ID: 945340131

View in Genome Browser
Species Human (GRCh38)
Location 2:208642644-208642666
Sequence CTGGTTTCTCAGATCAGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945340126_945340131 29 Left 945340126 2:208642592-208642614 CCATACTGACTGGCAATAGTCTC 0: 1
1: 0
2: 0
3: 8
4: 57
Right 945340131 2:208642644-208642666 CTGGTTTCTCAGATCAGACCAGG 0: 1
1: 0
2: 1
3: 7
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945340131 Original CRISPR CTGGTTTCTCAGATCAGACC AGG Intronic
901857825 1:12055537-12055559 CTGGTTTCTCAGAAGAGCCTTGG - Intergenic
902534241 1:17110038-17110060 CTGTTTGCTCAGCTCAGAACAGG - Intronic
904110107 1:28119373-28119395 CTTTTTTCCCAGATCAGGCCAGG + Intergenic
904345437 1:29865235-29865257 CTGGCTTCTCTGACCAGACCAGG + Intergenic
905694649 1:39965680-39965702 CTTATTGCTCAGATGAGACCTGG + Intronic
907840749 1:58155062-58155084 CTGGTGTCTCAGCTCAGAAGAGG + Intronic
907938169 1:59061303-59061325 TTGTTTTCTCAGATCACTCCAGG - Intergenic
908357264 1:63334928-63334950 CTTGATTCTCAGAACAAACCTGG - Intergenic
908626717 1:66052835-66052857 CTGGATTCTCAGAGGAAACCTGG - Intronic
909584948 1:77279573-77279595 CTGCTTCCACAGAACAGACCTGG + Intergenic
909945620 1:81659511-81659533 CTGGGTTTTCAGATAAGAACAGG - Intronic
911147544 1:94567322-94567344 CTGGTGTCTCGGATGAGACTGGG + Intergenic
911897350 1:103454043-103454065 CTGTTTTCTCAGAACACTCCAGG + Intergenic
920050850 1:203163995-203164017 CTGGCTTCTCAGCACAGAGCTGG + Intronic
920301207 1:204990157-204990179 CTGGTTTCTGAGACCAGAGAGGG - Intronic
922515711 1:226206812-226206834 CTGCTTTATCAGATCAGATGTGG + Intergenic
923088139 1:230717299-230717321 GTGGTTTCTGAGATGAGACTTGG + Intergenic
923103128 1:230833274-230833296 CTGGCTTCTTAGATCAGAGGTGG - Intergenic
924246699 1:242092517-242092539 CTGGGAGCTTAGATCAGACCTGG - Intronic
924278870 1:242416098-242416120 CTGTTTTCTAAGATCAGTTCAGG + Intronic
924740558 1:246792125-246792147 CAGCTTTCTCAGACCAGCCCTGG + Intergenic
924797776 1:247304801-247304823 CTGGTTTCACAGTTCATAGCTGG + Intronic
1063762156 10:9091914-9091936 GTGATCTCTCAGATAAGACCAGG + Intergenic
1064094342 10:12412036-12412058 CTGGTTTCTCAGGTGACAACTGG + Intronic
1064625216 10:17254432-17254454 CTGTTTTCTCTGATCACTCCTGG + Intergenic
1065290847 10:24227879-24227901 CTGGTTTCTCCCATCAGACCAGG + Intronic
1067696716 10:48541211-48541233 TTGGTTTCTCAGAGGTGACCTGG + Intronic
1072676441 10:97469813-97469835 CTGGTTTTTCTGCTGAGACCAGG - Intronic
1078857895 11:15221347-15221369 CTGGCTTCCCAGAACAGCCCAGG - Intronic
1079107194 11:17579140-17579162 CTGTCTTCTCAGCCCAGACCTGG - Intronic
1081259030 11:40935356-40935378 CTGTTTTGTCAGAACAGACATGG - Intronic
1082836973 11:57658207-57658229 CTGTTTTCTGAGTTCAGACCCGG + Intronic
1083132098 11:60634116-60634138 CTGGATATTCAGATCAGACAGGG - Intergenic
1090188332 11:124752254-124752276 CTGGTATCTCAGAGCAAACAGGG + Intergenic
1090968967 11:131623299-131623321 CTGGATTCTCAAAACAGTCCTGG - Intronic
1091676364 12:2493534-2493556 CTTGTTTCTCAGGCAAGACCTGG - Intronic
1092709749 12:11323269-11323291 CTGGTTTCTCTTATCAAACAGGG - Intergenic
1098802655 12:74981699-74981721 CTGGTTCCTCAGATCTAAGCAGG + Intergenic
1101999385 12:109547345-109547367 CTGGTTGCTGAGATCAAACAAGG + Intergenic
1102112282 12:110373545-110373567 CCTGTTTCTCAGATCAGCCCAGG + Exonic
1103706106 12:122873664-122873686 CTCCTTTCTCAGAACTGACCGGG - Intronic
1104020247 12:124987434-124987456 GTTGTTTCTCACATCAGAACAGG - Intronic
1104810554 12:131617762-131617784 CTTGTTTCTGATATCAGCCCAGG + Intergenic
1106427050 13:29641345-29641367 CTGGTATCAGGGATCAGACCAGG + Intergenic
1109517538 13:63464079-63464101 CAGGTTCCTCAGCTCATACCAGG - Intergenic
1114530388 14:23391758-23391780 CGGGTTTGTCAGAAGAGACCTGG - Intronic
1117515568 14:56497716-56497738 ATGGTTTCTTAGATATGACCTGG - Intronic
1117917644 14:60694696-60694718 ATATTTTCTCAGACCAGACCAGG + Intergenic
1121227382 14:92331052-92331074 CTGGTTTCACAGGTCAGGGCTGG - Intronic
1122071262 14:99206958-99206980 ATGGTTTTTTAGATAAGACCGGG - Intronic
1122230498 14:100304429-100304451 TAGGTTTCTCCGATGAGACCAGG + Intronic
1122264276 14:100539444-100539466 CCGGCTTCTCAAATCACACCAGG + Intronic
1125217193 15:37289080-37289102 CTGGTTTCTTACATTAGTCCAGG - Intergenic
1128381346 15:67115323-67115345 CTGTGTTCTCAGAACAGAACAGG + Intronic
1129068834 15:72934149-72934171 CTGGGTTGTCAGATCAGATGAGG + Intergenic
1130686389 15:86041349-86041371 TTGGTCTCTCAGATCGCACCAGG - Intergenic
1130847648 15:87762196-87762218 CTGGCTTCCCAGCTGAGACCAGG + Intergenic
1131293612 15:91128582-91128604 CTGGTTTCTATGATCTGCCCTGG - Intronic
1136375791 16:29864265-29864287 CTGGTTTCTCAGGTCAACTCAGG + Intergenic
1138167344 16:54815528-54815550 GTGGTTGCTCAGCTCAGAGCGGG - Intergenic
1139373993 16:66485552-66485574 CTGGTTGCCTAGATCAGGCCGGG + Intronic
1140715275 16:77720844-77720866 CTGGATTCTCAGCTCGCACCAGG + Intergenic
1143583082 17:7837557-7837579 TTGGGCTGTCAGATCAGACCTGG + Intergenic
1146973431 17:37091477-37091499 CTGGTTTTTCTCAACAGACCTGG + Intronic
1147319806 17:39639329-39639351 CTGGTTTTCCTGAGCAGACCAGG - Intronic
1149530525 17:57391403-57391425 CTGGTTTCTCAGATGAGGTTGGG - Intronic
1150215851 17:63468733-63468755 CTGGCTGCTCAGTGCAGACCTGG - Intergenic
1152411218 17:80124241-80124263 CTGGTTTCTATCATCAGCCCTGG - Intergenic
1154014578 18:10604980-10605002 CTGCTTTCTCAGAACTAACCTGG + Intergenic
1154190909 18:12230597-12230619 CTGCTTTCTCAGAACTAACCTGG - Intergenic
1156306644 18:35884098-35884120 ATGGTTTCCCAAATGAGACCTGG - Intergenic
1157866820 18:51195429-51195451 GTGGTTTCACATATCAGACTTGG - Intronic
1165230903 19:34386042-34386064 CTGGCTCCTCAGACCATACCTGG - Intronic
1165875417 19:39003126-39003148 CTGCTTTCTCAGACCACTCCTGG + Intronic
925820269 2:7793185-7793207 CTGGTCTCTCAGAACACACACGG - Intergenic
926672402 2:15588539-15588561 CTGGTTTCTGGGACCAGGCCAGG + Intergenic
926774705 2:16410419-16410441 TTGGTTTCTCAGATAAAACTGGG - Intergenic
932489219 2:72109275-72109297 TTGGTCTCACAGATCAGCCCTGG - Intergenic
933706481 2:85294663-85294685 CAGGTTTCTCAGCTCAAAGCTGG - Intronic
935539512 2:104333098-104333120 CTGTTTTCTGAGATCAGTCTTGG + Intergenic
936935558 2:117835873-117835895 CTTGTTTCTAAGATCTGACTTGG - Intergenic
938829609 2:135037290-135037312 CTGGTTTTTGACAGCAGACCCGG + Intronic
940531047 2:154876419-154876441 CTGGGTACTCAGATAAGTCCAGG - Intergenic
941864777 2:170323444-170323466 CTGGCTTATCATATCAGGCCTGG + Intronic
942381290 2:175393973-175393995 ATGGATTCTGAGATCACACCTGG - Intergenic
945340131 2:208642644-208642666 CTGGTTTCTCAGATCAGACCAGG + Intronic
945360525 2:208890886-208890908 TTTGTTTTTCAGATCAGACCAGG + Intergenic
946045603 2:216818438-216818460 CTGATTTCTCAGAGCAACCCAGG + Intergenic
946706924 2:222467364-222467386 CAGGGTACTCAGATCAGAGCAGG - Intronic
1169020260 20:2325873-2325895 CTGGTTTGTGAGGTCTGACCTGG + Exonic
1172995041 20:39064404-39064426 CTGCCTTCTGAGATCAGCCCCGG + Intergenic
1174364718 20:50049692-50049714 CTGGTTTTTCAGAACTGATCAGG - Intergenic
1176145081 20:63561925-63561947 CTGGTTTCATAAATCAAACCAGG - Exonic
1177885517 21:26741495-26741517 CTGTTTACTCAGATCACAGCTGG + Intergenic
1177911986 21:27044217-27044239 CTGCTTTCTCAGACCTGGCCTGG - Intergenic
1178521971 21:33294124-33294146 CTGATTTCTCAGATCTTACAGGG - Intronic
1178636881 21:34311702-34311724 CATGTTTCTCAGATTAGATCAGG + Intergenic
1179096013 21:38314812-38314834 CTGGTTCTTCTGATAAGACCGGG + Intergenic
1179115360 21:38486459-38486481 CTCATTTCTCAGAACTGACCGGG + Intronic
1179168767 21:38956569-38956591 TTGGTTTCTCTGATCATTCCTGG - Intergenic
1182422290 22:30254400-30254422 CTGGCTGCTCAGACCACACCTGG - Intergenic
1185104312 22:48858564-48858586 CTGGTGTCTCAGATGAGGTCAGG + Intergenic
949482494 3:4507135-4507157 CTGGTTTCACAGAACATAGCCGG + Intronic
949954884 3:9259436-9259458 CTGGTGTTTCAGGTCACACCTGG - Intronic
950737763 3:15024384-15024406 ATGGCTTCTCAGATCAGAGCTGG + Intronic
956110380 3:65864611-65864633 CTGGTTTCCCAGATTGAACCAGG + Intronic
956688351 3:71853388-71853410 CAGGATTCTGAGAGCAGACCAGG - Intergenic
956825485 3:72993912-72993934 ATGGTTTTTCAGATCCCACCTGG - Intronic
962141944 3:132799650-132799672 CTGTTTTCCCAGAACAGTCCAGG + Intergenic
962530696 3:136277442-136277464 CTGGTTTCTCAGGTGACAACGGG + Intronic
964188716 3:153978041-153978063 CTGGTTTCTCTGACCTGCCCAGG + Intergenic
967186482 3:186948838-186948860 CTGGTTTCTCTGCACAGCCCTGG + Intronic
971382918 4:26116327-26116349 CTGGTTTTTCACAGCATACCGGG - Intergenic
977348805 4:95853370-95853392 CTGGTTTCTAAGACCTGACTTGG + Intergenic
977369252 4:96114399-96114421 CTGGTTTCTCAGACCTGAGAAGG - Intergenic
977518802 4:98055793-98055815 AGGGTTGCTCAGGTCAGACCAGG - Intronic
979457267 4:120941126-120941148 CTGGTAGCTGAGGTCAGACCAGG + Intergenic
979664199 4:123293064-123293086 CTGGATATTCAGATCAGACGAGG + Intronic
981373273 4:143984891-143984913 CTGATATCTCTGATCAGAGCTGG + Intergenic
981382374 4:144088139-144088161 CTGGTATCTCTGATCAGAGCTGG + Intergenic
983899611 4:173119878-173119900 CTTCTTTCACAGATTAGACCAGG + Intergenic
988925825 5:35990564-35990586 CTGGGTTCTCTCCTCAGACCTGG + Intronic
994318839 5:98365844-98365866 GTGATTTCTGAGATCAGAGCTGG - Intergenic
995349512 5:111158959-111158981 CTAGTTTCACAGATTACACCTGG - Intergenic
996355221 5:122588354-122588376 CTTCTTTCTCAGATAAAACCAGG - Intergenic
997347507 5:133202624-133202646 CTGCTTTCTCTCATCAGTCCTGG - Intronic
998350672 5:141498532-141498554 CTGGTGTGTCTGACCAGACCAGG - Intronic
1003132486 6:3407046-3407068 GTGCTTTCTCAGAACAGAACTGG - Intronic
1005011529 6:21340399-21340421 CTGGCTTCTCTGATGAAACCAGG - Intergenic
1009269078 6:61596116-61596138 CTGGATTCTCAGATCTGGACAGG - Intergenic
1012696499 6:102391082-102391104 CTGGTTTCTCAGATGATAGGTGG - Intergenic
1013801641 6:113952205-113952227 CTGGTCTGTAAGATAAGACCAGG + Intronic
1017097762 6:150819863-150819885 CTGGTTTCTCAGCTCACTGCCGG + Intronic
1018494248 6:164332340-164332362 GTGATTTGTCAGAGCAGACCAGG + Intergenic
1018791036 6:167147899-167147921 CTGCTTTCTCATCACAGACCTGG - Intronic
1020430441 7:8112190-8112212 CTGGTTCCTCACAGGAGACCTGG + Intergenic
1021621901 7:22557187-22557209 TTGGTGTCTCTGATAAGACCAGG + Intronic
1022581993 7:31564701-31564723 CTGCTACCTCAGATCAGAGCAGG - Intronic
1024976138 7:55115663-55115685 CTGGGTCCTGAGAGCAGACCGGG - Intronic
1025029899 7:55548456-55548478 CTGTTTTCTCACATTAGAGCTGG + Intronic
1026475065 7:70728099-70728121 CTGTTTTCTCAGATCCCAACAGG + Intronic
1026655931 7:72256525-72256547 CTGGATTCACAGATAAGACTTGG + Intronic
1027525451 7:79263412-79263434 CTGGTTTCCCAGCTGACACCAGG + Intronic
1029722172 7:102375517-102375539 CTGCTTTCTCAGAGCAGGCATGG + Intronic
1030942951 7:115678334-115678356 CTAGTTACTCAGATCACACTGGG + Intergenic
1031343961 7:120641408-120641430 TTGGTTTCTAAAATCATACCGGG - Intronic
1033705962 7:143885170-143885192 CTGGTTTCGGGGACCAGACCAGG - Intronic
1033813410 7:145044558-145044580 CTGGTTTCTCAGTGCAAACAAGG + Intergenic
1036748452 8:11427295-11427317 CTGGTTTCTCAGTTGTGACATGG + Intronic
1038379801 8:27081903-27081925 CTGGTTTCTTTGCTCAAACCTGG - Intergenic
1038382321 8:27107455-27107477 CTGAATTCTCTGCTCAGACCTGG + Intergenic
1039771784 8:40694772-40694794 CTGGTTTCTAAGATCTGCCTTGG - Intronic
1047169853 8:122481860-122481882 CTGGCTTCTGAGATCAGAGAAGG + Intergenic
1047228858 8:122979123-122979145 CTGGTTCCTCATCTGAGACCTGG + Intergenic
1049604940 8:143524940-143524962 CTGGTCTCGGAGATCAGCCCTGG - Intronic
1052751172 9:32492469-32492491 ATGCCTTCTCAGATCAGACAAGG - Exonic
1052791360 9:32878126-32878148 CAAGTTATTCAGATCAGACCAGG + Intergenic
1055519387 9:77065056-77065078 CTGGTTTCTAAGACCTGCCCGGG - Intergenic
1057746965 9:97760059-97760081 CTGGCTGCTCAGATCAGAGTAGG - Intergenic
1057973354 9:99578342-99578364 CTCGTTTCTCAGAACAGTTCAGG - Intergenic
1060183640 9:121550915-121550937 CTGGATTCCCAGAGCAGGCCTGG + Intergenic
1060197375 9:121632457-121632479 CTGGTATCTGAGCACAGACCAGG + Intronic
1061648665 9:132027981-132028003 GTGGTTGCTCAGATCAGAGATGG - Intronic
1061883799 9:133581163-133581185 CTGGTTTATCAGCACAGCCCAGG - Intronic
1188222953 X:27562470-27562492 CTGCTTTCTCAGATCACTCCTGG + Intergenic
1189443610 X:41060057-41060079 CTGGTCTCACAGATCAACCCTGG - Intergenic
1189443938 X:41063235-41063257 CTGGTCTCACAGATCAACCCTGG - Intergenic
1190999583 X:55646128-55646150 GTGGGTTCGCAGATGAGACCAGG - Intergenic
1196208387 X:112967359-112967381 CTGGTTTCTATGATCAGTCTTGG + Intergenic
1196397013 X:115275426-115275448 TTGGTCTCTCAGATCACACTAGG - Intergenic
1196779975 X:119375135-119375157 CTGCTTTCTCAGACCAATCCTGG - Intergenic