ID: 945352405

View in Genome Browser
Species Human (GRCh38)
Location 2:208796809-208796831
Sequence TAGGTTCGCATACATGTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 46}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945352405_945352407 -4 Left 945352405 2:208796809-208796831 CCTAGAACATGTATGCGAACCTA 0: 1
1: 0
2: 0
3: 4
4: 46
Right 945352407 2:208796828-208796850 CCTAATGCCCTAGTAATAGCAGG 0: 1
1: 0
2: 0
3: 1
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945352405 Original CRISPR TAGGTTCGCATACATGTTCT AGG (reversed) Intronic
904005777 1:27362481-27362503 TGGGTCCTCATACCTGTTCTGGG - Intronic
904636116 1:31882964-31882986 TAGGTTAGCTTATATTTTCTAGG - Intergenic
906889369 1:49691400-49691422 CAGGTGTGCAGACATGTTCTTGG + Intronic
910811456 1:91241712-91241734 TGGGATTGCATATATGTTCTGGG + Intergenic
911255854 1:95632494-95632516 TAGGTTAACATGCATGCTCTCGG + Intergenic
924954127 1:248911081-248911103 TAGGTTAGCTTACATTTTCTAGG + Intronic
1068455763 10:57251614-57251636 TAGGTTCTCAAACACTTTCTGGG - Intergenic
1071991290 10:91102931-91102953 GAGGAGCGCATCCATGTTCTAGG - Intergenic
1078276424 11:9852187-9852209 CAGATTCCCAGACATGTTCTGGG + Intronic
1078285437 11:9949263-9949285 TTTGTTCTCATACATTTTCTAGG + Intronic
1082730142 11:56785894-56785916 TAGGTTTGCCTACATGTGTTAGG + Intergenic
1085131818 11:74046292-74046314 TAGGTTAGGATGCATTTTCTAGG + Intronic
1085780817 11:79407112-79407134 TAGGTACTCATACATATTCGTGG - Intronic
1088128379 11:106457083-106457105 AGGGTTCCAATACATGTTCTAGG - Intergenic
1091940764 12:4478722-4478744 TAGGTTTCCATTTATGTTCTAGG + Intergenic
1093430438 12:19079259-19079281 TTAGTTCTCATACATGTACTAGG - Intergenic
1107345901 13:39460572-39460594 TAAGTATGCACACATGTTCTGGG - Intronic
1110683012 13:78338326-78338348 TAGCTTGACATACTTGTTCTTGG - Intergenic
1112303552 13:98252368-98252390 CAGGTTCACATTCATGTTCTTGG + Intronic
1115062023 14:29203604-29203626 TAGCTTCTCTGACATGTTCTAGG + Intergenic
1115911086 14:38256436-38256458 TATGTTCGCTTACGTGTTATGGG - Intergenic
1117018991 14:51549953-51549975 TAGGTTAGCGGACATGTGCTGGG - Intronic
1120163241 14:81168010-81168032 TAGGTTTCCATCCATGTTCCTGG + Intergenic
1133528240 16:6627288-6627310 TAGGTGTGCTTACCTGTTCTAGG + Intronic
1140048668 16:71460087-71460109 TAGGTTCTCATATACTTTCTAGG - Intronic
1144829687 17:18124301-18124323 GAGGGTCGCATGCAGGTTCTGGG + Intronic
1145850996 17:28096353-28096375 TTGGTTAGCTTACATTTTCTTGG - Intronic
1146472572 17:33136130-33136152 TGTGTTTGCATACATGTACTGGG + Intronic
1149163459 17:53722889-53722911 TAGGTTCTCATATATTTTCTGGG + Intergenic
1151914807 17:77109941-77109963 TAGGCTCGCAAACATTTTCTTGG + Intronic
927007097 2:18862002-18862024 CAGGTTCTATTACATGTTCTAGG - Intergenic
934630496 2:95915226-95915248 TAGGTTGGCTTACTTGTTCAAGG - Intronic
935384459 2:102486137-102486159 TGGCTTCCCATCCATGTTCTTGG - Intronic
944508634 2:200442180-200442202 TAGGTACTCAAACATATTCTTGG - Intronic
944950949 2:204747846-204747868 TAGGTTAGCATACAAATTCAAGG + Intronic
945352405 2:208796809-208796831 TAGGTTCGCATACATGTTCTAGG - Intronic
959131619 3:102363388-102363410 TAGTCTTGCATCCATGTTCTGGG + Intronic
963435560 3:145260867-145260889 TGGGTTCTCTTACATGTTTTAGG - Intergenic
970168878 4:13268780-13268802 TAGATTCACAGACGTGTTCTTGG - Intergenic
972563919 4:40252676-40252698 TATGTTGGCATAGATTTTCTGGG + Intergenic
973733407 4:53845484-53845506 AAGGTTAGAATTCATGTTCTAGG + Intronic
974699827 4:65427080-65427102 TATATTCGCATATATATTCTTGG - Intronic
981931253 4:150191387-150191409 TAGGTTAGCAAACCTGTTCCAGG + Intronic
988041551 5:25894327-25894349 TAGGTTCCTATATATCTTCTGGG + Intergenic
1010042091 6:71396849-71396871 TAGGTTTACAGACATTTTCTTGG + Intergenic
1012065157 6:94540429-94540451 TATGTTCTTATACATGCTCTTGG - Intergenic
1018264143 6:162003405-162003427 TAGGTTCTCAGACACTTTCTAGG + Intronic
1043175212 8:77016575-77016597 TAGGTTGGCAGTCATGTTTTAGG + Intergenic
1045634838 8:104172790-104172812 TAGATTCCCAAACATCTTCTTGG + Intronic
1052612474 9:30793418-30793440 TATGTTCTCAAATATGTTCTGGG - Intergenic
1189112507 X:38306815-38306837 TAGGTTCCCATTCAGGTGCTTGG + Intronic