ID: 945345755

View in Genome Browser
Species Human (GRCh38)
Location 2:208713479-208713501
Sequence CAGAATAATTGAATTGAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 279}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945345755_945345758 2 Left 945345755 2:208713479-208713501 CCAAACTCAATTCAATTATTCTG 0: 1
1: 0
2: 2
3: 24
4: 279
Right 945345758 2:208713504-208713526 GGGAGCCAAAGACTAAAGAGTGG 0: 1
1: 0
2: 0
3: 16
4: 197
945345755_945345760 16 Left 945345755 2:208713479-208713501 CCAAACTCAATTCAATTATTCTG 0: 1
1: 0
2: 2
3: 24
4: 279
Right 945345760 2:208713518-208713540 AAAGAGTGGATGAGCCCACAAGG 0: 1
1: 0
2: 0
3: 10
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945345755 Original CRISPR CAGAATAATTGAATTGAGTT TGG (reversed) Intronic
902130096 1:14252785-14252807 CAGAATAAATTTATTGTGTTAGG - Intergenic
908548182 1:65182628-65182650 CAAAATAATTGACTTTAGTTAGG - Intronic
909635342 1:77811622-77811644 CAGAATTATTGTGTTGAGCTTGG + Intronic
909731313 1:78894455-78894477 AAGAATATTTAAATTGATTTAGG + Intronic
909740796 1:79027143-79027165 TAGTAGAGTTGAATTGAGTTTGG - Intergenic
909863499 1:80637251-80637273 CTGAAGCATGGAATTGAGTTTGG - Intergenic
910626623 1:89314234-89314256 CTGAATCTTGGAATTGAGTTTGG + Intergenic
911515883 1:98867412-98867434 CAGACTAATAGAATAGAGTGGGG - Intergenic
911843240 1:102711753-102711775 AAGAATCAATGAATTGAGATAGG + Intergenic
912249441 1:107995536-107995558 CAGTGTAATGGAATTGATTTAGG - Intergenic
914425995 1:147577108-147577130 TAAAATAATTGAATTGCATTTGG + Intronic
914844162 1:151271889-151271911 CAGGATAACTGACTTAAGTTTGG - Intergenic
914982801 1:152430251-152430273 CAAAATAAAAGAATTTAGTTTGG - Intergenic
916100372 1:161389013-161389035 CAGTATAAATGATTTGGGTTTGG + Intergenic
916346818 1:163801677-163801699 CAGAGTCTTTGAAGTGAGTTGGG - Intergenic
917057289 1:170996913-170996935 CAGAAAACTAGAAGTGAGTTTGG + Intronic
918780567 1:188694540-188694562 CAGAATAATGAAGTTGAATTTGG + Intergenic
922123894 1:222703168-222703190 CAGAATTATTGTGTTGAGCTTGG + Exonic
923152330 1:231244562-231244584 CAGGGTAATAGAATTCAGTTTGG + Intronic
923270297 1:232349179-232349201 TTGAATAATTGACTGGAGTTGGG + Intergenic
1063136702 10:3223414-3223436 CAGAAGAGTTGAAATGTGTTTGG - Intergenic
1063184499 10:3638554-3638576 CAAAATAAATGAGTTGAGCTAGG - Intergenic
1064749124 10:18508192-18508214 CACAATAAATGAATTGCTTTAGG + Intronic
1064789777 10:18944348-18944370 CAAAATAATTAAATTTAGGTGGG + Intergenic
1066027413 10:31375219-31375241 CAGAATACTTGAACTCAGGTTGG - Intronic
1067988668 10:51182960-51182982 CACAATAATTCTATTGATTTTGG + Intronic
1069287714 10:66736939-66736961 CTGAATATTTGAATTTAATTTGG + Intronic
1069999902 10:72368468-72368490 TAGGATAAGAGAATTGAGTTTGG - Intronic
1070307608 10:75248888-75248910 CAGATCATTTGAATGGAGTTCGG + Intergenic
1071017337 10:81013089-81013111 CAGATTAATTGATTTGGGATAGG + Intergenic
1073543429 10:104330181-104330203 CTGAATACATGAATGGAGTTAGG + Intronic
1073651792 10:105368334-105368356 CAGTCTAATTAAATTAAGTTCGG + Intergenic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1078975818 11:16475091-16475113 CACAAAAATTGAAGAGAGTTAGG + Intronic
1079606137 11:22369542-22369564 TAGAATAATTGACTTCAGGTAGG + Intronic
1080798092 11:35584200-35584222 TAGAATAATAGACTTGAGTATGG - Intergenic
1084505154 11:69561948-69561970 AAGAAGAATTGAAGAGAGTTAGG + Intergenic
1084998053 11:73002799-73002821 AAGAATAACTTGATTGAGTTTGG - Intronic
1085584529 11:77689238-77689260 CAGAAGAATGAAATAGAGTTGGG - Intronic
1086751747 11:90504480-90504502 CTTGATAGTTGAATTGAGTTTGG + Intergenic
1086763306 11:90661100-90661122 AAGGATAACTGTATTGAGTTAGG - Intergenic
1087256553 11:95961859-95961881 GAGAATCTTTGAAATGAGTTTGG + Intergenic
1087364983 11:97207403-97207425 CATACTTATTGAATTGAATTTGG + Intergenic
1087746847 11:101957277-101957299 GGGAATAATTTAATTGAATTAGG + Intronic
1088062942 11:105679489-105679511 CAGAATAATTGTATTATGTTAGG - Intronic
1088616596 11:111635930-111635952 CACATTAATAGAATTCAGTTGGG - Intronic
1092501767 12:9054578-9054600 TAGAATAGTAGAATTGTGTTAGG - Intergenic
1093654427 12:21678092-21678114 CAGAGTTCTTGAATTCAGTTAGG - Intronic
1094357774 12:29596554-29596576 AAGAATAATTGAGTGGACTTGGG + Intronic
1096829022 12:54300431-54300453 CAGAGTAATGGAATGGAGTTGGG + Intronic
1097296001 12:57963736-57963758 AAGAATAATTCAATGGACTTCGG + Intergenic
1097486588 12:60211037-60211059 CAAAATAGTTGCATTAAGTTAGG + Intergenic
1097940434 12:65298359-65298381 AGTAATAAATGAATTGAGTTTGG + Intronic
1098254629 12:68604461-68604483 TAAAATAACTGCATTGAGTTTGG + Intergenic
1098931926 12:76427256-76427278 GAGAATAATTGAACAGATTTAGG - Intronic
1099494597 12:83331076-83331098 CAGAATTACTGAATTTACTTTGG + Intergenic
1099918736 12:88930498-88930520 CTTAATAATTGAATTGAATTAGG - Intergenic
1099931441 12:89080006-89080028 AAGAATTATTGACTTGAGGTGGG - Intergenic
1100059188 12:90551796-90551818 AAGAATAATATAATTGACTTTGG - Intergenic
1103113876 12:118308454-118308476 TAAAATAATTGAATTTGGTTAGG - Intronic
1104286880 12:127431805-127431827 CAGAATGTTTGCATTTAGTTTGG - Intergenic
1105245642 13:18647695-18647717 CAGAAATATTTAATTAAGTTTGG - Intergenic
1107030056 13:35841625-35841647 CAGAAAATTTGAAATGACTTGGG - Intronic
1107035924 13:35902411-35902433 CAGAAAAGTTGATTTGAGGTGGG - Intronic
1107139543 13:36982851-36982873 CAAATTAATTCAATTGAGCTGGG + Intronic
1107400370 13:40063469-40063491 AAGAGTAATTGAATTAAATTGGG + Intergenic
1108951164 13:56095912-56095934 CAGAATATTTAAACTGTGTTTGG + Intergenic
1109108478 13:58285921-58285943 TAGAATTCTTGAATTGATTTTGG + Intergenic
1109831486 13:67796305-67796327 AAGAATAATTGAATGGCATTAGG + Intergenic
1111190364 13:84799105-84799127 CAGAATAATTGAAGATAATTGGG + Intergenic
1115071836 14:29332598-29332620 CAAAACATTTGAATTGATTTTGG - Intergenic
1116659520 14:47691393-47691415 CAGAACAAATGAATTGTCTTAGG + Intergenic
1116706363 14:48307290-48307312 CCAAATAATAGAATTGAGATTGG - Intergenic
1116799104 14:49424435-49424457 CAGAATACTTGAATTGGATTGGG - Intergenic
1117031433 14:51674974-51674996 GATAATAATTGAATTGACCTTGG + Intronic
1117465919 14:55993926-55993948 CAAAATGATTGAATTAATTTTGG + Intergenic
1118095342 14:62531092-62531114 AAAAAAAATTGAATTCAGTTGGG + Intergenic
1118105412 14:62653638-62653660 CTGAACCATTGAATTGAATTAGG + Intergenic
1119126402 14:72131159-72131181 CAGAATAAGATGATTGAGTTAGG - Intronic
1119987462 14:79154164-79154186 CAAGCTAAGTGAATTGAGTTGGG - Intronic
1121361730 14:93267640-93267662 CAGAGGAAATGAATTGACTTTGG - Intronic
1121592099 14:95123381-95123403 TAGAACAATTGAATTTATTTTGG - Intronic
1125210645 15:37211330-37211352 TAAAATAAAGGAATTGAGTTAGG - Intergenic
1127046591 15:55032466-55032488 CAGAATCATACACTTGAGTTGGG + Intergenic
1127287572 15:57544773-57544795 CAAAATAAGTGACTTGAGTAAGG + Intronic
1128851129 15:70957642-70957664 CAGTTTAATTCTATTGAGTTAGG + Intronic
1129520016 15:76179724-76179746 CAGCATATGTGAATTCAGTTTGG - Intronic
1131560527 15:93435815-93435837 CAGAATAATTGATCTTAGATTGG + Intergenic
1132237330 15:100232130-100232152 CAGAAAAATTGGGTTGGGTTGGG + Intronic
1135588689 16:23690297-23690319 CAGAATATTTCTATTGAATTCGG + Exonic
1139016372 16:62694074-62694096 CAGACTAAAATAATTGAGTTAGG + Intergenic
1139197986 16:64943588-64943610 AAAATAAATTGAATTGAGTTTGG - Intergenic
1140471562 16:75218386-75218408 CAGAAAAAGTGAATTCTGTTGGG + Intergenic
1149109424 17:53009407-53009429 CACAATCTTAGAATTGAGTTTGG - Intergenic
1150735784 17:67737476-67737498 CAGAATTAAAGAATTCAGTTTGG - Intronic
1153988144 18:10371411-10371433 CAGAATAAATGGAATGAGCTAGG - Intergenic
1155734644 18:29205394-29205416 TAGAATAATTTATTTGTGTTGGG - Intergenic
1156980546 18:43282702-43282724 ACGAATGATTAAATTGAGTTAGG + Intergenic
1158018464 18:52812133-52812155 GAAAATGATTGAATTTAGTTTGG + Intronic
1158325340 18:56307833-56307855 CAAAATAATTAATTTGAGTCTGG + Intergenic
1158996065 18:62920907-62920929 CAAAATAATTGAATTGAATGTGG - Intronic
1161888375 19:7014533-7014555 CAGAATTTTTGTATTAAGTTTGG + Intergenic
1164613485 19:29649604-29649626 AAGAATAATTCAGTGGAGTTTGG + Intergenic
1164974939 19:32565815-32565837 ATGAATAATTTAATTGAGCTGGG + Intergenic
926265027 2:11308162-11308184 CAGAATTATTGTGTTGAGCTTGG - Intronic
926393796 2:12421194-12421216 CACACTGATTGAATTGATTTAGG - Intergenic
928877516 2:36057318-36057340 AAGAATAATCCAATTGTGTTAGG - Intergenic
930174707 2:48289945-48289967 CAGATTAACTGAATTAAGATTGG + Intergenic
930310810 2:49737101-49737123 TAGAATAATTTAATTCATTTGGG + Intergenic
930351537 2:50262270-50262292 CAGAAGAATTGAATAGTGTATGG + Intronic
931049125 2:58390240-58390262 CTGAATAAGTGCATTGTGTTAGG + Intergenic
931509153 2:62970720-62970742 AAGAACAATTGAATAAAGTTGGG + Intronic
931787776 2:65636309-65636331 CTGTAAAATTGAAATGAGTTTGG + Intergenic
932039030 2:68278904-68278926 CAGAAAAATAAAATTGAATTTGG + Intergenic
932816665 2:74867340-74867362 AAGAATAATACAATTGACTTTGG + Intronic
933466987 2:82664694-82664716 GAGAATAAATGATATGAGTTAGG + Intergenic
935224254 2:101039326-101039348 CAGAATAATAACATGGAGTTAGG + Intronic
935977805 2:108596471-108596493 CAGATCAATGGAATTCAGTTAGG + Intronic
936135420 2:109889003-109889025 CAGATCAATGGAATTCAGTTAGG + Intergenic
936209277 2:110482482-110482504 CAGATCAATGGAATTCAGTTAGG - Intergenic
936877324 2:117206544-117206566 CAGAAAAAATTAATGGAGTTGGG + Intergenic
939029931 2:137060436-137060458 GAGAAAAATTGAGTTGACTTTGG - Intronic
939339883 2:140881584-140881606 TAGAATAAATGACTAGAGTTTGG - Intronic
939593824 2:144100501-144100523 ACTAATAATTGAATTGAATTGGG + Intronic
939634261 2:144561873-144561895 CAGAATGATTGAAGTGAAGTGGG + Intergenic
939685446 2:145193239-145193261 CAGAAATATTTAATTAAGTTTGG + Intergenic
940424659 2:153516622-153516644 GAGAATAATTGAAGTGAGAGAGG + Intergenic
940515638 2:154681151-154681173 CAGAAAAATTGAATTTGGATTGG - Intergenic
940541742 2:155029022-155029044 CATAATAATTTATTTCAGTTAGG + Intergenic
942569375 2:177297891-177297913 TAGAATAGTTGAATTAAGTTGGG + Intronic
942927839 2:181455573-181455595 GAAAATAATTGCATTGAGTTTGG + Intergenic
943094636 2:183414089-183414111 CAGAATGATTGAATTGATTTTGG - Intergenic
944209692 2:197194091-197194113 CAGAGTAAATAAATTGAGTTAGG + Intronic
945345755 2:208713479-208713501 CAGAATAATTGAATTGAGTTTGG - Intronic
945634562 2:212331662-212331684 CACACTAATTTGATTGAGTTTGG - Intronic
945750534 2:213777150-213777172 CAGAATAGTTGAATTTAAGTAGG - Intronic
945795910 2:214363594-214363616 CAGAATAAATGAATTTATTTTGG + Intronic
1169884248 20:10381134-10381156 CAGAAAAATTAAAATGAGCTGGG + Intergenic
1170028302 20:11915364-11915386 CAAAATAATTTAATTTAGTTTGG - Intronic
1173482474 20:43414009-43414031 CAGAAAAATACAATTGATTTTGG - Intergenic
1174356176 20:49999406-49999428 CAGCTAAATAGAATTGAGTTTGG - Intergenic
1175287971 20:57850584-57850606 AAGAATAATTGAAATGAGGCCGG - Intergenic
1177561094 21:22755104-22755126 CAATTTAATTGAATTGATTTTGG - Intergenic
1177593601 21:23206645-23206667 CAAAATAATTGAGTAAAGTTAGG - Intergenic
1177853158 21:26372721-26372743 AATAATAATTGAAGTGAGGTTGG - Intergenic
1184325883 22:43784234-43784256 AAGAGTAATTTCATTGAGTTTGG - Intronic
949629142 3:5903476-5903498 TAGAATATTTGAGTTGACTTAGG - Intergenic
951103282 3:18714258-18714280 CAGAATCAATGACTTGAATTTGG - Intergenic
951310403 3:21118087-21118109 CAGAATATTTGATTTGATTCTGG - Intergenic
951322255 3:21259590-21259612 GAAAATAATAGAATTAAGTTTGG + Intergenic
951602470 3:24391650-24391672 CAGAATAATAGAAATTAATTAGG - Intronic
952193259 3:31046351-31046373 CAGAAGCTTGGAATTGAGTTTGG - Intergenic
952500372 3:33956197-33956219 GAGAATAATTAAATTGGGTGAGG + Intergenic
952647341 3:35676845-35676867 CAGAATAATTGTTTTGAGAATGG + Intronic
952800460 3:37285959-37285981 TAGAATAATTGCATTTATTTAGG + Intronic
953049366 3:39326998-39327020 CAGTAGAATTGAATTTAGATGGG + Intergenic
953511699 3:43547654-43547676 CAGATTAAGTGAATCGAGTGAGG + Intronic
954902472 3:54031710-54031732 CAGAATGAATGAATAGAGATTGG - Intergenic
955556873 3:60147700-60147722 AAGAATAAAGGAGTTGAGTTAGG + Intronic
956648923 3:71485105-71485127 CAGTATAATTTAATTGATATGGG - Intronic
959329350 3:104983227-104983249 CAAAACAATTGAATAGAATTAGG - Intergenic
959915767 3:111815286-111815308 CAGAAATATGGAAGTGAGTTTGG + Intronic
960458545 3:117903712-117903734 CAAAACAGTTGAGTTGAGTTTGG + Intergenic
963378957 3:144505034-144505056 AAGAATAATTGTATTATGTTAGG - Intergenic
963609332 3:147445215-147445237 CAAAATAATTTTATTGTGTTAGG + Intronic
963788329 3:149557672-149557694 ATAAATAATTGAATTAAGTTGGG - Intronic
966664940 3:182461498-182461520 TAGAGTAATTGAATGGAGGTTGG - Intergenic
966695156 3:182782256-182782278 CAGGATAATTTAATAGATTTGGG + Intergenic
967633183 3:191770966-191770988 AAGAATAATTGCATTATGTTTGG - Intergenic
968013600 3:195304976-195304998 CAGAACACTTGAATGGAGTTGGG - Intronic
968895866 4:3402859-3402881 CATAATAAATGAAGTCAGTTAGG + Intronic
970172058 4:13300158-13300180 CTGAAATATTGAATGGAGTTTGG + Intergenic
971033164 4:22663358-22663380 GAGAATAATAGAATCTAGTTTGG + Intergenic
971993741 4:33936007-33936029 TAGATTAATTTAATTGAGTTTGG + Intergenic
972092041 4:35299240-35299262 CAGGAAAATTTAATTGAGTGGGG - Intergenic
972797203 4:42433451-42433473 CAGTTTAATTGAACTGAATTGGG + Intronic
972923166 4:43968632-43968654 CACAAAAATTAAATTGAGATGGG - Intergenic
974661631 4:64897776-64897798 CAGAATAATTAAACTGAGATTGG + Intergenic
976153586 4:82118304-82118326 CACTATCATTGAATTGAGGTAGG + Intergenic
978562113 4:110044249-110044271 TAGAATAAATGAATTTAGGTGGG - Intergenic
979065672 4:116129489-116129511 CAGAATAATTTAATGGAGAGAGG - Intergenic
979449716 4:120856098-120856120 CTGAATAATTGAACATAGTTGGG - Intronic
979625294 4:122838013-122838035 GAGTATAATTGAAGTGAGATTGG + Intronic
979711380 4:123783843-123783865 CAGAATAGTTGAAAAGAGTTTGG - Intergenic
979910962 4:126365170-126365192 AAGAATAATCAAATTGAATTAGG + Intergenic
980309773 4:131111399-131111421 CTGAATAATGGAATTCTGTTAGG - Intergenic
980365409 4:131797994-131798016 AAAAAAAATTAAATTGAGTTAGG - Intergenic
980582076 4:134768515-134768537 CAGAATAGTTGTATTTTGTTAGG - Intergenic
981311957 4:143306242-143306264 CAAAATAATTGACTTGAGGCAGG - Intergenic
982558877 4:156904110-156904132 CAGAAAAATTGGATTAAGTTGGG + Intronic
982667062 4:158277895-158277917 CAGAATTATTGTGTTGAGCTTGG - Intergenic
983087979 4:163470797-163470819 CAGAGTAATTTAATTTAGTTTGG + Intergenic
983206573 4:164916747-164916769 CAGAATAATTATATTGTATTGGG + Intergenic
983212050 4:164968801-164968823 CAGAATAATTATATTGTATTGGG - Intronic
983378029 4:166954752-166954774 CAGAGAAATTGGATTGAATTTGG - Intronic
983882203 4:172945832-172945854 CTGAATAATTGTAGTGAGGTTGG + Intronic
984676869 4:182559044-182559066 AAGAATAATTTAACTGGGTTGGG - Intronic
986361474 5:6982169-6982191 AAGGAGAATTGAATTGAGTCTGG - Intergenic
988088845 5:26508451-26508473 GAGAATAATTTTATTGAGTGAGG - Intergenic
988983403 5:36594209-36594231 CAGAATAATAGAATAGAAATTGG + Intergenic
989791897 5:45414462-45414484 CAGGTTAAATGAATTCAGTTTGG - Intronic
990705481 5:58524230-58524252 CAGAAGATTTGAATTCAGTCTGG - Intergenic
990740958 5:58912267-58912289 CAAAATAATTGAAATCAGTAAGG - Intergenic
991982983 5:72252699-72252721 CTGAATAATGGAATTGCATTTGG + Intronic
992711615 5:79463791-79463813 AAGAATAACTGCATTGAGATGGG + Intronic
992772084 5:80058574-80058596 CAGAATCTTTGAATTTAATTTGG - Intronic
993328152 5:86567120-86567142 CCGAATAAAAGAAATGAGTTCGG + Intergenic
993643133 5:90430214-90430236 GAGAATAATGGAATAAAGTTGGG + Intergenic
993703885 5:91148499-91148521 CAGAAGACAAGAATTGAGTTTGG + Intronic
994478857 5:100307349-100307371 TAGAATAATATTATTGAGTTTGG + Intergenic
996136009 5:119842966-119842988 CAGTATAATTGATCTGTGTTAGG + Intergenic
999888447 5:155950357-155950379 CACAATAATTGAACTGTCTTAGG + Intronic
999995538 5:157088916-157088938 AAGAATAATGGAATGGGGTTGGG - Intronic
1000780238 5:165471427-165471449 AAGAATGATACAATTGAGTTTGG + Intergenic
1002932808 6:1646066-1646088 AAGAACAATTGCATTTAGTTGGG - Intronic
1003796724 6:9613390-9613412 CAGAATAAAAGAAATGAGATGGG + Intronic
1004105415 6:12663171-12663193 CATAGTAATTGACATGAGTTAGG + Intergenic
1004444542 6:15686000-15686022 CAGATTATTTGAATTGGGATTGG + Intergenic
1004871415 6:19908357-19908379 CATGATAATTGAATTTGGTTTGG - Intergenic
1006231588 6:32592239-32592261 GAGAGTAATAGAATGGAGTTAGG - Intergenic
1007143650 6:39604305-39604327 CATATTAAATGAATTGAATTAGG + Intronic
1008505734 6:52227840-52227862 TAGACTAATTGAATTGAATTGGG + Intergenic
1008824119 6:55670913-55670935 CATTATATTTGAAGTGAGTTTGG - Intergenic
1008843308 6:55930899-55930921 CAGTATAATTTAATTAAATTTGG - Intergenic
1008906915 6:56688096-56688118 TAGAATAATTGTATAGAATTTGG - Intronic
1008942171 6:57058950-57058972 CAAAATAATTGATTTGACTTTGG - Intergenic
1009059792 6:58385217-58385239 GAGAATAATTGAAATTATTTTGG + Intergenic
1009517453 6:64638023-64638045 CAGTATATTTGAATTGTGTTGGG - Intronic
1009709980 6:67305561-67305583 CAGATAAATAGAATGGAGTTGGG + Intergenic
1009784319 6:68313112-68313134 GGGAATAATGGAATTCAGTTGGG + Intergenic
1010158534 6:72823878-72823900 CAGACTAATAGATTTGAGGTTGG - Intronic
1010628715 6:78171209-78171231 CAGAAAAAATTAATTCAGTTTGG - Intergenic
1012218595 6:96619982-96620004 CAGAAAAATTCAATTGAAGTGGG - Intergenic
1012643842 6:101655390-101655412 AAGATTAATTGAATTAGGTTGGG - Intronic
1013101667 6:106992298-106992320 GCCAATACTTGAATTGAGTTTGG - Intergenic
1013841319 6:114397734-114397756 CAGAATAGTTGCATTATGTTAGG - Intergenic
1014506084 6:122258799-122258821 CAGAATAATAGAATGGAAATAGG - Intergenic
1014689962 6:124551254-124551276 TAGAAAAATATAATTGAGTTTGG + Intronic
1015641452 6:135337890-135337912 TAGAATATTTGGATTGACTTTGG - Intronic
1016015290 6:139177767-139177789 CAGAATATGTGAAATGAATTTGG + Exonic
1016114922 6:140268950-140268972 CTCAATAATTGAATTGAACTTGG - Intergenic
1016180603 6:141142988-141143010 CAGAATGATAGAATGGACTTTGG - Intergenic
1019076605 6:169393335-169393357 CAGAGGCATGGAATTGAGTTTGG + Intergenic
1019815996 7:3201266-3201288 CAGGATAATTGAATATAGTAAGG + Intergenic
1020869123 7:13605816-13605838 AAGAAAAATAGAAATGAGTTAGG + Intergenic
1020907281 7:14079351-14079373 CAGAAAAATGGAATTGGGCTGGG + Intergenic
1021689225 7:23216073-23216095 TAGATTAATTGCATTGTGTTTGG + Intergenic
1021960068 7:25862112-25862134 CATAATCATTGAATTGATCTGGG + Intergenic
1023532648 7:41174414-41174436 CAGGATATTTGAATTGAGTTAGG + Intergenic
1027559596 7:79711252-79711274 CAGAATGTTTGAATTTGGTTTGG + Intergenic
1027620557 7:80480119-80480141 CAGAATAACTAAATTGACTGTGG + Intronic
1028360355 7:89960115-89960137 TAGAATAATTGTATTATGTTAGG - Intergenic
1028959643 7:96734316-96734338 TAAAATAACTGAATTGATTTGGG - Intergenic
1029406760 7:100379858-100379880 CAGACTAATGGAATTGGTTTAGG + Intronic
1029408679 7:100394047-100394069 AAGAATAATTGAATAGATATTGG + Intronic
1031250714 7:119376968-119376990 TAGAGTAATTGAAATAAGTTTGG - Intergenic
1031276599 7:119732024-119732046 CAGAATAATTGCATCATGTTAGG - Intergenic
1031836039 7:126683219-126683241 CACAATAATTCAATTATGTTAGG - Intronic
1036521505 8:9495582-9495604 CAGAAGGATTTAATTGAGCTTGG - Intergenic
1036586062 8:10124798-10124820 AAAAATAATTGAATTAAATTGGG + Intronic
1038984839 8:32797279-32797301 CAGAATAATTGGAGAGAATTTGG + Intergenic
1039342223 8:36663416-36663438 TAGAATAATTTTATTGTGTTAGG + Intergenic
1039555904 8:38474721-38474743 CAGAATAATAAAATTCAGTTAGG - Intergenic
1040426234 8:47289458-47289480 CAGAATAATTGATTTTTATTAGG + Intronic
1040960688 8:53029124-53029146 TAGGATAATTAAAATGAGTTTGG + Intergenic
1042895580 8:73663888-73663910 CTGAATAAGTGAATTTAGTAAGG - Intronic
1045215771 8:100146844-100146866 CATAATAATTTTAGTGAGTTTGG - Intergenic
1045614252 8:103888988-103889010 CCCAATAATTGAATTCAGTGAGG + Intronic
1045746859 8:105432574-105432596 CAGAACAATAGAATTGTGATGGG + Intronic
1046082717 8:109391536-109391558 CAGAACAATTAATTTGGGTTTGG - Intronic
1047492234 8:125384556-125384578 GAGAATAATAGAATTTATTTGGG + Intergenic
1047758635 8:127937769-127937791 CATAAAGATTGAATTGAATTGGG - Intergenic
1050365989 9:4874239-4874261 CAGAATATGTGCATTGATTTAGG + Intronic
1051004497 9:12326631-12326653 CATAATAATTGTATTTATTTTGG + Intergenic
1051018020 9:12504922-12504944 CAGAATAATCTGATTGAATTGGG + Intergenic
1053041582 9:34878184-34878206 CAGAAAAATTGAGTGGAGTATGG - Intergenic
1053629762 9:39923857-39923879 AAAAAAAATTAAATTGAGTTAGG - Intergenic
1053776002 9:41539690-41539712 AAAAAAAATTAAATTGAGTTAGG + Intergenic
1054214125 9:62326845-62326867 AAAAAAAATTAAATTGAGTTAGG + Intergenic
1054365729 9:64338802-64338824 AAAAAAAATTAAATTGAGTTAGG - Intergenic
1054673358 9:67828512-67828534 AAAAAAAATTAAATTGAGTTAGG - Intergenic
1055940916 9:81648601-81648623 TTGAATAATTGATTTCAGTTGGG - Intronic
1056673821 9:88655933-88655955 CAGAATAATATAATGGACTTTGG + Intergenic
1057634909 9:96755582-96755604 AAGGATAATTGAATCAAGTTTGG - Intergenic
1058426814 9:104882569-104882591 CAGACTAATTGAAATGATTAGGG + Intronic
1059808537 9:117830562-117830584 CAGAAGAATAGCATTCAGTTAGG + Intergenic
1060136283 9:121158249-121158271 CAGAAGTATTGTATTGAGTTGGG - Intronic
1060359194 9:122939058-122939080 CAGAATATTTGATTGTAGTTAGG + Intergenic
1062366961 9:136214817-136214839 CAGAATAAGTGAAATCTGTTTGG - Intronic
1187712798 X:22071113-22071135 CAGCAGAATTGAATTGAGTGAGG + Intronic
1189616594 X:42790091-42790113 CAGAAGCTTGGAATTGAGTTTGG + Intergenic
1192394989 X:70771568-70771590 CAGAATCATTGAAATGGATTTGG - Intronic
1193566024 X:83078181-83078203 CAGCATAATTGGAATGAGTCAGG - Intergenic
1193716278 X:84938298-84938320 CAGAATAACTGAGCTGATTTGGG + Intergenic
1194059756 X:89182229-89182251 CTGAATCTTGGAATTGAGTTTGG + Intergenic
1194106625 X:89777458-89777480 CAAATTAATTGAAATGATTTTGG + Intergenic
1194108536 X:89802122-89802144 CAGGATAATTGCATTATGTTAGG - Intergenic
1194119263 X:89939829-89939851 GAGAATACTAGAGTTGAGTTTGG + Intergenic
1195888463 X:109667135-109667157 TAGAATAATGGCATTGATTTTGG + Intronic
1196237603 X:113300196-113300218 CAGCAGTAATGAATTGAGTTTGG - Intergenic
1196594424 X:117527051-117527073 GAGAATTATTGAATTGATTTTGG + Intergenic
1199487279 X:148362052-148362074 CATGATATTTGAATTGAGGTCGG + Intergenic
1199590839 X:149467209-149467231 AAGCATAATTGAATTCAGTCTGG - Intergenic
1199702209 X:150390022-150390044 TAGAGTAATAGAATAGAGTTTGG + Intronic
1200458589 Y:3425322-3425344 CAAATTAATTGAAATGATTTTGG + Intergenic
1200461194 Y:3456853-3456875 CAGGATAATTGCATTATGTTAGG - Intergenic