ID: 945341299

View in Genome Browser
Species Human (GRCh38)
Location 2:208658758-208658780
Sequence GCACTCACCATAGCCAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945341299 Original CRISPR GCACTCACCATAGCCAAAAC TGG (reversed) Intronic
900928240 1:5719416-5719438 GCACAAACCAAAGCCAATACAGG + Intergenic
902342031 1:15790098-15790120 TTACTCACAATAGCCAAAAGGGG + Intergenic
907023755 1:51094955-51094977 GCTCTCCCCATAGCCACCACAGG - Intergenic
907095704 1:51778455-51778477 ACACTAAACATAGCAAAAACTGG + Intronic
907774277 1:57498175-57498197 GAATTCAACATACCCAAAACAGG - Intronic
911716189 1:101135826-101135848 TCATTCACAATAGCCAAAAATGG + Intergenic
912085737 1:106001026-106001048 GCACTCACTTCAGCCACAACAGG + Intergenic
914735302 1:150410850-150410872 GCCCTCACCAGAGACCAAACTGG - Intronic
918572442 1:186013763-186013785 GACCTCCCAATAGCCAAAACTGG + Intronic
920422084 1:205841818-205841840 GCACTCACCATATTCAAAGCAGG - Exonic
921719270 1:218452464-218452486 GCACTCACCAAAGCCAGCCCAGG + Intergenic
922612592 1:226941099-226941121 GCACTCCCCATCGCCCAAAGAGG - Intronic
1065676115 10:28176394-28176416 GCACTCCCAATGGCCAAAGCTGG + Intronic
1068517268 10:58039980-58040002 GCACTTGGCATAGCCAAGACAGG + Intergenic
1068884062 10:62080213-62080235 GCTCTCCCCATAACCAAGACAGG - Intronic
1072990749 10:100190822-100190844 GCACCCAACATAGCCAAAGCAGG + Intronic
1074755884 10:116623836-116623858 GCACTGGCCTTAGCCAAACCTGG + Intronic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1081778456 11:45693389-45693411 GAACAGACAATAGCCAAAACAGG - Intergenic
1085286517 11:75365771-75365793 GAGCTCTCAATAGCCAAAACCGG + Intergenic
1087165973 11:95002824-95002846 GCAGTCCCCAGAGCCAAAACAGG + Intergenic
1087471607 11:98582874-98582896 GCACTAATCAAAGCCAAAATTGG - Intergenic
1087752577 11:102022403-102022425 CCACTTAACATGGCCAAAACAGG - Intergenic
1088579471 11:111300713-111300735 GCACTCACCATTCCCAGACCTGG + Intronic
1092897252 12:13024170-13024192 GCACTCACAATAGCCAAAATGGG - Intergenic
1094447820 12:30551124-30551146 TGATTCATCATAGCCAAAACCGG - Intergenic
1095830471 12:46580973-46580995 ACATTCACAATAGCCAAAAGGGG - Intergenic
1097802339 12:63928391-63928413 TTATTCACAATAGCCAAAACTGG + Intronic
1098264755 12:68706944-68706966 GCCCGCACCAGAGCCAAAGCTGG - Intronic
1099974781 12:89534902-89534924 TTACTCACAATAGCCAAAAGTGG + Intergenic
1101145904 12:101840191-101840213 TCACTCACTCCAGCCAAAACAGG - Intergenic
1106502196 13:30339722-30339744 GCACCAAACACAGCCAAAACAGG + Intergenic
1108753231 13:53470276-53470298 GCACTTACCTTAGCCAAGCCAGG - Intergenic
1108989356 13:56635239-56635261 CCATTCACAATAGCCAAAAAAGG + Intergenic
1110663809 13:78091864-78091886 GTACTACACATAGCCAAAACGGG - Intergenic
1112258259 13:97854364-97854386 TTACTCACAATAGCCAAAATAGG + Intergenic
1118442287 14:65822721-65822743 GAAGTCATCATAGCCAAAATAGG - Intergenic
1120734918 14:88042106-88042128 GCTCTCACCAAAGCCATTACTGG + Intergenic
1120782907 14:88502078-88502100 GCACTCACCTGAGCAAAAAGGGG - Intronic
1122166356 14:99827320-99827342 GTACTCACGATACTCAAAACCGG - Intronic
1122524782 14:102373756-102373778 ACAGTCACAATAGCCAATACAGG - Intronic
1124625493 15:31305224-31305246 CCAGTCACCATAGCAACAACAGG - Intergenic
1126136813 15:45400694-45400716 GGAATAACCAAAGCCAAAACAGG - Intronic
1130647736 15:85743567-85743589 GCACCTTCCATAGCCAAATCAGG + Exonic
1131744130 15:95427454-95427476 GCCCTCACCATAAACAAAATTGG + Intergenic
1132596922 16:756297-756319 CCATTCACAATAGCCAAAAATGG - Intronic
1134869235 16:17636803-17636825 GCATTCACCAAAGCCAAGCCTGG + Intergenic
1137231696 16:46572901-46572923 GCATTCACAATAGCCAAAAAGGG + Intergenic
1141263553 16:82475462-82475484 GCAGTCACCTGACCCAAAACAGG - Intergenic
1147534563 17:41311115-41311137 GCACTCAACTCAGCCAACACTGG + Intergenic
1148936631 17:51168329-51168351 GCACTCACCATGGCCACAACCGG - Exonic
1150165581 17:62938738-62938760 TCATTCACAATGGCCAAAACTGG - Intergenic
1151209931 17:72537040-72537062 GCTGTCACCATAGCAAAATCAGG + Intergenic
1151923706 17:77177550-77177572 CAACTAACCATAGCTAAAACTGG - Intronic
1152262777 17:79275939-79275961 TCATTCACCACAGCCAAAAACGG + Intronic
1154043705 18:10884320-10884342 CTAATCACAATAGCCAAAACAGG - Intronic
1158260514 18:55601186-55601208 GTGCTCATAATAGCCAAAACTGG + Intronic
1159639435 18:70846418-70846440 GCAGTCACAATACCCAAAAGAGG - Intergenic
1161450320 19:4342308-4342330 AGACTCAGCATAGCCCAAACCGG - Intronic
1164331993 19:24268171-24268193 GCGCCCACCATTGCCGAAACTGG - Intergenic
1164494014 19:28741593-28741615 GCATTCACCATAGCAGAGACAGG + Intergenic
1167187927 19:47960645-47960667 AGACTCAGAATAGCCAAAACAGG + Intergenic
930676875 2:54211554-54211576 ACACTAACCATAGCCAGGACTGG - Intronic
931052124 2:58427462-58427484 GCATTAACCATAGTCAAAACTGG + Intergenic
932193782 2:69765147-69765169 TTACTCACAATAGCCAAAAGTGG - Intronic
933146552 2:78860698-78860720 GCACTAAGCACAGCGAAAACAGG + Intergenic
934518176 2:95001863-95001885 GCAGTCACAATACCCAAAGCAGG + Intergenic
936431640 2:112469821-112469843 CTATTCACAATAGCCAAAACAGG + Intergenic
938034171 2:128022383-128022405 GTATTCATAATAGCCAAAACAGG - Intronic
940333105 2:152496788-152496810 GACCTCACAATAGCCAAATCTGG - Intronic
942098684 2:172556734-172556756 GCAATCATCATATGCAAAACTGG - Intronic
942759600 2:179382914-179382936 GCACCCATCAAAGCCAAGACTGG + Intergenic
944301816 2:198132273-198132295 CCAACCACCACAGCCAAAACTGG - Intronic
945341299 2:208658758-208658780 GCACTCACCATAGCCAAAACTGG - Intronic
1169237578 20:3943590-3943612 CAACTCACCATAACCAAAGCTGG + Intronic
1171080821 20:22181696-22181718 GAAATCCCAATAGCCAAAACTGG - Intergenic
1173654113 20:44687468-44687490 CTATTCACCATAGCCAAAAGTGG - Intergenic
1174258891 20:49278724-49278746 CCACTCACCACACACAAAACGGG - Intergenic
1179953757 21:44726773-44726795 GCACTCACCCAAGCCCACACAGG - Intergenic
1181838799 22:25636033-25636055 GCACTCCTAGTAGCCAAAACTGG - Intronic
1185390547 22:50558877-50558899 GCTCTCACCAAAGTCATAACTGG + Intronic
951717397 3:25664284-25664306 GCACTCGCCATGGCCAAGTCGGG - Exonic
952611488 3:35215810-35215832 GCCCGCACCAGAGCCAAAGCTGG + Intergenic
952882375 3:37992794-37992816 GAACTCACCAGGGCCAAACCAGG + Intronic
953504425 3:43470307-43470329 ATACTCCCCATAGCCCAAACAGG - Intronic
956169347 3:66420527-66420549 TCACTCACCACAGCCAAAGGTGG + Intronic
957105908 3:75887001-75887023 TCACTCTCCATAGACAAAAAAGG - Intergenic
957858096 3:85905118-85905140 GCATTCACCATAGACAAAAGGGG - Intronic
958999447 3:100945750-100945772 GCACTATTCATAGCTAAAACTGG - Intronic
961787245 3:129354572-129354594 TCACTCACAATAGCCAAAGGTGG + Intergenic
963067735 3:141277242-141277264 GCACGAACAATAGCTAAAACAGG - Intronic
965329789 3:167357572-167357594 TTACTCACAATAGCCAAAAGGGG + Intronic
966544065 3:181124884-181124906 GCATTCACAATAGCCACAAAAGG - Intergenic
967717814 3:192783398-192783420 GCACTAACCAAGGCCCAAACAGG + Intergenic
967786601 3:193503590-193503612 GCACTCTTCATAGCAAAAATGGG - Intronic
971295069 4:25380998-25381020 TCAGTCACCAGAGCCATAACAGG - Intronic
973171069 4:47144651-47144673 GAACTCATTATAGACAAAACTGG + Intronic
975718323 4:77227120-77227142 GTACTCACCCTGGCCAACACAGG - Intronic
977928621 4:102728854-102728876 GCCCACACCAGAGCCAAAGCTGG + Intronic
979352850 4:119665995-119666017 ACACTCCTCATAGTCAAAACTGG + Intergenic
979364788 4:119808460-119808482 GGACTCTGAATAGCCAAAACAGG - Intergenic
979817312 4:125125762-125125784 AAACTAACCATAGCCAAATCTGG - Intergenic
982677677 4:158394896-158394918 CCACTCACAATAGCCAAGATAGG - Intronic
984089783 4:175358614-175358636 GCACTTCCCAAAGCCAAAACTGG + Intergenic
985941973 5:3143597-3143619 TGATTCACCATAGCCAAGACGGG - Intergenic
986571117 5:9167356-9167378 GAACTCAGTATACCCAAAACTGG + Intronic
990900434 5:60743669-60743691 GCCCGCACCAGAGCCAAAACTGG + Intergenic
993973396 5:94447115-94447137 AAACTCACCATAACCAAATCTGG - Intronic
994960676 5:106597873-106597895 ACCCTCACAATAGCCAAATCTGG + Intergenic
996850627 5:127947739-127947761 CCATTCACAATAGCCAAAAAAGG - Intergenic
1000610952 5:163373688-163373710 TTACTCACAATAGCCAAGACAGG + Intergenic
1004585771 6:16998528-16998550 GCCCTCACCATAATCTAAACAGG - Intergenic
1005240782 6:23822878-23822900 GCACTCACCAGACACCAAACTGG - Intergenic
1005315555 6:24599659-24599681 GCACCCGCCAGAGCCAAAGCTGG - Intronic
1007119557 6:39368798-39368820 GCATTCACCAAAGCCAAAAGGGG + Intronic
1012185877 6:96216386-96216408 ACACTCAACATTGCCACAACTGG + Intergenic
1012432013 6:99173816-99173838 TTATTCACCATTGCCAAAACTGG - Intergenic
1013368481 6:109451796-109451818 GCACTCACCGCAGCCTAAGCTGG - Intronic
1016438205 6:144059204-144059226 GCACTCCCCAAAGCCACAGCCGG + Intronic
1016524936 6:144990900-144990922 GCACTCACCAACGTAAAAACGGG - Intergenic
1016945716 6:149530767-149530789 GCACTTAGCAGAGTCAAAACTGG + Intronic
1017773258 6:157659783-157659805 GCTCTAACTATATCCAAAACAGG - Intronic
1020756023 7:12203844-12203866 GAACTCCCAATGGCCAAAACTGG - Intergenic
1021457217 7:20842784-20842806 GCACTCACCATACACTATACAGG - Intergenic
1023402696 7:39801933-39801955 TTACTCACAATAGCCAAAAGGGG + Intergenic
1023992473 7:45136884-45136906 GCACTCCCAATGGCCAAAGCTGG - Intergenic
1024011808 7:45273427-45273449 GCCTTCATCATTGCCAAAACAGG - Intergenic
1026141000 7:67706653-67706675 GCACTCTCTATAGCAAAAATTGG + Intergenic
1026501884 7:70949661-70949683 TTATTCACCATAGCCAAAAGTGG - Intergenic
1029195175 7:98800556-98800578 CCATTCACCATAGCAAAGACAGG - Intergenic
1031939109 7:127768361-127768383 TCACTGAGCATACCCAAAACAGG - Intronic
1032661705 7:133990852-133990874 CTATTCACCATAGCCAAAATAGG - Intronic
1032835281 7:135666793-135666815 TTACTCATCATAGCCAAAAGTGG - Intronic
1033412425 7:141130594-141130616 TCATTCATAATAGCCAAAACTGG - Intronic
1033763420 7:144461636-144461658 GCACTCACCACAGGGAAATCAGG - Intronic
1036249103 8:7146466-7146488 GCACTCACTATTGCAAAGACAGG + Intergenic
1036431593 8:8696771-8696793 GCATTCACAATAACCAAAAAAGG + Intergenic
1036657331 8:10685360-10685382 TTACTCACAATAGCCAAAAGTGG + Intronic
1038414199 8:27381573-27381595 CTACTCACAATAGCCAAAACAGG - Intronic
1039341841 8:36658998-36659020 ACAATCATCATAGCCAAAATAGG + Intergenic
1042674072 8:71299195-71299217 GTACTGACCCTGGCCAAAACTGG + Exonic
1046733710 8:117753143-117753165 ACACTACCAATAGCCAAAACTGG + Intergenic
1051529906 9:18090316-18090338 TTATTCACAATAGCCAAAACAGG + Intergenic
1052721717 9:32179373-32179395 GCACTGATAATAGCCAAAACTGG - Intergenic
1053622852 9:39838162-39838184 CCACTCACAATAGCCACAAAAGG + Intergenic
1054864851 9:69989571-69989593 GTACTCAACATAGCCAAAAGGGG - Intergenic
1057446581 9:95120046-95120068 GCACTAACCATAGGAAAAAATGG - Intronic
1060463883 9:123885138-123885160 GCTCTCACCATATCCAACCCTGG + Intronic
1061120425 9:128638760-128638782 TGACTCACTATAGCCAAAAAGGG + Intronic
1062689673 9:137834769-137834791 GCGCTCTCCATAGTCAAACCTGG - Exonic
1187078399 X:15959617-15959639 GAACTCTCAATAGCCAAATCTGG + Intergenic
1187184533 X:16970112-16970134 GCACTCACCATAATCAACTCTGG + Intronic
1189262090 X:39686516-39686538 GCTCTCAACACAGCCAAAGCTGG + Intergenic
1190935032 X:54992132-54992154 CCACTCACCATAGCCAAGAATGG - Intronic
1193215538 X:78859368-78859390 GAAGTCACCATTTCCAAAACAGG - Intergenic
1196117630 X:112014722-112014744 GCACTCCCCTGATCCAAAACAGG + Intronic
1199498719 X:148485204-148485226 GCACTCCCAATGGCCAAAAATGG + Intergenic
1200291978 X:154884168-154884190 CCACTCACAATAGCCAGAAGGGG + Intronic
1200309191 X:155059897-155059919 GCACTCCACATGGCCAAAGCAGG - Exonic
1200338816 X:155379905-155379927 CCACTCACAATAGCCAGAAGGGG + Intergenic
1200347653 X:155460787-155460809 CCACTCACAATAGCCAGAAGGGG - Intergenic