ID: 945346567

View in Genome Browser
Species Human (GRCh38)
Location 2:208724778-208724800
Sequence CTAGACAATGATGCATTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 138}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945346567 Original CRISPR CTAGACAATGATGCATTTGT AGG (reversed) Intronic
902666948 1:17946184-17946206 CCAGGCCATGATGCATTTGCTGG - Intergenic
904382751 1:30122571-30122593 ATAGACTATGTTGCATGTGTAGG - Intergenic
907251768 1:53144198-53144220 TTGGAAAATGAGGCATTTGTTGG - Intergenic
908215829 1:61950821-61950843 CTACACAATCATCCATTTTTGGG + Intronic
909041466 1:70657815-70657837 CTATACAAAGAGGCATTTTTGGG + Intergenic
909345381 1:74579056-74579078 CAAGACAATGATGTAATAGTTGG + Intronic
909491126 1:76227427-76227449 CTAGACAGTGAAGCACTTGAGGG + Intronic
910121246 1:83792686-83792708 CTAGATACAGATGAATTTGTAGG - Intergenic
913176604 1:116278430-116278452 CTAGGCAATGATGCAATATTAGG + Intergenic
919047289 1:192469507-192469529 ATAAACTATGATGCATTTTTTGG + Intergenic
921403399 1:214751951-214751973 GTAGAAAAAGATGCATTTCTTGG - Intergenic
921600833 1:217104685-217104707 CTAGAGAATCAAGCATTTGGTGG + Intronic
922577136 1:226668770-226668792 ATAGACAAAGCCGCATTTGTTGG - Intronic
923892485 1:238231488-238231510 AGGGACAATAATGCATTTGTGGG - Intergenic
1063126479 10:3140861-3140883 ATAGACAATGAAGTAATTGTTGG + Intronic
1069908043 10:71743592-71743614 CTAAACAAGGATACATTTATAGG + Intronic
1069930229 10:71876786-71876808 CTTGCAAATGATGCATTTGGTGG - Intergenic
1070500760 10:77070640-77070662 GTAAACAATAATCCATTTGTAGG + Intronic
1073452780 10:103619479-103619501 CTAGGCAAGGTTGCATTTGCAGG + Intronic
1073516656 10:104081947-104081969 CTAGACACTTTTGCCTTTGTAGG - Intronic
1073843224 10:107522365-107522387 CTAGACTAGAATGCATTTGAGGG - Intergenic
1076498385 10:130914672-130914694 CAAGGCAAGGATGAATTTGTGGG + Intergenic
1077757161 11:5044672-5044694 CTACAAAAAGATGCAGTTGTGGG - Intergenic
1080639672 11:34151525-34151547 CTAGACTAGGTTGCCTTTGTGGG - Exonic
1082124745 11:48418869-48418891 CTTCTCAATGAAGCATTTGTGGG + Intergenic
1082558402 11:54590108-54590130 CTTCTCAATGAAGCATTTGTGGG + Intergenic
1085444677 11:76592410-76592432 CTGGGAAATGCTGCATTTGTGGG + Intergenic
1086499213 11:87435020-87435042 ATAGCCAGTGATGAATTTGTGGG - Intergenic
1088951754 11:114578719-114578741 GTAGACAATAATGGTTTTGTAGG + Intronic
1090671392 11:128948615-128948637 CAAGATAATGATGAATTAGTAGG + Intergenic
1093364949 12:18282610-18282632 CTTGAGAAGGATGAATTTGTTGG - Exonic
1095822127 12:46489742-46489764 CAAGGCCATGATGCATTTGAAGG - Intergenic
1096594188 12:52684191-52684213 GTACATATTGATGCATTTGTTGG + Intergenic
1098742494 12:74191638-74191660 ATAGTCAATAATGCATTTTTAGG + Intergenic
1099849871 12:88080007-88080029 TTAGACAATGCTGTTTTTGTGGG - Intronic
1099921783 12:88967171-88967193 CTAGACAATGTTCCAGTTCTGGG + Intergenic
1104201492 12:126593992-126594014 CCAGACAATTATGCAGATGTGGG - Intergenic
1110539147 13:76688278-76688300 CTTGACAATGATACACTTCTAGG - Intergenic
1112064128 13:95773566-95773588 CTTGACATTGCTGAATTTGTTGG + Intronic
1112542525 13:100329653-100329675 CAAGACAATGAACCATTTCTTGG + Intronic
1113790065 13:113023521-113023543 CGAGACAAAGCTGCAGTTGTCGG + Intronic
1114413696 14:22524579-22524601 CTTCACAATGGTACATTTGTTGG + Intergenic
1114900841 14:27055685-27055707 CTGGACATTGATGAATCTGTAGG + Intergenic
1114906973 14:27141252-27141274 CAAGAAAATGTTGCATCTGTAGG + Intergenic
1118537392 14:66783057-66783079 CTAGACAAACAGGCTTTTGTAGG - Intronic
1119462670 14:74821478-74821500 AGAGACAATTATGCATATGTTGG - Intronic
1119952701 14:78762152-78762174 ATACACAATGACACATTTGTAGG - Intronic
1120157353 14:81108406-81108428 ATTGACAAAGATGCATTTGGAGG + Exonic
1125702418 15:41698869-41698891 CTAGACATTCATGCAGTTGATGG + Exonic
1126341156 15:47642529-47642551 CTAGACAGTGAAGCCTTTGAGGG - Intronic
1128282165 15:66404893-66404915 ATAGACAAGGATGCATCTGTAGG + Intronic
1132019860 15:98351570-98351592 CTAGACAACCTTGCATTTGTGGG - Intergenic
1133453215 16:5920720-5920742 CTAGACAATGATGTCGGTGTGGG + Intergenic
1133575788 16:7087839-7087861 CAAGATGATGATGTATTTGTGGG + Intronic
1134551889 16:15142402-15142424 CAAGACCTTGCTGCATTTGTGGG - Intergenic
1137298844 16:47126286-47126308 CTAGACAATGAAGTATTATTTGG + Intronic
1137462231 16:48675531-48675553 ATAGACAATGATTCCTCTGTTGG + Intergenic
1144050734 17:11495334-11495356 ATAGACTAAGCTGCATTTGTGGG + Intronic
1144543921 17:16174408-16174430 CTTGAAAATTATGCTTTTGTAGG - Intronic
1155037910 18:22040846-22040868 CTAGACTATGAAGCACTTGAGGG + Intergenic
1159971246 18:74657419-74657441 CTACACAATAATGCATTTTCTGG - Intronic
1163413759 19:17172983-17173005 CTCGACAGTGACGCTTTTGTGGG - Intronic
927278424 2:21281604-21281626 TTACATAATGATGCATTTCTTGG + Intergenic
927311032 2:21631443-21631465 ATAGAAAATAATGAATTTGTAGG + Intergenic
930214140 2:48675777-48675799 CTATACAATGATTAATTTCTAGG + Intronic
932321861 2:70828379-70828401 CAAGGCAATGCTGCACTTGTTGG + Intergenic
932845356 2:75129658-75129680 TAAGAAAATGATGCATTTTTTGG + Intronic
935499268 2:103818473-103818495 CTATAGAAAGATACATTTGTTGG + Intergenic
935876334 2:107511971-107511993 CTAGAAAGAGATGCATTTGGGGG + Intergenic
937742740 2:125375503-125375525 GTAGAGAATGATCCACTTGTTGG - Intergenic
942673190 2:178398992-178399014 CTAGATAATGAGGTGTTTGTGGG + Intronic
945088411 2:206156875-206156897 CTAGACAATGAGCTATTAGTAGG + Intronic
945346567 2:208724778-208724800 CTAGACAATGATGCATTTGTAGG - Intronic
946350561 2:219148781-219148803 TTAGACTATGCTGCATTTGTGGG - Intronic
946407780 2:219501305-219501327 CTGGACAATGAGGAATTTGGAGG - Intronic
946417312 2:219546627-219546649 CCAGAAAATGAGGTATTTGTAGG - Intronic
948732139 2:239972706-239972728 CTAAATAATGATATATTTGTAGG - Intronic
1169906197 20:10607206-10607228 CATGACAATGAGGCATCTGTAGG + Intronic
1170147794 20:13196053-13196075 CTAGGCCATGATAAATTTGTGGG + Intergenic
1173899464 20:46576518-46576540 CAGGACAATGATGCATCTGCAGG + Intronic
1175525166 20:59628732-59628754 CCAGAGAAGGATGGATTTGTGGG + Intronic
1178715194 21:34957984-34958006 CTTTACAAGGATGCATTTGTTGG - Intronic
950267049 3:11581883-11581905 CTAGACAATGGTGCATAGTTTGG - Intronic
956051769 3:65255719-65255741 CCAGACACTGATACATCTGTGGG + Intergenic
962648963 3:137468664-137468686 CAAAACAATGATGCATTGCTGGG + Intergenic
966144032 3:176789475-176789497 CTTGATAATGATTCATTTCTAGG - Intergenic
967681267 3:192366759-192366781 CTAGAAAAGGAAGCATTTGGAGG + Intronic
972517627 4:39822858-39822880 CTATATAATGCTGCATTTCTTGG + Exonic
975134658 4:70862974-70862996 CTGTATAATGATGCATATGTAGG + Intergenic
975681126 4:76877262-76877284 CTAGAAAATGATGAATTAATGGG + Intergenic
978531479 4:109719184-109719206 GTATGCAATGAAGCATTTGTGGG - Intronic
978693643 4:111547660-111547682 CTAGACTATGATGCTTATGAGGG + Intergenic
979345476 4:119581691-119581713 ATATACAATGAAGTATTTGTAGG + Intronic
981211190 4:142107907-142107929 CAAGAGAATGATGCAGGTGTTGG + Intronic
984534031 4:180950582-180950604 CTTGGCATTGATACATTTGTGGG + Intergenic
986074550 5:4321577-4321599 CAAGGCAATGATGCACTTGAAGG + Intergenic
986954167 5:13130300-13130322 CTACACATTTATTCATTTGTGGG + Intergenic
987613829 5:20246645-20246667 CTCAACCATGATGCATTTATGGG + Intronic
988616307 5:32778317-32778339 CTAAACAATGGTCCATTTGAGGG + Intronic
989733636 5:44676692-44676714 CAAGAAAATGATGCATTTAGTGG + Intergenic
990367192 5:55083054-55083076 GTAAACAATGATAAATTTGTAGG - Intergenic
990968716 5:61479346-61479368 CTAGCCCATGAGGAATTTGTTGG + Intronic
995405994 5:111796634-111796656 CTAGACTATGATACTGTTGTAGG - Intronic
995677771 5:114682398-114682420 TTAGACCATGATGGATTTGGTGG - Intergenic
1000751882 5:165106062-165106084 CTAGAAAATAATGTTTTTGTTGG - Intergenic
1003399023 6:5776333-5776355 CTAAGCAATGATGCATTTTTGGG - Intergenic
1008239430 6:49090755-49090777 CTAGCCTATCATTCATTTGTTGG + Intergenic
1008731934 6:54493071-54493093 CTAGAAAATGATGTTTTTATAGG + Intergenic
1012721223 6:102748193-102748215 CTAGAGAATCATCCATATGTAGG - Intergenic
1016605449 6:145917633-145917655 CTGGACACTGATGAATTGGTGGG - Intronic
1019753957 7:2754368-2754390 CTAGATAATGAGTCCTTTGTCGG + Intronic
1021879112 7:25076715-25076737 CTAGAAAAAGATTCATTTTTTGG - Intergenic
1023462000 7:40408562-40408584 CTCCACAATGATGCAACTGTGGG - Intronic
1024785200 7:52899487-52899509 CTAGACATTGTTGCTTTAGTTGG + Intergenic
1026143857 7:67728814-67728836 AAAGTCAATTATGCATTTGTGGG + Intergenic
1026955571 7:74374377-74374399 CTAGATCAAGATGCATTTGGAGG - Intronic
1027805682 7:82818663-82818685 CAAGACAATGTTATATTTGTCGG + Intronic
1029794262 7:102876832-102876854 CTTGAAAATCATGCATTTGGAGG - Intronic
1031211050 7:118826659-118826681 CTAGAAAATTATCCATTTGAGGG + Intergenic
1034626510 7:152497330-152497352 GTAGACAATGATCCATTTACGGG + Intergenic
1038806623 8:30799350-30799372 CGAGAGAATGATACATTTATCGG + Intronic
1042171128 8:65992077-65992099 CTAGACAATGAAATATTTGAGGG - Intergenic
1046850111 8:118962416-118962438 GTAAAAAATAATGCATTTGTTGG - Intergenic
1048072350 8:131035384-131035406 CTAGACAATAATCTCTTTGTTGG + Intronic
1048353714 8:133636324-133636346 CTTGACAATGGTTCTTTTGTTGG + Intergenic
1050466648 9:5932769-5932791 CTATACAATGCTGTATTTCTTGG + Intronic
1050640280 9:7660295-7660317 CTTAACAATGATGCATCTGAAGG + Intergenic
1050744463 9:8859271-8859293 CTAGACAAGCATCCAGTTGTTGG + Intronic
1052755566 9:32537455-32537477 ATAGACAAAAAAGCATTTGTGGG - Intergenic
1053139158 9:35671693-35671715 CTATTCAATGCTGCATCTGTAGG + Intronic
1053476980 9:38389349-38389371 CAAGACACTGAGGCATTTGCAGG - Intergenic
1054351651 9:64021548-64021570 ATAGAAAATGATGCAGTTGCTGG - Intergenic
1059989441 9:119851297-119851319 CTAAAAACAGATGCATTTGTTGG + Intergenic
1060735999 9:126066922-126066944 CTAGACAGCGAGGCATTTGGGGG + Intergenic
1061875110 9:133539706-133539728 CTGGACAAAAATGCCTTTGTCGG + Intronic
1186304006 X:8234211-8234233 ATAGACAGTGATTCATCTGTTGG - Intergenic
1186326857 X:8487499-8487521 CTAAACAATGATGCATCTCTGGG - Intergenic
1188554415 X:31395902-31395924 CTAAACAATGAAGAATTTATGGG + Intronic
1188681457 X:33013084-33013106 CTACCCAATAATGCATTTTTGGG - Intronic
1189337256 X:40177252-40177274 CTAGACAAGGCTGCATGTGCGGG - Intronic
1189553468 X:42117111-42117133 CTAGACAATGTTGGGTGTGTGGG - Intergenic
1189850586 X:45172606-45172628 CTTGTCACTGAAGCATTTGTGGG + Intronic
1197072435 X:122315080-122315102 CTAAATAATGATGTATTTGTTGG + Intergenic
1197173468 X:123460113-123460135 TTAGGTAATGATGCATTTCTAGG - Intronic
1197677921 X:129350410-129350432 CTTGAGAATGATGCATGTGCTGG - Intergenic
1197831459 X:130647464-130647486 TTAGAGAATGCTGCATGTGTAGG + Intronic
1201435131 Y:13950445-13950467 CTAAACAATGATGCATCTCTGGG + Intergenic