ID: 945339117

View in Genome Browser
Species Human (GRCh38)
Location 2:208630716-208630738
Sequence AATTCTTCTTCAGATGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 564
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 520}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945339117_945339118 -8 Left 945339117 2:208630716-208630738 CCAGTTTCATCTGAAGAAGAATT 0: 1
1: 0
2: 1
3: 42
4: 520
Right 945339118 2:208630731-208630753 GAAGAATTTTAATACCCCATTGG 0: 1
1: 0
2: 0
3: 14
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945339117 Original CRISPR AATTCTTCTTCAGATGAAAC TGG (reversed) Intronic
901903025 1:12383054-12383076 AATTGTTGTTCAGGTGGAACTGG - Exonic
904572393 1:31476787-31476809 AATTCTTTTTCAGGTAAATCAGG + Intergenic
904984348 1:34532535-34532557 AATATTTGTTTAGATGAAACTGG - Intergenic
905142362 1:35858112-35858134 AATTTTTCTAAAGATGAGACTGG - Intergenic
905605197 1:39291897-39291919 TTTTCTTTTTCAGATGAAACTGG + Exonic
906177399 1:43786409-43786431 ACTTCTTCTTTAGATGTAGCAGG + Intronic
906563938 1:46783274-46783296 AACTCTTTTTCAGATAAATCAGG + Intronic
906877063 1:49551281-49551303 AATTCTTTTTCAGTTAAATCAGG + Intronic
906910633 1:49944713-49944735 AATTCTTATTCAGGTAAATCAGG - Intronic
907624627 1:56017212-56017234 TCTTCTTCTTCAGATAAGACTGG + Intergenic
907686604 1:56617841-56617863 AACCCATCATCAGATGAAACAGG + Intronic
909226152 1:73025761-73025783 CATTCTTGGTCAGATAAAACAGG + Intergenic
909673748 1:78215701-78215723 AATTCTTTTTCAGGTAAATCAGG - Intergenic
909981363 1:82105386-82105408 AATTCTTTTTCAGGTAAATCAGG + Intergenic
910077717 1:83299678-83299700 AATTCTTTTTCAGGTAAATCAGG - Intergenic
910231608 1:84993549-84993571 AATTATTCCTCTGATGAATCTGG - Intronic
910388859 1:86716157-86716179 AATTCTTCCCTAGATGAAAAAGG - Intronic
910598334 1:89004373-89004395 AATTCTTTTTCAGATAAATCGGG + Intergenic
910738876 1:90494012-90494034 AATTCTTTTTCAGGTAAATCAGG + Intergenic
910955088 1:92694337-92694359 AGCACTTCTTCAGATGAATCAGG - Exonic
911743384 1:101411758-101411780 AATTCTTTTTCAGGTAAATCAGG - Intergenic
913021714 1:114794707-114794729 AATTATTTTTCTGATGAAATTGG + Intergenic
913207206 1:116550737-116550759 AATTATTCTTCTGATGAATCTGG - Intronic
913493629 1:119405880-119405902 AATTCTTTTTCAGGTAAATCAGG - Intergenic
914346180 1:146800142-146800164 AATTCTTTTTCAGGTAAATCAGG - Intergenic
914927279 1:151899093-151899115 AATTCTTTTTCAGATAAATCAGG - Intronic
914968073 1:152278671-152278693 AATTCTTTTTCAGACAAATCAGG - Intergenic
915720848 1:157984493-157984515 CCTTGTTCTTCTGATGAAACAGG - Intergenic
916388652 1:164305894-164305916 AAAACTTTTTCAGATGAAAAGGG + Intergenic
917319093 1:173759877-173759899 AATTCTTTTTCAGGTAAATCAGG - Intronic
917325409 1:173826353-173826375 ATTTCTTCCTCAAATGAAATAGG - Intronic
917435126 1:175013242-175013264 TAGTCTTCATCAGATGACACAGG + Exonic
917461685 1:175235570-175235592 AATTCTTTTTCAGGTAAATCAGG - Intergenic
917909995 1:179633809-179633831 ACTTCTTGTTCAAATTAAACAGG - Intronic
918370047 1:183851633-183851655 ACATGTTCTGCAGATGAAACAGG + Intronic
919278009 1:195445662-195445684 AATTCTTTTTCAGGTAAATCAGG - Intergenic
921635808 1:217491122-217491144 AATTTTTGTTTAGATGAAAATGG - Intronic
921696700 1:218219369-218219391 AATTCTTCTTCAAAGGAATATGG - Intergenic
922039747 1:221885150-221885172 AATACTTTTTCAGAGGAAATTGG - Intergenic
922395902 1:225201350-225201372 AATTCTTTTTCAGGTAAATCAGG + Intronic
922673271 1:227531679-227531701 AATTCTTTTTCAGATAAATCAGG + Intergenic
922927257 1:229360419-229360441 AATTCTTTTTCAGGTAAATCAGG + Intergenic
923058936 1:230452510-230452532 AATGCTTCTTTAGGAGAAACTGG - Intergenic
923543757 1:234908969-234908991 AATGATTCTTGAGATGAAGCTGG - Intergenic
923661738 1:235962906-235962928 AATTCTTTTTCAGGTCAATCAGG - Intergenic
924302212 1:242651488-242651510 AATTCTTTTTCAGGTAAATCAGG + Intergenic
924455157 1:244213408-244213430 GATTATTCTTCTGATGAAAAGGG - Intergenic
1062981717 10:1728997-1729019 ATTTCTTCTTCAGAAAAAATTGG + Intronic
1063151830 10:3344156-3344178 GATTCTTCTTCAGAGGATCCAGG - Intergenic
1063780920 10:9323093-9323115 AATTCTAGTTCAGATGATCCTGG + Intergenic
1066145409 10:32553400-32553422 AATTCTTTTTCAGGTAAAGCCGG + Intronic
1066703564 10:38155127-38155149 AACTCTACCTCACATGAAACAGG + Intergenic
1066987213 10:42478141-42478163 AACTCTACCTCACATGAAACAGG - Intergenic
1068036662 10:51768212-51768234 AATGCTTGTTTAGATAAAACTGG + Intronic
1068480884 10:57586433-57586455 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1068778708 10:60896401-60896423 GATTCTTTTACAGCTGAAACAGG - Intronic
1069112998 10:64469313-64469335 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1069325391 10:67225877-67225899 AATTCTTTTTCAGGTAAAACAGG - Intronic
1070465032 10:76712479-76712501 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1071405708 10:85329341-85329363 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1071484844 10:86092138-86092160 AATTCTTTTTCAGGTAAATCTGG - Intronic
1072815004 10:98498653-98498675 AATTCTTTTTCAGGTAAATCAGG - Intronic
1072928087 10:99634301-99634323 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1073900370 10:108214407-108214429 AATTCTTTTTCAGGTAAATCGGG + Intergenic
1073960359 10:108919595-108919617 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1074632037 10:115269064-115269086 AACTCTACTTTAGATGAAAAAGG - Intronic
1074985706 10:118658021-118658043 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1075660503 10:124192563-124192585 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1075982644 10:126754871-126754893 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1078706645 11:13749849-13749871 AATTCTTTTTCAGGTAAATCTGG - Intergenic
1079208000 11:18434297-18434319 AATTCTTTTTCAGGTAAACCAGG + Intronic
1079791614 11:24747038-24747060 AATTCTTTTTCAGGTAAATCAGG + Intronic
1080215837 11:29839411-29839433 AATTCTTCTTTATATGATAATGG - Intergenic
1080229531 11:30003505-30003527 AATTCCTCTTGAGAGGAAAATGG - Intergenic
1080672436 11:34394065-34394087 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1082903998 11:58286085-58286107 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1083064473 11:59910347-59910369 AATTCTTTTTCAAGTGAATCAGG + Intergenic
1086082789 11:82922670-82922692 AATTCTTTTTCAGGTAAATCAGG + Intronic
1086300578 11:85422927-85422949 AATTCTTTTTCAGGTAAATCAGG + Intronic
1086822746 11:91454993-91455015 AATTCTTCTTCTGTTGGAAGGGG + Intergenic
1086843557 11:91719466-91719488 ACTTCTCTTCCAGATGAAACTGG + Intergenic
1087494546 11:98873428-98873450 AATACTTCTTTACATGAAAATGG + Intergenic
1088137604 11:106577290-106577312 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1088239633 11:107759696-107759718 GATTCTTTTTCAGATAAATCAGG - Intergenic
1088387947 11:109280919-109280941 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1088730393 11:112676693-112676715 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1090559424 11:127914823-127914845 AATTCTTTTTCAGCTAAATCAGG + Intergenic
1090753144 11:129764650-129764672 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1090916445 11:131168177-131168199 AATTGTTCTTTAGATGGGACTGG + Intergenic
1091072228 11:132578373-132578395 AATTCTGCTACAGATGAAGTAGG + Intronic
1091210413 11:133853795-133853817 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1092622876 12:10292328-10292350 AGTGATTCCTCAGATGAAACTGG - Intergenic
1092894042 12:12996186-12996208 TCTTCATTTTCAGATGAAACTGG + Intronic
1092932422 12:13328898-13328920 AATTCTGGTTCGAATGAAACAGG - Intergenic
1093001933 12:14007099-14007121 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1093010632 12:14102668-14102690 AATTCTTTTTCAGGTAAATCTGG - Intergenic
1093172696 12:15876701-15876723 AATTCTTTTTCAGGTAAATCAGG - Intronic
1093389710 12:18603027-18603049 AATTCTTTTTCAGGTAAATCAGG - Intronic
1093478496 12:19580999-19581021 AGTTCTTGTTCTGATGAGACTGG + Intronic
1093510978 12:19928188-19928210 AATTCTTCTTTGAATGAAATAGG + Intergenic
1093995067 12:25631803-25631825 AATTCTTTTTCAGGTAAATCAGG - Intronic
1094263345 12:28527093-28527115 AATTCTTTTTCAGGTAAATCAGG + Intronic
1094362229 12:29641748-29641770 AATTCTTCTCCAGGTAAATCAGG - Intronic
1094447249 12:30545510-30545532 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1094501422 12:31024016-31024038 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1094718005 12:33032977-33032999 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1094721913 12:33074665-33074687 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1094808656 12:34115642-34115664 AATTATTTTTCAGATTAATCGGG - Intergenic
1095498975 12:42815852-42815874 AATTCTTTCTCAGATGTTACTGG - Intergenic
1095665284 12:44789627-44789649 AATTCTTTTTCAGGTAAATCAGG - Intronic
1095932171 12:47637782-47637804 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1096347991 12:50867137-50867159 AATTCTTTTTCAGTTAAATCAGG - Intronic
1096956957 12:55535502-55535524 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1097066419 12:56323904-56323926 AATTTTCCCTCAGATAAAACTGG - Exonic
1097295607 12:57958891-57958913 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1097385856 12:58949732-58949754 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1098022653 12:66171697-66171719 AGTTTTACTTCAGATGACACTGG + Intergenic
1098960822 12:76738481-76738503 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1099362016 12:81715040-81715062 CATTCTTCTTCATATTAAACTGG + Intronic
1100088022 12:90935932-90935954 AATTCTTTTTCAGGTAAATCAGG + Intronic
1100203486 12:92324735-92324757 CATTCTTTTTCAGATAAATCAGG + Intergenic
1101635156 12:106534789-106534811 AATTCTTTTTCAGGTAAATCAGG + Intronic
1102916628 12:116759346-116759368 AATTCTTTTTCAGGTAAATCAGG + Intronic
1103760997 12:123250358-123250380 AATTCTTTTTCAGGTAAATCAGG + Intronic
1105076464 13:16032658-16032680 GAATCTTCTTCACATGAAAACGG + Intergenic
1105078281 13:16067725-16067747 GAATCTTCTTCACATGAAAACGG + Intergenic
1105078683 13:16075386-16075408 GAATCTTCTTCACATGAAAACGG + Intergenic
1105314549 13:19244967-19244989 AATTCATTTTCAGGTAAAACAGG - Intergenic
1105357998 13:19677408-19677430 AATTTGTCTTCAGGTAAAACTGG - Intronic
1105930872 13:25050171-25050193 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1107184942 13:37506515-37506537 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1107291158 13:38855548-38855570 AATTTTCCTTCAGATAAAATCGG + Intronic
1107666124 13:42693148-42693170 AATTCTTTTTCAGCTCAATCAGG + Intergenic
1108697974 13:52919779-52919801 AATTCTTCTTCAGGGAAACCTGG - Intergenic
1108976473 13:56450394-56450416 AATTCTTCTGCATAGGAAATTGG + Intergenic
1109213471 13:59562365-59562387 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1109434595 13:62283304-62283326 AACTCATCTTCAGATGAGGCTGG - Intergenic
1110561974 13:76918760-76918782 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1110748188 13:79080244-79080266 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1110852515 13:80261989-80262011 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1111988551 13:95090784-95090806 AATTCTTTTTCAGGTAAATCAGG - Intronic
1112035243 13:95491651-95491673 AATTCTTTTTCAGGTAAATCCGG + Intronic
1112720444 13:102237521-102237543 AATACTCCTTCTGCTGAAACAGG - Intronic
1113357337 13:109593994-109594016 AATCCTTCTTGAGTTTAAACAGG - Intergenic
1114902666 14:27084349-27084371 AATCCATCTTGAAATGAAACAGG + Intergenic
1115159034 14:30372092-30372114 AATTCAAGTTCAGAGGAAACTGG + Intergenic
1115350537 14:32390335-32390357 AATTCTTTTTCAGGTAAATCAGG + Intronic
1115527127 14:34292730-34292752 AATTCTTTTTCAGGTAAATCAGG + Intronic
1115680420 14:35731388-35731410 AATTCTTTTTCAGGTAAATCAGG - Intronic
1116048930 14:39780481-39780503 AATTCTTTTTCAGGTAAAGCAGG + Intergenic
1117510678 14:56448125-56448147 AATTCTTTTTCAGATAAGTCAGG + Intergenic
1117639942 14:57786918-57786940 AATTCTTCTTCAGGCAAATCTGG - Intronic
1117895189 14:60477111-60477133 AATTCTTTTTTAAATGAAGCAGG + Intronic
1118532003 14:66717492-66717514 AATTCTTTTTCAGGTAAATCAGG + Intronic
1119040659 14:71271505-71271527 ATTTCTTCTTCCTCTGAAACAGG - Intergenic
1119599334 14:75964454-75964476 CCTTTTTTTTCAGATGAAACGGG - Intronic
1119914846 14:78388501-78388523 AATTCATGTTCATATGGAACAGG + Intronic
1120939848 14:89937239-89937261 GATTCTTCTTTATATGAAAATGG + Intronic
1121334302 14:93068064-93068086 AATACAGCTACAGATGAAACTGG - Intronic
1121503364 14:94458012-94458034 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1121516474 14:94555695-94555717 AATTCTTTTTCAGATAAATCAGG + Intergenic
1121652063 14:95566057-95566079 AGTTATGCTTCAGGTGAAACTGG + Intergenic
1123104113 14:105829876-105829898 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1124380839 15:29163317-29163339 AATTCTTTTTCAGGTAAATCAGG - Intronic
1124701622 15:31918443-31918465 AATTTTTCTCCATATTAAACTGG - Intergenic
1125055827 15:35358367-35358389 AATTCTTTTTCAGGTAAATCAGG + Intronic
1125237056 15:37527261-37527283 GAATCTTCTGTAGATGAAACAGG - Intergenic
1126004775 15:44245710-44245732 AAGACTTCCTCAGATCAAACTGG - Intergenic
1126907651 15:53384956-53384978 CACTCTCCTTCAGATGGAACAGG + Intergenic
1127008096 15:54593815-54593837 AATTCTTTTTCAGGTGAATCAGG + Intronic
1127342165 15:58058635-58058657 AATTCTTCTAGATAAGAAACAGG + Intronic
1129148485 15:73671300-73671322 GATTCTTCTTAAGAAGAAAAGGG - Intergenic
1130779691 15:87022320-87022342 AATTCTTTTTCAGGTAAATCAGG - Intronic
1132033496 15:98458621-98458643 AATTCTTTTTCAGGTAAATCAGG - Intronic
1133953068 16:10414561-10414583 AATTCTTTTTCAGGTAAATCAGG + Intronic
1137266757 16:46875213-46875235 ATTCATTCTTCAGAAGAAACGGG - Intergenic
1137499138 16:48997219-48997241 ATTTCTTGTTCACATGAACCTGG + Intergenic
1138881131 16:61015555-61015577 AATTCTTTTTCAGGTAAATCTGG - Intergenic
1139543572 16:67637043-67637065 ACTTCTTCTTGAAATGTAACAGG - Intronic
1139761916 16:69191056-69191078 TATTCTTCTTCAGGTAAAAATGG - Intronic
1139987799 16:70915125-70915147 AATTCTTTTTCAGGTAAATCAGG + Intronic
1140619919 16:76717229-76717251 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1140855247 16:78972159-78972181 ACTTCATTTCCAGATGAAACTGG + Intronic
1143990944 17:10960585-10960607 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1144050011 17:11490405-11490427 AATTCTCCTGCCGATGAAACAGG + Intronic
1146746546 17:35335629-35335651 AATTCTTTTTCAGATACATCAGG + Intergenic
1147856605 17:43485130-43485152 AAGGCTTCTTCAGTTGTAACAGG + Intronic
1148321189 17:46754737-46754759 AAATCATCTCCAGATGAATCTGG - Intronic
1148616807 17:49006920-49006942 AATTGTTCTTTAGGGGAAACAGG + Intronic
1149161789 17:53702565-53702587 AATTTTTCTTCAGAAGTAACAGG + Intergenic
1149192165 17:54076131-54076153 AATGATTCTGCAGATGAATCTGG + Intergenic
1149376064 17:56045386-56045408 ACTGCTTCCTCAGAGGAAACAGG - Intergenic
1149410793 17:56404646-56404668 AATTCTTTTTCAGGTAAATCAGG + Intronic
1150539060 17:66077206-66077228 AATTCTTTTTCAGGTAAATCAGG - Intronic
1150818664 17:68416956-68416978 AATTCTTTTTCAGGTTAATCAGG + Intronic
1150945575 17:69742515-69742537 AATTCTTTTTCAGGTAAAAAGGG + Intergenic
1151583484 17:74993797-74993819 ACTCCTTCTCCAGATGACACAGG + Intronic
1152036216 17:77874722-77874744 CATTCTTCCTAAGAGGAAACAGG - Intergenic
1153965822 18:10181431-10181453 AATTCTTTTTCAGGTGAATCAGG + Intergenic
1155278435 18:24212879-24212901 AATTCTGCTTCTGTTGAAATGGG - Intronic
1155779909 18:29818105-29818127 AAATATTCTTCAGAAAAAACAGG - Intergenic
1156011264 18:32500690-32500712 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1156687980 18:39672898-39672920 AATTTTTTTTTAGAAGAAACAGG - Intergenic
1157218703 18:45807882-45807904 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1157540972 18:48506199-48506221 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1157863712 18:51163408-51163430 AATTATTCATCAGTTGAAAGTGG - Intergenic
1158829872 18:61264821-61264843 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1159301263 18:66572229-66572251 TATTACTCTTCAGAGGAAACAGG + Exonic
1160219642 18:76965372-76965394 AATTCTTTTTCAGGTAAATCAGG + Intronic
1163301618 19:16450918-16450940 AATGTTGCTTCAGAGGAAACTGG + Intronic
1164102367 19:22068415-22068437 GATTCTTGGTCAGATCAAACTGG - Intronic
1164359348 19:27485518-27485540 AAATATGCTTCAGATAAAACAGG + Intergenic
1164996349 19:32722214-32722236 ATTTCTTCTTTAGAAGAGACAGG + Intronic
1168454035 19:56491150-56491172 AAATATTCTTCAGATGACTCTGG + Intergenic
925127365 2:1469193-1469215 AATTCTTTTTCAGGTAAATCAGG + Intronic
925343431 2:3152168-3152190 AATTCTTTTTCAGGTGAATCAGG - Intergenic
925354067 2:3224825-3224847 AGTTCCTCTTCAGATGTAACAGG - Intronic
926552048 2:14312684-14312706 AGTTTTTCTACAGATGAAGCTGG - Intergenic
927363382 2:22264108-22264130 AATTCTTTTTCAGGTAAATCGGG + Intergenic
928214843 2:29352656-29352678 AATTCCTCTGCAGATGGATCTGG - Intronic
928566293 2:32554053-32554075 AATACTTCTTAAAATGAAACAGG - Intronic
928907716 2:36384924-36384946 ACTTCCACTTAAGATGAAACTGG + Intronic
928963392 2:36952978-36953000 AATTTTCCATCAGGTGAAACTGG + Intronic
929722795 2:44388492-44388514 AATTCTTTTTCAGGTAAATCAGG + Intronic
930352386 2:50273638-50273660 AATTTTTCTTAAGATGTATCAGG - Intronic
930486394 2:52017103-52017125 AATTCTTTTTCAGTTAAATCAGG + Intergenic
931136893 2:59413571-59413593 AATTCTTTTTCAGGTAAATCAGG + Intergenic
931465805 2:62485894-62485916 AAATCTTCTTGAAATGACACAGG - Intergenic
931525106 2:63144742-63144764 AATTCTTTTTCAGGTAAATCAGG + Intronic
931547990 2:63409553-63409575 AATTCTTTTTCAGGTAAATCAGG - Intronic
932100547 2:68895918-68895940 AATTCTTTTTCAGGTAAATCAGG + Intergenic
933121471 2:78542659-78542681 AATTCTTCTGCAGGTAAATCAGG - Intergenic
933873488 2:86594198-86594220 ACTTCTTGTGCAGATGATACTGG + Intronic
935131898 2:100266868-100266890 AATCCATCTTAAGATGAAAGTGG - Intergenic
936164560 2:110108189-110108211 AATTCTTTTTCAGGTGAATCAGG - Intronic
936843733 2:116804729-116804751 AATTCTTTTTGAGGTAAAACAGG + Intergenic
936983687 2:118288117-118288139 AATTCTTTTTCAGAAGATATGGG + Intergenic
937069144 2:119049625-119049647 AATTCTTTTTCAGGTAAATCAGG + Intergenic
937263202 2:120599529-120599551 AATTCTACGTAAGATGAAAATGG - Intergenic
937521900 2:122721648-122721670 AATTCTTTTTCAGGTAAATCAGG - Intergenic
937529391 2:122809516-122809538 AATTCTTTTTCAGGTTAATCAGG - Intergenic
939998778 2:148946732-148946754 CATTGTTTTTCAGAAGAAACAGG + Intronic
940034606 2:149301050-149301072 AATTCTTTTTCAGGTAAATCAGG + Intergenic
940802325 2:158146112-158146134 AATTCTTTTTCAGATAAATCAGG - Intergenic
941614833 2:167707474-167707496 AATTCTTCTGCAGAGTATACAGG - Intergenic
941631508 2:167890443-167890465 AATTCTTTTTCAGGTAAATCAGG + Intergenic
941710381 2:168705593-168705615 AAGTCTTCTTCAGGTCAACCAGG - Intronic
941943044 2:171064003-171064025 AATTCTGCCTCAGAGGAAAAAGG - Intronic
942470003 2:176250480-176250502 AATTCTTTTTCAGGTAAATCGGG + Intergenic
943086705 2:183320953-183320975 AAATCCTCTACACATGAAACAGG - Intergenic
943199293 2:184798719-184798741 AATTCTTTCTCAGATAAATCAGG + Intronic
943891184 2:193289555-193289577 AATTCTTTTTCAGGTAAATCAGG + Intergenic
944360557 2:198850586-198850608 ATTTCTACTTCAGTTGAAAGAGG - Intergenic
944431970 2:199644027-199644049 AATTCTTTTTCAGGTAAATCAGG + Intergenic
944864422 2:203846812-203846834 ACTTGTTTTTCAGAGGAAACAGG + Intergenic
945132005 2:206583843-206583865 AATTCTTTTTCAGGTAAATCAGG + Intronic
945339117 2:208630716-208630738 AATTCTTCTTCAGATGAAACTGG - Intronic
945365770 2:208951658-208951680 AATTTTTTTTTAGATGAAAGGGG - Intergenic
945681333 2:212917455-212917477 AAATCCACTTCAGTTGAAACTGG - Intergenic
945806235 2:214493193-214493215 AAATATTCTTCTGATGTAACAGG - Intronic
946501402 2:220250883-220250905 AATTCTTTTTCAGGTAAATCAGG - Intergenic
947323043 2:228944054-228944076 AAATCTACTTCAGTTGAAAGTGG + Intronic
948714146 2:239848098-239848120 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1170026533 20:11894595-11894617 CAATCTTCTTTAGATAAAACGGG - Intronic
1170133643 20:13050090-13050112 AATTCTTTTTCAGGTAAATCAGG - Intronic
1170664449 20:18374954-18374976 AATTCTTCTTTAGATTTAATTGG - Intergenic
1171081484 20:22190259-22190281 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1171470198 20:25364233-25364255 AATTTATCTTCAGATGACAAAGG + Intronic
1174897851 20:54469647-54469669 AATTCTACTTCAGATAAGAGAGG - Intergenic
1175069187 20:56317228-56317250 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1176533818 21:8010457-8010479 GAATCTTCTTCACATGAAAACGG - Intergenic
1176534023 21:8014367-8014389 GAATCTTCTTCACATGAAAACGG - Intergenic
1176534537 21:8024577-8024599 GAATCTTCTTCACATGAAAACGG - Intergenic
1176534709 21:8027816-8027838 GAATCTTCTTCACATGAAAACGG - Intergenic
1176534883 21:8031055-8031077 GAATCTTCTTCACATGAAAACGG - Intergenic
1177131893 21:17267894-17267916 AATTCCTCTTCAGATGTAGATGG + Intergenic
1177176573 21:17705749-17705771 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1177610431 21:23440435-23440457 AACTCTTCTTCAGAGTTAACAGG - Intergenic
1177847448 21:26306691-26306713 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1177972026 21:27801863-27801885 AATTCTTCATGGGATGAAAGTGG + Intergenic
1178059495 21:28835642-28835664 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1183048253 22:35239737-35239759 AATTGTTTTTCAGATAAATCAGG + Intergenic
1183610753 22:38902722-38902744 AATTATTTTTCTGATGAAATTGG - Intergenic
1183852541 22:40602893-40602915 ATTTCTTCTTCACAAAAAACTGG + Intronic
1183883990 22:40861528-40861550 AAATTTTCTTCATATGATACAGG - Exonic
1184322163 22:43750473-43750495 ATATTTTCTTCAGATGAAAGAGG + Intronic
949814372 3:8041794-8041816 AATTCTTTTTCAGGTAAATCAGG - Intergenic
950592292 3:13947193-13947215 AATTCTTTTTCAGGTAAATCAGG + Intronic
951114356 3:18842710-18842732 AACTCTTTTTCAGCTGAAGCAGG - Intergenic
951764125 3:26178437-26178459 AATTCTTTTTCAGGTAAATCAGG + Intergenic
951852015 3:27151660-27151682 AATTCTTTTTCAGGTAAATCAGG - Intronic
952689739 3:36191446-36191468 AATTCTTTTTCAGGTAAATCAGG + Intergenic
953723836 3:45380860-45380882 AATTCTTTTTCAGGTAAATCAGG + Intergenic
955175520 3:56610555-56610577 AATTCTTTTTCAGGTAAATCAGG + Intronic
955456189 3:59124572-59124594 AATTCTTCTGGAGATGACAAAGG + Intergenic
955461506 3:59188985-59189007 AATTCTTTTTCAGGTAAATCAGG + Intergenic
955480913 3:59388960-59388982 AATTCTGCTCCAGATGCAATAGG - Intergenic
955702849 3:61699189-61699211 AATTATTTTTCAGATGAGATCGG + Intronic
955859986 3:63318744-63318766 AATTCTTTTTCAGGTAAACCAGG + Intronic
956561864 3:70587147-70587169 AAGTATTCTTCAGATGAAAAAGG - Intergenic
957681304 3:83439724-83439746 AATTTTTCTTGAGAAGAATCTGG + Intergenic
958969825 3:100599958-100599980 AATTCTTTCTCAGATAAATCAGG + Intergenic
959039584 3:101405582-101405604 AATTCTTTTTCAGGTAAATCAGG - Intronic
959279876 3:104324132-104324154 AATTCTTTTTCAGGTAAATCAGG - Intergenic
959436243 3:106318045-106318067 AATTCTTTTTCAGGTAAATCAGG - Intergenic
959756867 3:109910160-109910182 AATTCTTTTTCAGGTAAATCAGG + Intergenic
959937461 3:112044242-112044264 TATTCTTTTTCAGATAAACCTGG + Exonic
960512743 3:118570975-118570997 AATTCTTTTTCAGGTAAATCAGG + Intergenic
962065906 3:131980683-131980705 AATTCTTTTTCAGGTTAATCAGG + Intronic
962401740 3:135066684-135066706 AATTCTTTTTCAGGTAAATCAGG + Intronic
962407159 3:135110262-135110284 ATTTCTTCTTCAAATGCAATGGG + Intronic
962504840 3:136036204-136036226 AATTCTTTTTCAGGTAAATCAGG + Intronic
962999463 3:140664597-140664619 AATTCTTTTTCAGGTAAATCAGG - Intergenic
963213293 3:142717700-142717722 AATTCTTTTTCAGGTAAATCAGG - Intergenic
963591153 3:147261323-147261345 AAACCTTCTACAGATGAAAGAGG - Intergenic
963974912 3:151469523-151469545 AATTCTGCTTCAGGAGAATCAGG - Intergenic
964211271 3:154231026-154231048 GTTTATTCTGCAGATGAAACAGG - Intronic
964518314 3:157536891-157536913 AATTCTTTTTCAGGTAAATCAGG + Intergenic
965052619 3:163670664-163670686 AATTCTTTTTTAGATAAATCAGG + Intergenic
965321773 3:167260815-167260837 AATTCTTTTTCAGGTAAATCAGG + Intronic
965611441 3:170548081-170548103 AATACTTCTTCATATGGAAATGG - Intronic
965874274 3:173298772-173298794 AATTCTTTTTCAGGTAAATCAGG + Intergenic
966122523 3:176537721-176537743 AATTCTTTTTCAGGTAAATCAGG - Intergenic
966212232 3:177465230-177465252 AATTTTTCTTCATAGGAAATTGG + Intergenic
966799973 3:183754107-183754129 AATCCTGCTTGAGATGAAAGAGG - Exonic
967257413 3:187608318-187608340 AATTCTTTTTCAGGTAAATCAGG + Intergenic
967823140 3:193856963-193856985 AGTTCTTATTCAAATGAAAGGGG + Intergenic
968125552 3:196157400-196157422 AATTCTTTTTCAGGTAAACCAGG + Intergenic
968720646 4:2200869-2200891 AATTCTTTTTCAGGTAAATCAGG - Intronic
969903249 4:10369590-10369612 CATTCTTCCTCAGATGACAGAGG + Intergenic
969958924 4:10922636-10922658 TATTCTACTTCAAATGAAAGAGG + Intergenic
970217414 4:13774556-13774578 AATTCTTTTTCAGGTAAATCAGG + Intergenic
970312164 4:14793804-14793826 AATTCTTTTTCAGGTAAATCAGG - Intergenic
970526588 4:16938683-16938705 CATCCATCTTCAGATCAAACTGG + Intergenic
970549194 4:17162900-17162922 AATTCTTTTTCAGGTAAATCAGG + Intergenic
971132347 4:23826786-23826808 AAATTTTCTTTAGATGAGACTGG - Intronic
971803339 4:31320922-31320944 AAGTCTAACTCAGATGAAACTGG - Intergenic
972110517 4:35552737-35552759 ATTTCTTCTTCTGATAAATCTGG + Intergenic
972188962 4:36567924-36567946 AATTCTTTTTCAGGTAAATCAGG + Intergenic
972480033 4:39488125-39488147 AATTATTCTCCAAATGAAACGGG + Intergenic
973069052 4:45834999-45835021 AATTCTTTTTCAGGTAAATCAGG + Intergenic
973690847 4:53429486-53429508 AATTCTTTTTCAGAGGACAAAGG - Intronic
973956510 4:56068434-56068456 ACTTTTACTTCAGATGAGACAGG + Intergenic
974951077 4:68583254-68583276 AATTCTTTTTCAGGTAAATCAGG - Intronic
974996636 4:69168315-69168337 AATCCTTCTTCATATGTATCTGG - Intronic
975009612 4:69333253-69333275 AATCCTTCTTCATATGTATCTGG - Intronic
975034076 4:69659197-69659219 AATTCTTTTTCAGGTAAATCAGG - Intergenic
975190985 4:71462015-71462037 AATTAGTCTTCAGAAGAAACAGG - Intronic
975290115 4:72667856-72667878 AATCCTTCTACAGAAGAAAGTGG - Intergenic
976295360 4:83465835-83465857 ACTACTTTTTCATATGAAACGGG - Intronic
976856595 4:89610930-89610952 AATTCTTTTTCAGGTAAATCAGG - Intergenic
976963000 4:91002734-91002756 AATTCTTTTTCAGGTAAATCAGG + Intronic
979498334 4:121410659-121410681 AATTCTTTTTTAGATAAATCAGG + Intergenic
979561764 4:122108942-122108964 AATTCTTTTTCAGGTAAATCAGG - Intergenic
980153109 4:129072788-129072810 AATTCTTATTCAGGTAAATCAGG + Intronic
980797656 4:137705642-137705664 ACTTCCTCTTCAAATGATACCGG - Intergenic
981626077 4:146757018-146757040 AATTCTTTTTCAGGTAAATCAGG + Intronic
981695836 4:147557924-147557946 AATTTTTCTTCAGTGGCAACAGG - Intergenic
981701156 4:147608781-147608803 AGTTCTTCTTCAGAGGCAACTGG + Intergenic
981760680 4:148191973-148191995 AATTCTTTTTGAGATAAATCAGG + Intronic
981824945 4:148929261-148929283 AATTCTTTTTCAGATAAATCAGG - Intergenic
981829492 4:148984116-148984138 AATTCTTCTGTAGATAAGACAGG - Intergenic
982075109 4:151730930-151730952 AATTCTTTTTCAGGTAAATCAGG - Intronic
982189824 4:152842905-152842927 AATTCTTTTTCAGATAAATCAGG + Intronic
982218660 4:153106340-153106362 AATTCTTTTTCAGGTAAATCAGG + Intergenic
983752341 4:171290684-171290706 AATTCTTTTTAAAATGAAATCGG + Intergenic
984153537 4:176164984-176165006 AAGTCATCATCAGATGAAAGGGG + Intronic
984266589 4:177504763-177504785 AATTCTTTTTCAGGTAAATCAGG + Intergenic
984323681 4:178225068-178225090 AATTCTTTTTCAGGTAAATCAGG - Intergenic
984331592 4:178327583-178327605 ACTTCTTCTCCAGATCATACTGG - Intergenic
984721798 4:182979076-182979098 AATTCTTTTTCAGGTAAATCAGG - Intergenic
984764278 4:183387621-183387643 ACTTTTTCTTTAGATGAAAAAGG + Intergenic
985120490 4:186636123-186636145 AATGATTCTTCAAATGAAATGGG + Exonic
985217629 4:187671227-187671249 AATTCTTTTTCAGGTAAATCAGG + Intergenic
985240691 4:187928746-187928768 AATTCTTTTTCAGGTAAATCAGG + Intergenic
986831371 5:11582705-11582727 TATTCTTCTACAGATGGAAGAGG + Intronic
988869837 5:35376960-35376982 TATTCTTGTTCAAAAGAAACAGG - Intergenic
988902338 5:35746323-35746345 AATTCTTTTTCAGATAAATCAGG - Intronic
988989778 5:36659094-36659116 AATTCTTCTTCACACTAGACTGG - Intronic
989027404 5:37083433-37083455 AATTCTTTTTCAGGTAAATCAGG - Intergenic
990233443 5:53739993-53740015 AATTCTTTTTCAGGTAAATCAGG - Intergenic
990827663 5:59920478-59920500 AAACCTTCTTCAGCTGAAACAGG + Intronic
992520261 5:77543309-77543331 AATTCTTTTTCAGGTAAATCAGG - Intronic
993250228 5:85512609-85512631 AATTCTTTTTCAGGTAAATCAGG + Intergenic
993883775 5:93394079-93394101 AATTCTTTTTCAGGTAAATCAGG + Intergenic
993917164 5:93756879-93756901 AATTCTTTTTCAGGTAAATCAGG - Intronic
994051199 5:95364990-95365012 AATTCTTTTTCAGATAAATCAGG + Intergenic
994527457 5:100924858-100924880 AATTCTTTTTCAGGTAAATCAGG + Intergenic
995004199 5:107171233-107171255 AATTCTTATACAGTTGAATCTGG - Intergenic
995472896 5:112522602-112522624 AATTCTTTTTCAGGTAAATCAGG + Intergenic
996010862 5:118479863-118479885 AATTCTTTTTCAGGTAAATCAGG - Intergenic
996031916 5:118714776-118714798 AATTCTTTTTCAGGTAAATCAGG - Intergenic
996160760 5:120160766-120160788 ATTTGTTCTTTAGATGAGACTGG - Intergenic
996288830 5:121828325-121828347 AATTCTTTTTCAGGTAAATCAGG + Intergenic
996325518 5:122268173-122268195 AATTCTTTTTCAGGTAAATCAGG - Intergenic
996504684 5:124256534-124256556 AATTCTTTTTCAGGTAAATCAGG + Intergenic
998777376 5:145618168-145618190 AATTCTTCTTCAGGTAAATCAGG + Intronic
998940966 5:147281259-147281281 AATTCTTTTTCAGGTAAATCAGG - Intronic
999469682 5:151842385-151842407 AATTCTTTTTCACATGTCACTGG - Intronic
999617438 5:153439231-153439253 ATTTCCTCTTCACATGAAATAGG + Intergenic
999677202 5:154015776-154015798 AATTCTTTTTCAGTTGAATCAGG - Intronic
999818730 5:155202758-155202780 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1000757804 5:165183469-165183491 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1000779763 5:165465686-165465708 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1001177042 5:169480250-169480272 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1001290809 5:170457849-170457871 AATTCTTTTTCAGGTGAAACAGG - Intronic
1003063262 6:2878437-2878459 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1003450997 6:6231079-6231101 AATTCTTTTTCAGGTAAATCAGG - Intronic
1003582070 6:7348570-7348592 AATTCTTTTTCAGGTAAATCAGG - Intronic
1005305638 6:24511817-24511839 AATTCTTTTTCAGGTAAATCAGG + Exonic
1005852397 6:29831348-29831370 AATTTTTCTTCTGATAACACAGG - Intergenic
1006727394 6:36209944-36209966 AATTCTTCTTGAACTGGAACAGG + Intronic
1007230284 6:40343401-40343423 AATTCCTCTTAAGATTAAATGGG + Intergenic
1007804499 6:44430251-44430273 GATTCCTCTTCAGAGAAAACAGG - Intronic
1008115623 6:47546010-47546032 AATTCTTTTTCAGGTAAATCAGG - Intronic
1008866663 6:56219976-56219998 AACTCTTTTTCTGAAGAAACAGG - Intronic
1008973476 6:57397652-57397674 AATTCTTTTTCAGGTGAATCAGG + Intronic
1009162381 6:60299196-60299218 AATTCTTTTTCAGGTGAATCAGG + Intergenic
1009557611 6:65194029-65194051 AATTCTTCATCTGATGAGATAGG + Intronic
1009968945 6:70605650-70605672 AATTCTTTTTCAGGTAAATCGGG - Intergenic
1010707656 6:79134370-79134392 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1010787363 6:80020174-80020196 AATTATTTTTCTGATGAAATTGG + Intronic
1011133029 6:84072060-84072082 AATTCTTTTTCAGGTAAATCAGG + Intronic
1011328963 6:86183175-86183197 AATTCTTTTTCAGGTAAACCAGG + Intergenic
1011789616 6:90884797-90884819 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1012131938 6:95506134-95506156 AATTCTACTTTAGATCAAATGGG + Intergenic
1012156063 6:95820657-95820679 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1012208263 6:96488734-96488756 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1012581280 6:100873043-100873065 AATTCTTTTTCAGGTAAATCAGG - Intronic
1012737935 6:102974387-102974409 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1013900899 6:115155514-115155536 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1014304728 6:119726797-119726819 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1014336933 6:120148134-120148156 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1014620827 6:123665015-123665037 AATTCTTCTTCAGAGATAACAGG + Intergenic
1015362252 6:132354139-132354161 AATTCTTCTTCAGGTTAATCAGG + Intronic
1015849680 6:137559449-137559471 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1016585778 6:145683107-145683129 AATTCACCTTCACATGAAACTGG - Intronic
1016746204 6:147582583-147582605 AGTCCTTCTGCAGATGAGACTGG - Intronic
1017168512 6:151433145-151433167 TATTCTTCTTCAGGTAAGACAGG - Exonic
1017207547 6:151819773-151819795 AATTTTTCCACAGATGGAACTGG - Intronic
1017215315 6:151900428-151900450 AATTCTTTTTCAGGTGACTCAGG + Intronic
1017216944 6:151919352-151919374 AATTTTTCTTTAAATGAAAAAGG - Intronic
1018665745 6:166135805-166135827 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1020635013 7:10685701-10685723 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1021879521 7:25080896-25080918 ATCCCTTCTTTAGATGAAACAGG - Intergenic
1022777599 7:33544186-33544208 AATTCTTTTTCAGGTAAATCAGG + Intronic
1022780788 7:33580671-33580693 AAATTTTTTACAGATGAAACTGG + Intronic
1023342769 7:39239487-39239509 AATGCTGCTACAGATGATACTGG + Intronic
1023748862 7:43350852-43350874 AATTCTTTTTCAGGTAAATCAGG + Intronic
1024917112 7:54514551-54514573 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1025059598 7:55793948-55793970 AACTCTATTTCACATGAAACTGG + Exonic
1025772896 7:64529316-64529338 AATTCTTTTTCAGGTAAAACAGG - Intronic
1026190217 7:68118778-68118800 ATTTCTTCTAGAGATTAAACAGG - Intergenic
1027295487 7:76764874-76764896 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1027328922 7:77070979-77071001 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1027417540 7:77989545-77989567 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1028182842 7:87746959-87746981 AATTCTTTTTCAGGTAAATCAGG + Intronic
1028934460 7:96449594-96449616 AATTCATGTTCAAATGCAACAGG + Intergenic
1028936758 7:96473746-96473768 AATTCTTTTTCAGGTAAATCGGG + Intergenic
1028962120 7:96761140-96761162 AATTCTTTTTCAGGTAAACCAGG + Intergenic
1030146936 7:106366423-106366445 TCTTCTTATTCAAATGAAACTGG + Intergenic
1030325318 7:108212400-108212422 AATTCTTTTTCAGGTAAATCAGG - Intronic
1031587436 7:123549341-123549363 AACTCTTCTTTGGTTGAAACTGG + Intronic
1033378987 7:140794038-140794060 AAGTCATCTTCAAATGAAAATGG - Intronic
1033714017 7:143981042-143981064 CATTCTTCTTCTGATCAGACTGG + Intergenic
1033822846 7:145154729-145154751 AATTCTTTTTCAGATAATTCAGG + Intergenic
1035825321 8:2638990-2639012 AATTCTTCTTCCTTTGAATCTGG + Intergenic
1036552916 8:9831016-9831038 CTTTCATCTTTAGATGAAACAGG + Intergenic
1036591970 8:10176570-10176592 AAGTCTTCTGCTGCTGAAACAGG - Intronic
1037713493 8:21375845-21375867 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1038054968 8:23849636-23849658 GATGCTACTTCAGATGAAATAGG + Intronic
1038593847 8:28867249-28867271 AATTTTTTTTCAGTTGAGACAGG - Intronic
1039095441 8:33880212-33880234 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1039268609 8:35855385-35855407 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1039361934 8:36885922-36885944 CTTTCTTCTTCAGGTGATACAGG - Intronic
1039421783 8:37449658-37449680 ACTTCAGCCTCAGATGAAACAGG - Intergenic
1039810390 8:41043288-41043310 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1041570432 8:59332401-59332423 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1042088715 8:65134600-65134622 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1042467015 8:69140132-69140154 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1042893280 8:73636473-73636495 AATTATTCAACATATGAAACAGG + Intronic
1043048156 8:75353092-75353114 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1043071605 8:75642925-75642947 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1043270813 8:78330420-78330442 AATTCTTTTTCAGGTGAATCAGG - Intergenic
1045779936 8:105850480-105850502 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1045994296 8:108343997-108344019 AATTCTTTTTCAGGTAAATCAGG - Intronic
1046074518 8:109300255-109300277 AATTCTTTTTCAGGTAAATCAGG - Intronic
1046764529 8:118055476-118055498 AATTCTTCTTCAGATAGAGGTGG - Intronic
1047260449 8:123253986-123254008 ACTTCTCCTGCAGATGAATCTGG - Exonic
1047504865 8:125471094-125471116 AATTCTTTGCAAGATGAAACTGG - Intergenic
1049295873 8:141837361-141837383 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1050175573 9:2866533-2866555 AATTCTGCTGTAGATGAAATAGG + Intergenic
1050502803 9:6315978-6316000 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1051030470 9:12669114-12669136 AAGTCTTCTTCACATGGATCTGG + Intergenic
1051757276 9:20416479-20416501 AATCCTTCTTTAGAACAAACTGG + Intronic
1052194629 9:25696329-25696351 AACTCTTCTCCAGTTCAAACCGG + Intergenic
1052246988 9:26347720-26347742 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1052731348 9:32290558-32290580 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1053238175 9:36474620-36474642 ACTTATTGTACAGATGAAACTGG - Intronic
1053674833 9:40413302-40413324 GATTCTTATTCAGTTGAAATGGG - Intergenic
1053924625 9:43039663-43039685 GATTCTTATTCAGTTGAAATGGG - Intergenic
1054385937 9:64553369-64553391 GATTCTTATTCAGTTGAAATGGG - Intergenic
1054509787 9:65962991-65963013 GATTCTTATTCAGTTGAAATGGG + Intergenic
1054867675 9:70019729-70019751 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1055424652 9:76181685-76181707 AATTGTGCTTCATATCAAACAGG + Intronic
1055500790 9:76900618-76900640 AAGTCTTCTTGAAAGGAAACTGG - Intronic
1055700934 9:78945206-78945228 AATTTTTTTGAAGATGAAACAGG - Intergenic
1056340024 9:85619967-85619989 AATTCTTTGTCAGATAAGACAGG - Intronic
1056977555 9:91273026-91273048 AATTCTTCTTCAGCTAAAGTTGG - Intronic
1057369986 9:94462685-94462707 ATTCCTTCTCCAGATGGAACTGG + Intergenic
1058156615 9:101523721-101523743 AATTCTTTTTCAGGTAAATCAGG + Intronic
1058379859 9:104365468-104365490 AATTCCTCAGCATATGAAACTGG + Intergenic
1058623094 9:106904903-106904925 AATTCTTTTTCAGATAAATCAGG + Intronic
1058770777 9:108229006-108229028 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1059048313 9:110895075-110895097 AATTCTTTTTCAAATGAGATTGG - Intronic
1061716856 9:132523792-132523814 AATTCATCTTCCAATGAAATTGG - Intronic
1062705180 9:137934983-137935005 AATTCTTTTTCAGGTAAATCCGG - Intronic
1186544083 X:10430630-10430652 AATTTTCATTCAGATGAAATGGG + Intergenic
1187681527 X:21771712-21771734 AATTCTTTTTCAGATAAATCAGG - Intergenic
1188045779 X:25425345-25425367 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1188339776 X:28984979-28985001 AATTTTTCATCAGATCAAAGAGG - Intronic
1188445459 X:30249458-30249480 AATTCCTCTTCAGAAGTAACAGG + Intronic
1188737893 X:33741409-33741431 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1189999990 X:46676659-46676681 AACTCTTCTTCAGATCAAATGGG - Intronic
1190895363 X:54613420-54613442 AACTCTTTTTCAGATAAATCAGG + Intergenic
1191080744 X:56506762-56506784 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1192820329 X:74637807-74637829 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1192880992 X:75284282-75284304 AATTCCTCTTCAGGTAAATCAGG + Intronic
1192929687 X:75792561-75792583 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1193156971 X:78184006-78184028 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1193389818 X:80913427-80913449 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1193420918 X:81280824-81280846 AATTCTTTTTCAGGTAAATCAGG - Intronic
1193680873 X:84517959-84517981 AATTCTTTCTCAGATAAATCAGG + Intergenic
1193754659 X:85393591-85393613 AGTTCTTTTTCTCATGAAACTGG - Intergenic
1194314078 X:92352472-92352494 AATTCTTTTTCAGGTAAATCAGG + Intronic
1194701373 X:97119038-97119060 AATTCTTTTTCAGGTAAATCAGG + Intronic
1194709760 X:97221088-97221110 AATTCATCTAAAGATGAGACAGG - Intronic
1194882463 X:99271336-99271358 AATTCTTTTTCAGATAAATCAGG + Intergenic
1194926804 X:99835839-99835861 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1195019403 X:100812013-100812035 AATTCTTTTTCAGGTAAACCAGG + Intergenic
1195795570 X:108642914-108642936 AATTCTTTTTCAGGTAAATCAGG - Intronic
1196225070 X:113157198-113157220 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1196590384 X:117480829-117480851 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1196619886 X:117809177-117809199 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1196675638 X:118418173-118418195 AATTCTTTTTCAGGTAAATCAGG + Intronic
1196948165 X:120849575-120849597 AATTCTTTTTCAGGTGAATCAGG + Intergenic
1197132518 X:123020824-123020846 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1197476207 X:126928930-126928952 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1197574170 X:128188734-128188756 AATTCTTTTTCAGTTAAATCAGG - Intergenic
1197589020 X:128384908-128384930 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1197668968 X:129255213-129255235 AATTCTTTTTCTGGTAAAACAGG + Intergenic
1197671531 X:129283684-129283706 AATTCTTTTTCAGGTAAATCAGG + Intergenic
1197953804 X:131924534-131924556 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1198582999 X:138087396-138087418 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1198712587 X:139521696-139521718 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1199521396 X:148740634-148740656 AATTCTTTTTCAGGTAAATCAGG + Intronic
1199636285 X:149815430-149815452 AATTCATCTTGAGTTGAAACTGG - Intergenic
1199644333 X:149891456-149891478 AATCCATCTTGAGTTGAAACTGG - Intergenic
1199668649 X:150121949-150121971 AATTCTTTTTCAGGTAAATCAGG - Intergenic
1200021176 X:153210765-153210787 CATTCTTATCCAGATGAATCGGG + Intergenic
1200737050 Y:6811281-6811303 AATTCTTGTCCTTATGAAACAGG - Intergenic
1200777299 Y:7180865-7180887 ACCTCTTCTGCAGATGAACCAGG + Intergenic
1201322419 Y:12714776-12714798 AATTCATACTCAGATGTAACAGG - Intronic
1201369804 Y:13251263-13251285 GATTCTACTTCACATGGAACTGG + Intronic