ID: 945344651

View in Genome Browser
Species Human (GRCh38)
Location 2:208698877-208698899
Sequence AAACATGCACAGATGAAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 344}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945344651_945344652 23 Left 945344651 2:208698877-208698899 CCTTGCTTCATCTGTGCATGTTT 0: 1
1: 0
2: 3
3: 33
4: 344
Right 945344652 2:208698923-208698945 GACACAGATTCTGATTCAGCAGG 0: 1
1: 2
2: 25
3: 160
4: 920

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945344651 Original CRISPR AAACATGCACAGATGAAGCA AGG (reversed) Intronic
900338532 1:2176774-2176796 ACACATGCACAGGCAAAGCAAGG - Intronic
900630979 1:3635086-3635108 AACCATGCACAGGTGAGGCAGGG + Intronic
900779662 1:4609537-4609559 AAACCTGTAGCGATGAAGCATGG + Intergenic
901129946 1:6955935-6955957 AAGCATGCACTGAGGAGGCAAGG + Intronic
901424675 1:9174283-9174305 ACACATGCACAGATGAACTGAGG + Intergenic
902238263 1:15071617-15071639 AAATATGCAAATATGCAGCACGG + Intronic
903967429 1:27099429-27099451 AGACAGGCACAGATGAGGAAGGG + Exonic
904097624 1:27993487-27993509 GAACACCCACAGATGAACCATGG + Exonic
905023003 1:34830753-34830775 GAGCATGCCCAGATGAACCAAGG + Intronic
906865762 1:49417970-49417992 AAACATGTACACATGAATCTAGG - Intronic
907306166 1:53514245-53514267 CCAAATGCACAGATGAGGCAAGG + Intronic
908038132 1:60078094-60078116 TAACATCCACAGAGGAAGTAAGG - Intergenic
908383875 1:63622033-63622055 AAACATGCACTGAGGAATTAAGG - Intronic
909554411 1:76937568-76937590 ATACATGCACACATAAAGGAAGG + Intronic
910148946 1:84117965-84117987 AAGCATGAACAGCTGCAGCAAGG - Intronic
910609367 1:89124928-89124950 AAACATTCTCTGATGAACCAGGG + Intronic
911758282 1:101586104-101586126 AAACAAGCAAAGATCTAGCATGG - Intergenic
912166494 1:107047742-107047764 CAAAATGCACAAATAAAGCAAGG + Intergenic
915500822 1:156315992-156316014 AAAGATGCAAAGGTCAAGCAAGG + Intronic
917364231 1:174211320-174211342 AAACAAGAAAAGATTAAGCAGGG + Intronic
917476408 1:175373065-175373087 AAACATGCACAGAAGCAGCATGG + Intronic
918801465 1:188978303-188978325 ACACATGCACAAAAGAAGGAAGG + Intergenic
919074933 1:192801683-192801705 AAACAAGCCCAGCTGAAGCCAGG - Intergenic
919369974 1:196710669-196710691 ACACATTCACAGATGAATCTGGG + Intronic
919378609 1:196825627-196825649 TAACATGCACAGAAGAAGGATGG + Exonic
919389923 1:196970628-196970650 TAACATGCACAGAGAAAGAATGG + Intergenic
919390807 1:196983035-196983057 TAACATGCACAGAAGAAGGATGG + Exonic
919784941 1:201253035-201253057 ACAGAGGCACAGATGAGGCAGGG - Intergenic
920072920 1:203316021-203316043 AAACATGCACAGGCCAGGCATGG + Intergenic
920381534 1:205537206-205537228 AAACATGGAGAGCTGAAGCATGG + Intergenic
921789226 1:219270674-219270696 AAACTTGCACAGATGAATGCTGG - Intergenic
1063170447 10:3505145-3505167 AAACTTGAACAGTTAAAGCATGG - Intergenic
1063856136 10:10256226-10256248 TAAAATGCACACATAAAGCATGG - Intergenic
1063863390 10:10337384-10337406 AAACCTGAACAGATGTATCAAGG - Intergenic
1063874753 10:10462456-10462478 AAAAAGGCAAAGAAGAAGCAGGG - Intergenic
1065486427 10:26240390-26240412 AAACATGCACAAATAAATAAGGG - Intronic
1066212236 10:33251555-33251577 AAACATGATCAGGAGAAGCAAGG - Intronic
1066757209 10:38722972-38722994 AAACATGAACAAATGGAGCTTGG + Intergenic
1067740244 10:48890062-48890084 AAACATGTGCAGAAGATGCACGG - Intronic
1068726069 10:60304929-60304951 AAACAGGCACAGAGCAAGCAGGG - Intronic
1068906622 10:62333176-62333198 AAACATGCAAAGAGGAAACCAGG - Intergenic
1069363801 10:67674879-67674901 AAAGAGGGACATATGAAGCAGGG - Intronic
1069809769 10:71149666-71149688 GAACAAGGACAAATGAAGCAAGG + Intergenic
1071926466 10:90415459-90415481 CAGCTTGCACACATGAAGCAGGG - Intergenic
1072195058 10:93110386-93110408 AAATCTGCACAGATGCAGCCAGG - Intergenic
1074058896 10:109946948-109946970 GAAGATGCACAGATGAATCGTGG - Intronic
1075072428 10:119327788-119327810 AGACATGAGCAGGTGAAGCAAGG + Intronic
1075456377 10:122587650-122587672 AAACACCCCCAGATGCAGCAGGG + Intronic
1075647073 10:124103653-124103675 AAACATGCAAATCTGGAGCAAGG - Intergenic
1076925931 10:133487016-133487038 AAATAATAACAGATGAAGCAAGG - Intergenic
1078562455 11:12385005-12385027 AAGCAGGCAGAGATGAAGCAGGG + Intronic
1078610253 11:12813484-12813506 AAACATACACACATGAAGTATGG - Intronic
1080752400 11:35162839-35162861 GAGCATGCACATAAGAAGCAGGG - Intronic
1084005995 11:66323904-66323926 AGGCATGCATAGATGATGCATGG + Intergenic
1086876551 11:92103368-92103390 TAAAATGCACAGAGGATGCAGGG - Intergenic
1087128624 11:94650433-94650455 CAAAATGCACAAATGAGGCAAGG - Intergenic
1087702822 11:101455487-101455509 AGACATCCACACCTGAAGCAGGG + Intronic
1088111048 11:106261857-106261879 AAACATACACATATAAATCAAGG - Intergenic
1088782800 11:113152309-113152331 AGAAATGCACAGATGCAGTATGG - Intronic
1089683915 11:120134825-120134847 ACACAGGCACAGAGGAAGGAAGG - Intronic
1090324508 11:125873554-125873576 AAACTTGCACAGGTGAATCCCGG + Intergenic
1090357789 11:126151510-126151532 AACCAGGCACAGATGCAGTAGGG + Intergenic
1090448847 11:126788425-126788447 GAACATGGACAGAGGAGGCAAGG - Intronic
1090491923 11:127171548-127171570 CAACATGAACAGATGAAGTGAGG - Intergenic
1090638595 11:128710241-128710263 AAAAATGAAGAGATGAAGAAAGG + Intronic
1091218191 11:133916413-133916435 ACACATGCAAAGGTGCAGCATGG + Intronic
1091474633 12:760187-760209 ATACATGCAAAGATGAGACAAGG - Intronic
1091496709 12:979278-979300 AAACATACAAAGATTTAGCATGG + Intronic
1091952051 12:4601447-4601469 AAACATCTACAAATGAAGAAGGG + Intronic
1091964419 12:4725933-4725955 AATCAAGCACAGGAGAAGCAAGG + Intronic
1093914859 12:24790113-24790135 AAACATGTACACATGAAGCATGG + Intergenic
1094047840 12:26186871-26186893 AAACAATTACAGCTGAAGCAAGG - Intronic
1096426830 12:51511069-51511091 CAACATTCACAGATGAACAATGG - Exonic
1097486345 12:60207111-60207133 AATAATGCATAGAGGAAGCAAGG + Intergenic
1097754117 12:63390128-63390150 CAAAATGCACAAATAAAGCAAGG - Intergenic
1098925496 12:76345457-76345479 AAACATGTAACGATGAAGGAGGG + Exonic
1099711581 12:86232608-86232630 AAACATGAACAGATTGAGAAGGG + Intronic
1101703622 12:107198985-107199007 AAAGATGTTCAGATGAAGAACGG + Intergenic
1102114859 12:110395036-110395058 AAACATGGAGAGAGGGAGCAGGG + Intronic
1102713159 12:114946198-114946220 AAAAATACAGAGATCAAGCAGGG + Intergenic
1103383776 12:120515562-120515584 AAACATGCTGAGATGGACCAAGG + Intronic
1104573097 12:129942527-129942549 AAACAGGCTGAGATGAAACATGG + Intergenic
1104653088 12:130551676-130551698 GAAAATGCACAGATAGAGCAAGG + Intronic
1104709535 12:130975939-130975961 AAACATTCACAGAGGGAGGAAGG - Intronic
1106073791 13:26440104-26440126 AAAGAGGCAGAGATGAACCAGGG + Intergenic
1106612817 13:31299843-31299865 AAGGATGCCCATATGAAGCATGG - Intronic
1106766709 13:32920582-32920604 ACACATGCACAGGTGTATCAGGG + Intergenic
1106809846 13:33349508-33349530 GAGCATGCACAGAAGCAGCAAGG + Intronic
1107417038 13:40210378-40210400 TAACATGGACAAATGAGGCATGG + Intergenic
1108485346 13:50917946-50917968 AAACATACTGAGATGGAGCATGG - Intronic
1108671298 13:52691853-52691875 AAAAATGCACAGATGGAGAAAGG - Intronic
1109086322 13:57975282-57975304 AAACATGCAAAGATCAAACTAGG - Intergenic
1109954114 13:69543243-69543265 AAGCATGCTCAGAAGTAGCAGGG - Intergenic
1110555617 13:76856118-76856140 CAACATGCACAGACAAAGCAAGG + Intergenic
1111503348 13:89154931-89154953 ATACATGCAGAGAGAAAGCATGG + Intergenic
1111674933 13:91375392-91375414 AAACATGCAGTGATGAAGACAGG - Intergenic
1112243895 13:97710560-97710582 CAACATGCAGTGATGGAGCAGGG - Intergenic
1112549316 13:100404708-100404730 CAACTTGCACCGGTGAAGCAGGG + Intronic
1113148864 13:107239859-107239881 AAACAAGCACTTATGAAGCAGGG + Intronic
1113475885 13:110580894-110580916 AAACATTCTCACATGAAGGAAGG - Intergenic
1114919882 14:27312858-27312880 CAAAATGCACAAATGAAGCAAGG - Intergenic
1116013977 14:39384540-39384562 AAACGTGTACAGCTGAAGGAGGG + Intronic
1116020011 14:39448834-39448856 GAACAAGAACAGATGTAGCATGG - Intergenic
1116172786 14:41424744-41424766 AAACATTCAGAGAAGAAGTAAGG + Intergenic
1116407945 14:44588357-44588379 AGACTTGCACAGATGAATTATGG + Intergenic
1116726510 14:48566972-48566994 CAAAATGCACACATAAAGCAAGG + Intergenic
1117100214 14:52338253-52338275 CAACCTGCACAGATGCAACAAGG + Intergenic
1117281656 14:54247337-54247359 AAACAAGGACAAATGAAGGAAGG + Intergenic
1117698541 14:58390872-58390894 AAACCTGCACACATCCAGCATGG + Intergenic
1118057705 14:62098971-62098993 GAACATGTACAGATGAGACAGGG + Intronic
1118916704 14:70113730-70113752 CAACATGCACAGATAGAGCCAGG + Intronic
1119032009 14:71200142-71200164 CAAGATGCACAGATGCAGTAAGG + Intergenic
1120348014 14:83315007-83315029 AATCATTCACAGATGAATAAAGG + Intergenic
1120431517 14:84422583-84422605 AAATATGCAGAAAAGAAGCATGG - Intergenic
1120484926 14:85101505-85101527 AAAAATGAACAAATGAAACAAGG - Intergenic
1121016115 14:90550281-90550303 ATACATCAACAGATGAGGCAGGG - Intronic
1128221440 15:65971512-65971534 ACACAGGCACAGATGAAGGTGGG + Intronic
1129025264 15:72566239-72566261 AAAAATGCACTGATGAAGCATGG + Intronic
1130783311 15:87068692-87068714 AAACAACCACAGATGAGGCCTGG + Intergenic
1133554441 16:6891634-6891656 AAACTTGCAGAGATTAAGCAAGG - Intronic
1134630790 16:15754505-15754527 AAAAATCCACTGATGAAGTAGGG + Intronic
1134756903 16:16675073-16675095 AAACATCCGCAGGAGAAGCAAGG - Intergenic
1134895255 16:17880617-17880639 AAACATGCCCTGATGAAGATAGG + Intergenic
1134989165 16:18684090-18684112 AAACATCCGCAGGAGAAGCAAGG + Intergenic
1136720316 16:32314753-32314775 AAACATGAACAAATGGAGCTGGG - Intergenic
1136725369 16:32353145-32353167 AAACATGAACAAATGGAGCTGGG - Intergenic
1136838693 16:33521029-33521051 AAACATGAACAAATGGAGCTGGG - Intergenic
1136843702 16:33559203-33559225 AAACATGAACAAATGGAGCTGGG - Intergenic
1139898086 16:70304336-70304358 AAAGATGAACAGATGAACCTCGG - Intronic
1140102426 16:71929214-71929236 AAACATCCAAGGATGAGGCATGG - Exonic
1140895010 16:79317192-79317214 AAAGAGGGACAGATGAAGGAAGG - Intergenic
1141005742 16:80349957-80349979 GGACATGCAGAGATGAAGAAAGG - Intergenic
1203001062 16_KI270728v1_random:164609-164631 AAACATGAACAAATGGAGCTGGG + Intergenic
1203006115 16_KI270728v1_random:203016-203038 AAACATGAACAAATGGAGCTGGG + Intergenic
1203132664 16_KI270728v1_random:1701013-1701035 AAACATGAACAAATGGAGCTGGG + Intergenic
1203148858 16_KI270728v1_random:1821315-1821337 AAACATGAACAAATGGAGCTGGG - Intergenic
1203153867 16_KI270728v1_random:1859501-1859523 AAACATGAACAAATGGAGCTGGG - Intergenic
1142585279 17:968410-968432 AAAGATACACAGATGCAGCCCGG + Intronic
1143397565 17:6614288-6614310 ACACGTGCACAGAGGAAGCCAGG + Intronic
1143790035 17:9287427-9287449 CAACAGGCACAGAAGAAGAAAGG + Intronic
1145021312 17:19433600-19433622 AAATCTGCACTGATGAAGCCAGG - Intergenic
1147269076 17:39254520-39254542 AACCATGCCCAGATGCAGCTGGG + Intergenic
1147955911 17:44134366-44134388 CAACATGGCCACATGAAGCAGGG + Intergenic
1149481662 17:57008456-57008478 TCACCTGCACAGATGAAGCTAGG + Intergenic
1149530554 17:57391593-57391615 GAAGATGCACAGATGACTCACGG - Intronic
1149751620 17:59151428-59151450 AAACATGCATAGATGTAGAAAGG + Intronic
1153987846 18:10368868-10368890 AGACATGCAGTGATGAGGCAGGG - Intergenic
1154251865 18:12751349-12751371 CAACATGCATGGGTGAAGCATGG + Intergenic
1154259820 18:12820908-12820930 AAACTTGCATATATGAAGCCAGG + Intronic
1155917793 18:31573079-31573101 AAAGATACAGAAATGAAGCAGGG - Intergenic
1155944454 18:31832821-31832843 TAACATGTACAAATGAAGCAGGG + Intronic
1156962036 18:43043977-43043999 AGACATGCCCAGAGGAAGCATGG + Intronic
1158676399 18:59523192-59523214 AAACATGGACAGTTGAAGAGGGG + Intronic
925274556 2:2639497-2639519 AAGCTCACACAGATGAAGCAAGG - Intergenic
926969939 2:18456503-18456525 AAACATGCAAGAATGAAACAGGG + Intergenic
929138376 2:38646081-38646103 CAACAGGAACAGAAGAAGCAGGG - Intergenic
929931849 2:46263416-46263438 AAACATACACAGATGCGGCCTGG + Intergenic
930191879 2:48467955-48467977 CATGATGCACAGAAGAAGCAGGG - Intronic
930277970 2:49335843-49335865 AAATATGGACAGATCATGCATGG + Intergenic
930605970 2:53493353-53493375 AGACAAGAACAGATGGAGCAGGG + Intergenic
932296670 2:70629784-70629806 AAACCTGCACAAATGATTCAGGG - Intronic
932471174 2:71959856-71959878 AGAAATGCACAGATCCAGCAGGG - Intergenic
934320513 2:91967413-91967435 AAACATGAACAAATGGAGCTGGG + Intergenic
935819430 2:106879193-106879215 ATACATACACAGAAGAGGCAGGG - Intronic
936050656 2:109221154-109221176 AGTCATGCACAGAGGAACCATGG + Intronic
937370456 2:121293921-121293943 AAACTTGCACAGCTGGAGGACGG + Intergenic
937958403 2:127436919-127436941 AAACATGTACAAATCAAGGATGG - Intronic
939128680 2:138207217-138207239 AAACATGCAAATATAAAACAAGG - Intergenic
940376734 2:152966289-152966311 AAACATTCCCTGATAAAGCATGG - Intergenic
940449434 2:153818783-153818805 TAAAATGCTCAGATGGAGCAGGG - Intergenic
943273435 2:185837304-185837326 CCACATGTACAGCTGAAGCAAGG + Intergenic
944968950 2:204969228-204969250 ATACATGCTCAGAAGAACCATGG - Intronic
945344651 2:208698877-208698899 AAACATGCACAGATGAAGCAAGG - Intronic
945590287 2:211720571-211720593 AAACAGGCAAAGATCCAGCACGG - Intronic
1170069989 20:12356375-12356397 ACACATGAAAAGATGAAGAATGG + Intergenic
1171213507 20:23335045-23335067 AAACCTGCAGAGTTGAAGCAAGG - Intergenic
1171297008 20:24026154-24026176 GAACAGGGACAGAGGAAGCACGG - Intergenic
1173567700 20:44053344-44053366 AAAGCTGCACAGCTGAAACATGG + Intronic
1177259938 21:18716663-18716685 AAACAAGAACAGAAGAAGGAAGG + Intergenic
1177742886 21:25175163-25175185 GAACATGTATAAATGAAGCAAGG + Intergenic
1177926630 21:27224139-27224161 AAATAAGCACAGATGTAACAAGG + Intergenic
1178477561 21:32950653-32950675 GAAAATGCACAAATGAAGAAGGG - Intergenic
1179305860 21:40153554-40153576 GTACAAGCACAGATGAAGCTAGG + Intronic
1180308761 22:11151472-11151494 AAACATGAACAAATGGAGCTGGG + Intergenic
1180547238 22:16513283-16513305 AAACATGAACAAATGGAGCTGGG + Intergenic
1181536887 22:23550959-23550981 AAAGATGGAAAGATGAAGCGTGG - Intergenic
1181843958 22:25690986-25691008 CAACTTGCACTGATCAAGCAGGG - Intronic
1182211925 22:28684051-28684073 AAACATGAACAAATGGAGCTGGG - Intergenic
1182343361 22:29642826-29642848 AATCAGGGGCAGATGAAGCAGGG - Intronic
1183675612 22:39297384-39297406 AAACATTCAGGGATGAAGCGGGG + Intergenic
949963138 3:9331340-9331362 AAAGATGAAGAGATGAAGCTTGG + Intronic
950575606 3:13830403-13830425 AAACATGAACAGATGGGGCATGG - Intronic
951506427 3:23450131-23450153 AAACTTGCAAAAAAGAAGCAAGG - Intronic
951874479 3:27406989-27407011 AAACATTGAGACATGAAGCAAGG + Intronic
951988712 3:28651245-28651267 AGAGAGGCACAGATGAAACATGG - Intergenic
952668830 3:35941091-35941113 AAACATTCAAAATTGAAGCATGG - Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953267366 3:41404722-41404744 GCACATGCACATATGCAGCAGGG - Intronic
953711569 3:45275566-45275588 AAAGATGCAATGCTGAAGCAGGG + Intergenic
955549543 3:60068775-60068797 AAACAGGCAAAGAAGAAACAAGG + Intronic
955613263 3:60779971-60779993 CAACTTGCACCCATGAAGCAGGG - Intronic
955636930 3:61040700-61040722 AAACATTTGCACATGAAGCATGG + Intronic
956042683 3:65162000-65162022 CAACTTCCAGAGATGAAGCAAGG + Intergenic
956867935 3:73387620-73387642 AAACCTGCACAGATCAAGGCTGG + Intronic
957646116 3:82930698-82930720 AAACATGTAAAGATTAAGAATGG + Intergenic
958030489 3:88103330-88103352 ACACATTAACAGATGAAGAATGG + Intronic
958033137 3:88138042-88138064 AAACATTCACTGATGACTCAAGG - Intronic
959370580 3:105520496-105520518 GAACATGAACAAATGAAGAAAGG - Intronic
960358348 3:116680039-116680061 TAACATGAAGAGCTGAAGCATGG + Intronic
961131187 3:124468503-124468525 GAACATGCACATTTTAAGCAAGG - Intronic
961219931 3:125191760-125191782 AGACATCCACAGATCAAGAAGGG + Intronic
963181039 3:142356642-142356664 AAACATTTACAGAGAAAGCATGG + Intronic
963318525 3:143786792-143786814 ATGAATGCACAGAGGAAGCATGG + Intronic
964654730 3:159053309-159053331 AAACATCCATATAAGAAGCAAGG + Intronic
965902180 3:173655882-173655904 CAAAATGCACAGACAAAGCAAGG + Intronic
966033183 3:175376820-175376842 AAACAACCCCAGCTGAAGCATGG - Intronic
966175081 3:177129847-177129869 AAAAATGCACATATCCAGCAGGG + Intronic
967090439 3:186130400-186130422 AGACATGAACAAATGAAGCCAGG + Intronic
967769419 3:193318140-193318162 AAACAAGCACAGAGTAAGGAAGG + Intronic
968333265 3:197890097-197890119 AAAAATGCACAGATAATGCCAGG + Intronic
968809830 4:2794787-2794809 CCACATGGACAGAGGAAGCAGGG + Intronic
969547387 4:7840179-7840201 AAACATTCACTGATGTAGGAAGG + Intronic
970779270 4:19716255-19716277 AACCTTTCACAGATGGAGCAGGG - Intergenic
970834539 4:20386868-20386890 AAACATGCTCCCATGAACCACGG + Intronic
971002101 4:22335105-22335127 AAACGTGCACAGATGAGGAGAGG + Intergenic
971285070 4:25281107-25281129 GAACATGCACAGACGAGGGAAGG + Intergenic
972116528 4:35642551-35642573 CAAAATGCACAAATAAAGCAAGG + Intergenic
973779445 4:54274466-54274488 AGACATGCACAGGGGCAGCAAGG - Intronic
975401142 4:73941176-73941198 AAACATGCTCGGAATAAGCATGG - Intergenic
976070494 4:81234679-81234701 CACCATGCAAAGAAGAAGCAAGG - Intergenic
976437252 4:85032441-85032463 CAAAATGCACAAATGAAGCAAGG + Intergenic
978930425 4:114304301-114304323 ATACATTCACAGTTGAAGTAAGG - Intergenic
980103159 4:128562096-128562118 AAACATGCACAGAACAAGATGGG - Intergenic
980500509 4:133646269-133646291 AAACATACACATATGTACCAAGG + Intergenic
981104992 4:140870584-140870606 AAACAAGCACAAATCAGGCATGG - Intronic
981696633 4:147565300-147565322 CAAAACGCACAAATGAAGCATGG + Intergenic
982421410 4:155202891-155202913 AAACATGCACAGAAGACCCATGG - Intergenic
983743162 4:171160875-171160897 AAACAGGCAGAAATGAAGAAAGG + Intergenic
984080361 4:175241202-175241224 CAGCATTCACAGAAGAAGCAGGG + Intergenic
984431208 4:179651296-179651318 AAACAGGCAGAAATGAAGCAAGG - Intergenic
984605243 4:181778429-181778451 AAACTTTCAGAGATGAAGAACGG + Intergenic
985983773 5:3495526-3495548 AAATATTCACAGATGAGACAAGG - Intergenic
987550070 5:19368090-19368112 AAAAATGCAAGGATGAAGAAGGG + Intergenic
987753209 5:22067707-22067729 AGACATCCACAGAGGAGGCAAGG - Intronic
988057517 5:26118568-26118590 AAACCTGCACAGAAGAATTATGG + Intergenic
988550473 5:32196559-32196581 AAAAATGCAAAGATGAGCCAGGG - Intergenic
989017952 5:36962253-36962275 ACACATCCACAGATGCAACAAGG + Exonic
989093164 5:37755623-37755645 AAACAGGCAAGGATGAAGAATGG + Intergenic
990047262 5:51448350-51448372 AAAAATGAACAGATGAACCTTGG - Intergenic
990066702 5:51725084-51725106 AAACATACACAAAACAAGCATGG + Intergenic
992068536 5:73129094-73129116 CAAAATGCACAAACGAAGCAAGG + Intronic
992176800 5:74157169-74157191 AAACATGCCGAGAGGAAACAGGG - Intergenic
992909784 5:81384743-81384765 AAACATTTACAGATGATGCTTGG + Intronic
993048237 5:82893526-82893548 GAACACGCATGGATGAAGCAAGG + Intergenic
993573029 5:89566650-89566672 AAACTTGCTTAGATGAAGCATGG + Intergenic
994260811 5:97656390-97656412 AAACATGCACAGAAGGAAGAGGG + Intergenic
994862092 5:105209834-105209856 AAAAAAACACAGCTGAAGCATGG - Intergenic
995023015 5:107387146-107387168 AAACATGCAGAGAAGAAGAAAGG + Intronic
996446359 5:123556743-123556765 AAACATGTACAGAGGAAACATGG - Intronic
996597028 5:125216374-125216396 AGACAGACAAAGATGAAGCAGGG + Intergenic
996933353 5:128917928-128917950 ACAGATGCACAGAAGAAGCAAGG - Intronic
997486598 5:134236140-134236162 AAACATGCACAGAAGAGGGATGG + Intergenic
997840538 5:137235497-137235519 AAACATGCCCAGATAAAGTGTGG + Intronic
998054527 5:139063065-139063087 AAACAGGCAGACAAGAAGCAGGG + Intronic
998179270 5:139925098-139925120 AAACATATTCAGATGAAGTAGGG + Intronic
998506090 5:142674058-142674080 CACCAGGCACACATGAAGCAGGG - Intronic
999048611 5:148496854-148496876 AAACATGAACCACTGAAGCAAGG - Intronic
999220037 5:149968145-149968167 ACAGATGAACAGATAAAGCATGG - Intronic
1000209858 5:159099087-159099109 AAACAGTCACAGACGAGGCAGGG + Intronic
1000281201 5:159783878-159783900 GAGCATGCACACAGGAAGCATGG + Intergenic
1004290869 6:14365780-14365802 AAACATGGAAAGGTGAAGTAAGG + Intergenic
1004525568 6:16404329-16404351 AAACATGCTCAGTTCAAACAAGG - Intronic
1005564279 6:27074250-27074272 AAACATACACAGATTAAAGAAGG + Intergenic
1005816544 6:29557443-29557465 ATACATGAAAAGGTGAAGCAGGG - Intronic
1006431248 6:33998141-33998163 CAACATGCACAAACAAAGCAAGG + Intergenic
1007273372 6:40655618-40655640 AAAGATGCTCAGCTGAAGCAGGG + Intergenic
1007317250 6:40999248-40999270 AAACAGGCAAAGATGGCGCACGG + Intergenic
1007994704 6:46294193-46294215 CAACATGCATAGATGATTCACGG + Intronic
1008956596 6:57222311-57222333 GAGCATGCGCAGACGAAGCACGG - Exonic
1009398010 6:63224569-63224591 AAAGATGGACATTTGAAGCAGGG + Intergenic
1009770740 6:68140347-68140369 AAACTTGCACAGATGAATGCTGG + Intergenic
1010016754 6:71113507-71113529 AAACATGAACAGATGATGTTTGG - Intergenic
1011458173 6:87575013-87575035 AAACATGCAGACAGGAAGGAAGG + Intronic
1012563738 6:100619596-100619618 AAAAATGTACAGATGATGTATGG + Intronic
1012626363 6:101408346-101408368 ACACATACACACATGCAGCAGGG + Intronic
1017041599 6:150312838-150312860 CAAAATGCACAAATAAAGCAAGG - Intergenic
1019267665 7:127458-127480 CAACATCCACAGATTCAGCAGGG - Intergenic
1019912199 7:4107286-4107308 ACACATGCACAGACCAGGCAAGG + Intronic
1019952931 7:4388369-4388391 TGACATCCAAAGATGAAGCAGGG - Intergenic
1019957231 7:4424995-4425017 GAGCATGCCCAGATGAACCAAGG - Intergenic
1019974951 7:4573709-4573731 AAACATGAACAGATGATAGATGG + Intergenic
1020669399 7:11087723-11087745 CCACACACACAGATGAAGCATGG - Intronic
1020677190 7:11196715-11196737 CAACTTGCACCCATGAAGCAGGG - Intergenic
1021239238 7:18180149-18180171 ACACATCAAAAGATGAAGCAAGG - Intronic
1022510246 7:30930732-30930754 AGACGTGCACAGATGCAGCGTGG - Intergenic
1023009697 7:35915572-35915594 AACCATGCAGAGATGAAAAACGG - Intergenic
1023862129 7:44223075-44223097 AAACATGCACATAAGCAGGACGG + Intronic
1024191873 7:47020394-47020416 AAAAATGCACAAACAAAGCAAGG + Intergenic
1024438298 7:49385059-49385081 AAAGATGAATAGTTGAAGCACGG - Intergenic
1026621032 7:71950106-71950128 CAAAATGCACAAATGAAGCAAGG - Intronic
1027737016 7:81945354-81945376 AAAGAAGAACTGATGAAGCAAGG + Intergenic
1028443463 7:90891285-90891307 AAACAAGCAGAGATCAATCAGGG + Intronic
1031741426 7:125436470-125436492 AAGTATGCACAGAGGAAGCTGGG + Intergenic
1032917147 7:136504412-136504434 TCACATTCAAAGATGAAGCATGG + Intergenic
1033984165 7:147202465-147202487 AAACATTTATAGATGAAGAAAGG + Intronic
1035432265 7:158830740-158830762 ACAAATGCCCAGAAGAAGCAGGG + Intergenic
1036524448 8:9521779-9521801 AGACATGCAAAGAAGAAACATGG + Intergenic
1036800840 8:11789738-11789760 AATCATGCAGAGATGAAGGCGGG + Intergenic
1037600690 8:20391478-20391500 AAACATGGAAGGATGAAGTATGG + Intergenic
1037653754 8:20865490-20865512 AAACATGAAGAGAGGAAGAAAGG - Intergenic
1037884412 8:22588848-22588870 AAACATAAAGGGATGAAGCAAGG - Intronic
1038410865 8:27358704-27358726 GAAAAGGCAAAGATGAAGCATGG - Intronic
1038662078 8:29506104-29506126 AAATCTGCCCAGAAGAAGCAGGG - Intergenic
1039010467 8:33087851-33087873 ACACATGCAAATTTGAAGCAAGG - Intergenic
1039564835 8:38543909-38543931 AAACTTGAACATATGAATCAAGG - Intergenic
1041690708 8:60684265-60684287 TGACATGCACAGAGGAAGCAAGG - Intronic
1041991169 8:63993499-63993521 AGAGCTGCACTGATGAAGCAGGG - Intergenic
1042549093 8:69977588-69977610 AATCGTGCAAAGATGAGGCAGGG - Intergenic
1042592857 8:70414531-70414553 AAACATGTATAGATGAAGATGGG - Intergenic
1043094903 8:75955344-75955366 ATATATGCACAGATGATCCATGG - Intergenic
1043626757 8:82271396-82271418 TAAGAGGCACAGGTGAAGCAAGG + Intergenic
1043707844 8:83376404-83376426 AACCATACATAAATGAAGCATGG - Intergenic
1044107189 8:88223980-88224002 AAAGATGCACAGATTATGGAAGG + Intronic
1044786824 8:95803055-95803077 AAACCTACACAGATAAATCAGGG + Intergenic
1044844433 8:96366421-96366443 GAGCATGCCCAGATGAACCAAGG + Intergenic
1046015550 8:108600311-108600333 AAACATGCAAAGCTGGAGAAAGG + Intergenic
1048151087 8:131895149-131895171 AAACATGCACTGAGGTAACAGGG - Intergenic
1049248144 8:141573774-141573796 CAAAATGCACAAATAAAGCAAGG - Intergenic
1049956408 9:696934-696956 ATTGATGCACAGATGAAGAAAGG + Intronic
1050170954 9:2816033-2816055 AAAGATACACACATGAAGTAGGG + Intronic
1050536906 9:6638508-6638530 AAAGAAGCAAAGATGAAGCTGGG - Intronic
1051864118 9:21659710-21659732 AAACATGTACACCAGAAGCATGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053025893 9:34727895-34727917 AGACATACACAGTGGAAGCAGGG - Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053619210 9:39798816-39798838 AAGCATGCACACATGCAGCTGGG + Intergenic
1053877368 9:42558165-42558187 AAGCATGCACACATGCAGCTGGG + Intergenic
1053895295 9:42736523-42736545 AAGCATGCACACATGCAGCTGGG - Intergenic
1054234327 9:62543557-62543579 AAGCATGCACACATGCAGCTGGG - Intergenic
1054264947 9:62908613-62908635 AAGCATGCACACATGCAGCTGGG - Intergenic
1054314176 9:63563322-63563344 AAACATGCAGATATGAAACTTGG + Intergenic
1054874150 9:70077718-70077740 GAACATCCAAAGAGGAAGCAAGG - Intronic
1055766487 9:79669038-79669060 ATACATGCACAAATGAAGCCTGG - Intronic
1056441829 9:86629552-86629574 AATCATGCAAAGGGGAAGCAAGG + Intergenic
1056548475 9:87632710-87632732 ATACATGTAGAGATGAAGGAGGG + Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056991011 9:91410999-91411021 ATACAAGCACAGATGAGGCATGG + Intronic
1056999732 9:91496735-91496757 AAACATGCCCAACTGAGGCAGGG - Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058202187 9:102057946-102057968 AACCATGCACAGTAGAGGCAGGG - Intergenic
1058370915 9:104266605-104266627 AAACAGACACAGATAAAACAAGG + Intergenic
1059215791 9:112560919-112560941 AAGAATTCACAGATGAAGAAGGG - Intronic
1061105274 9:128525339-128525361 CAAGAGGCACAGATGCAGCAGGG + Exonic
1061297973 9:129687260-129687282 CAACATGCACAGATGCTTCATGG + Intronic
1061648132 9:132023126-132023148 AAACATTCATAGGTGAGGCATGG + Intronic
1062161360 9:135082007-135082029 ACACGAGCACAGAAGAAGCAGGG - Intronic
1186952719 X:14645170-14645192 AACCATGCACAGAGCAAACATGG - Intronic
1187252860 X:17614603-17614625 AAACAAACACATATCAAGCATGG - Intronic
1189414810 X:40804383-40804405 CAACATGCACCCATGAAGCAGGG + Intergenic
1192067869 X:67904857-67904879 AAAGATTCATGGATGAAGCATGG + Intergenic
1193170468 X:78329843-78329865 AAAGATAAAGAGATGAAGCAAGG - Intergenic
1193712592 X:84896277-84896299 AAAGATCCATAGAAGAAGCATGG + Intergenic
1193945116 X:87724788-87724810 CAACTTGCACCCATGAAGCAGGG + Intergenic
1194066403 X:89267221-89267243 AGACTTGCACCCATGAAGCAGGG + Intergenic
1194864209 X:99046191-99046213 AAAAATGGACAGATCCAGCAAGG - Intergenic
1197329273 X:125133515-125133537 AAGCATGCACAGAGGAATAATGG + Intergenic
1197406154 X:126053717-126053739 AAACATGCAGGGATGAGGCAAGG + Intergenic
1197705513 X:129631850-129631872 AAACAAGCTCAGATGAAAGAGGG + Intergenic
1198573188 X:137980363-137980385 AAACATGTAGAGAGGAACCAAGG + Intergenic
1198747004 X:139901185-139901207 AAGAATGCCCAAATGAAGCATGG + Intronic
1199279506 X:145983651-145983673 AAACTTGCACATATGTAGGATGG + Intergenic
1200720572 Y:6601342-6601364 AGACTTGCACCCATGAAGCAGGG + Intergenic
1201188017 Y:11422518-11422540 AAACATGAACAAATGGAGCTGGG + Intergenic
1201330867 Y:12819395-12819417 AAAAATGCAAAAATTAAGCATGG + Intronic
1201355579 Y:13093918-13093940 GAAAATGCACAAATAAAGCAAGG + Intergenic
1202044513 Y:20725110-20725132 TAAAATGCACAAACGAAGCAAGG + Intergenic
1202174232 Y:22083043-22083065 AAAAATACAGAGATGAGGCAAGG - Intronic
1202217128 Y:22503339-22503361 AAAAATACAGAGATGAGGCAAGG + Intronic
1202326057 Y:23692731-23692753 AAAAATACAGAGATGAGGCAAGG - Intergenic
1202544714 Y:25977323-25977345 AAAAATACAGAGATGAGGCAAGG + Intergenic