534 6:52119392-52119414 GGGGGTAAACAACCAGAAGTAGG + Intergenic
1008992276 6:57617146-57617168 GCTAACAAACCACCAGAAGCTGG - Intronic
1009180899 6:60516258-60516280 GCCAACAAACCACCAGAATCTGG - Intergenic
1009652180 6:66490085-66490107 GGGGAGAAACCAGCACAAACTGG + Intergenic
1010432609 6:75796119-75796141 GGGAAAAAAGCACCAAAAGCAGG - Intronic
1010564575 6:77393854-77393876 AGGCACAAACCACCATATGCAGG + Intergenic
1011934928 6:92764921-92764943 GGAGACAAACCAACAGAGCCAGG + Intergenic
1012657447 6:101842353-101842375 GAGGAAAAACCACCAGAAAAAGG - Intronic
1013021605 6:106226439-106226461 GGGGAAAAAGCAGCAGAAACTGG + Intronic
1013731585 6:113174241-113174263 GGGGTCAAAACACCAGGAGCAGG + Intergenic
1014898055 6:126928035-126928057 AAGGATAAACCACCAAAAGCAGG - Intergenic
1016475671 6:144424298-144424320 GCAGACAAACCACCAGAATTTGG - Intronic
1017645692 6:156538164-156538186 GGGGACAAAGGAACAGAAGTTGG + Intergenic
1019943403 7:4308552-4308574 GGGGGGGGACCACCAGAAGCTGG - Intergenic
1022399918 7:30027250-30027272 GGGGCCAAACAACCTTAAGCAGG - Intergenic
1022588662 7:31640314-31640336 TGTGAGAAACCACCAAAAGCTGG - Intronic
1024725200 7:52186340-52186362 AGGAACAAACCAGCAAAAGCAGG + Intergenic
1024955470 7:54914704-54914726 GCCGACAAATCACCGGAAGCTGG + Intergenic
1026912248 7:74097732-74097754 TGGCACAAACCACCAGAGGTGGG + Intronic
1027187748 7:75982000-75982022 GGGGCCAGACGCCCAGAAGCCGG - Intronic
1027790515 7:82634420-82634442 GGGGAGAAACCAGCACAAACAGG + Intergenic
1029959111 7:104670651-104670673 GGGGTCAAAGCATCAGGAGCAGG - Intronic
1031771732 7:125852284-125852306 TGGGACAAACAAGCAGAAGAGGG + Intergenic
1034193712 7:149229945-149229967 GGGCCCAGACCACCAGCAGCTGG - Intergenic
1039283095 8:36007451-36007473 GGGGAGAAACCAGCACAAACGGG + Intergenic
1043430330 8:80188112-80188134 GAGGACAAAAAAACAGAAGCTGG + Intronic
1044319709 8:90788956-90788978 GGAGAAAAACCACGAGAAGGAGG - Intronic
1047871802 8:129091339-129091361 GGAGAGAAAACACCTGAAGCTGG - Intergenic
1049009254 8:139876351-139876373 GAGGACAGACCACCTGGAGCAGG - Intronic
1051432294 9:16992290-16992312 GGGGATAAACCAGCTGAATCTGG - Intergenic
1051745720 9:20292989-20293011 GCCAGCAAACCACCAGAAGCTGG - Intergenic
1052180308 9:25518391-25518413 GGGCACACACCACCAGAAAAGGG + Intergenic
1052669574 9:31538797-31538819 GGGGACACTCCACCAGAAAAGGG + Intergenic
1052902813 9:33808906-33808928 AGGGTCAAACTACCATAAGCAGG + Intergenic
1053696788 9:40646739-40646761 AGAGAGAAGCCACCAGAAGCTGG - Intergenic
1053943181 9:43276882-43276904 AGAGAGAAGCCACCAGAAGCTGG - Intergenic
1054308039 9:63445970-63445992 AGAGAGAAGCCACCAGAAGCTGG - Intergenic
1054406769 9:64769969-64769991 AGAGAGAAGCCACCAGAAGCTGG - Intergenic
1054440396 9:65255429-65255451 AGAGAGAAGCCACCAGAAGCTGG - Intergenic
1054490011 9:65766509-65766531 AGAGAGAAGCCACCAGAAGCTGG + Intergenic
1058525921 9:105857544-105857566 GGAGAAAAACAACCAGAAGTGGG - Intergenic
1061726893 9:132587071-132587093 GGGGAGAAAGAACCCGAAGCTGG - Intronic
1061861747 9:133471978-133472000 GGGGCCAAACCCCCAGTGGCTGG - Exonic
1062064225 9:134517701-134517723 AGAGACAAGCCACCAGCAGCTGG - Intergenic
1062402024 9:136376932-136376954 CCTGAGAAACCACCAGAAGCAGG - Intronic
1202779240 9_KI270717v1_random:20390-20412 AGAGAGAAGCCACCAGAAGCTGG - Intergenic
1203586301 Un_KI270747v1:6787-6809 AGAGAGAAGCCACCAGAAGCTGG - Intergenic
1203617164 Un_KI270749v1:76410-76432 AGAGAGAAGCCACCAGAAGCTGG + Intergenic
1188457470 X:30383030-30383052 GCCAACAAACCACCAGAAGCTGG + Intergenic
1191904379 X:66073431-66073453 GGGGTCAAAGCATCAGGAGCAGG + Intergenic
1191941961 X:66490231-66490253 GGGGAGAAACCAGCACAAACAGG + Intergenic
1192020682 X:67387287-67387309 GGGGAGAAACCAGCACAAGAAGG + Intergenic
1198679418 X:139165647-139165669 GGGGACAAAGCTCCAGAACGTGG - Intronic
1199635954 X:149811550-149811572 GGGGACAAAGTACTAAAAGCAGG + Intergenic
1201194513 Y:11478687-11478709 AGGGAGAAGCCACCAGAAGCTGG - Intergenic
1201315832 Y:12644323-12644345 GGAGACGAACCAGCAGAAGGTGG - Intergenic