ID: 945354659

View in Genome Browser
Species Human (GRCh38)
Location 2:208825518-208825540
Sequence AAGTTACCCTTCAGAAATGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1686
Summary {0: 1, 1: 11, 2: 94, 3: 395, 4: 1185}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945354657_945354659 2 Left 945354657 2:208825493-208825515 CCAACCTTGAATTCTTTATTTAG 0: 1
1: 0
2: 3
3: 58
4: 542
Right 945354659 2:208825518-208825540 AAGTTACCCTTCAGAAATGACGG 0: 1
1: 11
2: 94
3: 395
4: 1185
945354658_945354659 -2 Left 945354658 2:208825497-208825519 CCTTGAATTCTTTATTTAGTGAA 0: 1
1: 0
2: 13
3: 143
4: 1135
Right 945354659 2:208825518-208825540 AAGTTACCCTTCAGAAATGACGG 0: 1
1: 11
2: 94
3: 395
4: 1185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945354659 Original CRISPR AAGTTACCCTTCAGAAATGA CGG Intronic
900012303 1:126409-126431 AACTTATCCTTCAAAAATGAAGG + Intergenic
900042363 1:482398-482420 AACTTATCCTTCAAAAATGAAGG + Intergenic
900063804 1:717388-717410 AACTTATCCTTCAAAAATGAAGG + Intergenic
901189517 1:7399713-7399735 AAACTATCTTTCAGAAATGAAGG - Intronic
901393158 1:8961101-8961123 AAACCACCCTTCAAAAATGAAGG + Intronic
903363449 1:22791922-22791944 AAATTACCCTCCAGAAAGGCTGG + Intronic
903824355 1:26132381-26132403 AAGTTGTCCTTCAAAAGTGATGG + Intergenic
903940514 1:26927132-26927154 AAGTGACGCTTCAGATATGAAGG + Intronic
904018827 1:27445744-27445766 AAGTAACCCGTCAGAAGTGTTGG - Intronic
904275196 1:29378664-29378686 AAGTTATCTTTCAAATATGAAGG - Intergenic
904294755 1:29512416-29512438 AAAATACCCTTCATAAATGAAGG + Intergenic
904635026 1:31873356-31873378 AAAATATCCTTCAGGAATGAAGG - Intergenic
904763881 1:32826850-32826872 GAGTTATCCTGCAGAAATGGTGG + Exonic
905101706 1:35529546-35529568 AAGTTATCTTTCATAAATAAAGG - Intronic
905162446 1:36048334-36048356 AAGCTAACTTTTAGAAATGAGGG + Intronic
905496864 1:38396840-38396862 AATCTGTCCTTCAGAAATGAAGG + Intergenic
905832141 1:41078688-41078710 AAAATATCCTTCAGAAATAAAGG + Intronic
905979929 1:42215851-42215873 AAAATACTCTTCAAAAATGAAGG + Intronic
906030213 1:42713824-42713846 AAATTATCCTTCACAAATGAAGG - Intergenic
906050252 1:42865116-42865138 AAGGTATCCTTCAGAAATGAAGG + Intergenic
906064832 1:42973125-42973147 AAATTTCCCTTCAGAAAAAATGG + Intergenic
906352554 1:45076355-45076377 AAAATACCCTTCAAACATGAAGG - Intronic
906357950 1:45124033-45124055 CAAAAACCCTTCAGAAATGAAGG + Intronic
906573422 1:46864489-46864511 AAGTTATCCTTCATAAATGAAGG + Intergenic
906598451 1:47102560-47102582 AAGTTATCTTTCATAAATGAAGG - Intronic
906885942 1:49648757-49648779 AAATTATCCTTCAAAAATGGAGG + Intronic
907023977 1:51096755-51096777 AAAATATCCTTCAGACATGAAGG + Intergenic
907029298 1:51154960-51154982 AAGCTATCCTTCAGAAATAAAGG + Intergenic
907178612 1:52550131-52550153 AAAATACTCTGCAGAAATGATGG + Intronic
908070808 1:60457451-60457473 AACTTATCATTCATAAATGAAGG + Intergenic
908545007 1:65153676-65153698 AAATTACCCTTAAGGAATTAAGG - Intronic
908885978 1:68788497-68788519 ACACTGCCCTTCAGAAATGAGGG + Intergenic
908918042 1:69155869-69155891 AAATTAACCTACATAAATGAAGG - Intergenic
908932472 1:69333334-69333356 AAACTATCCTTCAGATATGAAGG - Intergenic
908945352 1:69489193-69489215 AAATTACCTTTCAAAAGTGAAGG + Intergenic
909031879 1:70551042-70551064 AAATTATCCTTCAAAATTGAAGG + Intergenic
909436250 1:75646441-75646463 ATGAGAACCTTCAGAAATGAAGG + Intergenic
909463476 1:75945455-75945477 AAGTTAGCCTTCATAAATGAAGG + Intergenic
909597752 1:77425171-77425193 AAATTATCCTTCAAAAATGAAGG + Intronic
909598864 1:77440218-77440240 AAACTACCCTTCAGAAATGAGGG - Intronic
910150157 1:84133285-84133307 AAATTAACCTTCAAAACTGAAGG + Intronic
910265716 1:85334935-85334957 AAATTATCCTTCATAAATGAAGG + Intronic
910372814 1:86536028-86536050 AAATTATTCTTCAAAAATGAGGG - Intergenic
910565050 1:88634236-88634258 AAGCTATTCTTCAAAAATGAAGG - Intergenic
910747555 1:90590356-90590378 AAACTATCCTTTAGAAATGAAGG + Intergenic
910926477 1:92403071-92403093 AAAATATCCTTCAAAAATGAAGG - Intergenic
910975267 1:92899874-92899896 AAGCTATCCTTCAGAAATGAGGG - Intronic
911083352 1:93955438-93955460 AAGTTACATTTCATAAATGAAGG - Intergenic
911434561 1:97840044-97840066 AAGTTACTCTACACAAGTGAAGG - Intronic
911485437 1:98499246-98499268 AAAATATCCTTCAGGAATGAAGG - Intergenic
911487355 1:98518168-98518190 AAAATACCCTTCAAACATGAAGG + Intergenic
911743434 1:101412501-101412523 AAACTAAGCTTCAGAAATGAAGG + Intergenic
911978290 1:104531730-104531752 AACTAACTCCTCAGAAATGATGG - Intergenic
912108313 1:106308344-106308366 AAACTATCCTTCAAAAATGAAGG + Intergenic
912267845 1:108176775-108176797 AAAGTGTCCTTCAGAAATGAAGG + Intronic
912278111 1:108282290-108282312 AAAATAACCTTCAAAAATGAAGG - Intergenic
912290115 1:108412067-108412089 AAAATAACCTTCAAAAATGAAGG + Intronic
912436419 1:109665148-109665170 AAGATTTCCTTCAGCAATGAAGG + Intronic
912588511 1:110788922-110788944 AAGCTATTCTTCAGAAATAAGGG + Intergenic
912598754 1:110905535-110905557 AAAATATCCTTCAAAAATGAAGG + Intergenic
912771678 1:112470217-112470239 AAATTATCCTTCAAACATGAAGG - Intronic
912774249 1:112494656-112494678 AAATTATCCTTTAAAAATGAAGG + Intronic
912885819 1:113473184-113473206 AAGGTGTCCTTCAGAAATAAAGG - Intronic
912935027 1:113995617-113995639 AAACTATTCTTCAGAAATGAAGG + Intergenic
912970443 1:114276549-114276571 AAATTATCCTTCAAAAGTGAAGG + Intergenic
912990233 1:114479517-114479539 AAAATATCCTTCAAAAATGAAGG + Intronic
912991119 1:114487424-114487446 CAAATACCCTTCAGGAATGAAGG + Intronic
913051907 1:115124649-115124671 AAACTATCCTTCAAAAATGAAGG + Intergenic
913281831 1:117192297-117192319 AAACTGTCCTTCAGAAATGAAGG + Intronic
913367741 1:118060758-118060780 AATGTAGCCTTCAGAAATGAAGG - Intronic
913401275 1:118436778-118436800 AAAATATCCTTCAAAAATGAAGG - Intergenic
913408600 1:118524952-118524974 AAGCTATCTTTCAGAAATGAGGG - Intergenic
913424972 1:118718348-118718370 AGGTTAGCATTCAGAAGTGAAGG + Intergenic
913663274 1:121023552-121023574 AATTTAAGCTTCATAAATGAAGG + Intergenic
914014661 1:143806817-143806839 AATTTAAGCTTCATAAATGAAGG + Intergenic
914082248 1:144419736-144419758 AAAATACTCTTCAAAAATGATGG - Intergenic
914163159 1:145154384-145154406 AATTTAAGCTTCATAAATGAAGG - Intergenic
914177153 1:145288235-145288257 AAAATACTCTTCAAAAATGATGG - Intergenic
914653285 1:149715374-149715396 AATTTAAGCTTCATAAATGAAGG + Intergenic
914766589 1:150643131-150643153 AAATTATCCTTCCAAAATGAAGG + Intergenic
914882486 1:151558208-151558230 AAAATATCCTTCAGAAATGAGGG - Intronic
915056460 1:153135683-153135705 AAGTTATCCTTTATAAATGAAGG + Intergenic
915071266 1:153270783-153270805 AATCTGCCCTTCAGAAATGAAGG - Intergenic
915678462 1:157554595-157554617 AAGTTAACCTAAATAAATGAGGG - Intergenic
915703012 1:157813984-157814006 AAGCTGTCTTTCAGAAATGAAGG + Intronic
915711266 1:157901343-157901365 AAATTGTCCTTCAAAAATGAAGG + Intergenic
915761932 1:158322739-158322761 AATATGTCCTTCAGAAATGAAGG - Intergenic
915858828 1:159420641-159420663 AAGTTATCCTTCATATATAAAGG - Intergenic
915990157 1:160506422-160506444 AAATTATCCTTCAAAAATGAAGG + Intronic
916347424 1:163809529-163809551 AAGTCCCCCTACATAAATGAAGG - Intergenic
916364655 1:164011702-164011724 AATGTGTCCTTCAGAAATGATGG + Intergenic
916644699 1:166771180-166771202 AGATTAACCTTCATAAATGAAGG + Intergenic
916702408 1:167311378-167311400 AAAATATCCTTCAGGAATGAAGG + Intronic
916795143 1:168160143-168160165 AAGCTATCCTTCAGAAATGAAGG - Intergenic
916943994 1:169705910-169705932 ATGTTACCCTGCATAAATGTTGG + Intronic
917039072 1:170782744-170782766 AAATTGTCATTCAGAAATGAAGG - Intergenic
917050891 1:170921562-170921584 AAGCTATCATTCAGAAATTAAGG + Intergenic
917186886 1:172367254-172367276 AATCTATACTTCAGAAATGAAGG + Intronic
917570004 1:176255551-176255573 AAGCTATCTTTCAGAAATGAAGG - Intergenic
917607686 1:176651365-176651387 AAGCTATCCTTCATATATGAAGG - Intronic
917693803 1:177497029-177497051 AAATTACCCTTCAGTAATGAAGG + Intergenic
917694242 1:177504163-177504185 AAATTATACTTCAGAAATGAAGG + Intergenic
917763132 1:178186476-178186498 ACCATACCCTTCAAAAATGAAGG - Intronic
918493280 1:185106328-185106350 AAAGTATCCTTCAGTAATGAAGG + Intergenic
918615955 1:186543879-186543901 AAATTATCCTACATAAATGAAGG + Intergenic
918656296 1:187029944-187029966 AAGCTGTCCTTCAGAAGTGAAGG + Intergenic
918664400 1:187131534-187131556 AAGCTATTCTTCAGAAATGAAGG + Intergenic
918767153 1:188500750-188500772 AAGTTACCAAACAGAAATCATGG - Intergenic
919043922 1:192426807-192426829 AAGCTATCCTTCATACATGAAGG + Intergenic
919120365 1:193332837-193332859 AAGCTGTCCTTCAGGAATGAAGG - Intergenic
919191045 1:194219480-194219502 AAATTATCCTTCAGATATGAAGG + Intergenic
919242064 1:194926421-194926443 CCGAGACCCTTCAGAAATGAAGG + Intergenic
919364120 1:196635292-196635314 AAATTATCCTACAAAAATGAAGG + Intergenic
919397753 1:197071485-197071507 AAGCTAGGCTTCATAAATGAAGG + Intergenic
920602596 1:207344479-207344501 AAGTTATCCTTCATAAATGAAGG - Intronic
921003797 1:211071967-211071989 AAATTATCCTTCAAAAGTGAAGG + Intronic
921194832 1:212745620-212745642 AAAATATCCTTCAAAAATGAAGG + Intronic
921197186 1:212769515-212769537 AAGCTATCCTTCAAAAATGAAGG + Intronic
921241266 1:213186316-213186338 AAATTATACTTCAGATATGAAGG - Intronic
921248128 1:213268322-213268344 AAATTATCCTTCAAAAATGAAGG + Intronic
921341556 1:214139296-214139318 AAGTTTTCCATCAGAAATTAAGG + Intergenic
921830229 1:219719878-219719900 AAAATATCCTTCAGGAATGAAGG + Intronic
921830938 1:219726728-219726750 AAGCAATTCTTCAGAAATGAAGG + Intronic
921875136 1:220187355-220187377 AAGCTCCCCATCAGAAATGGGGG - Intronic
922260734 1:223942880-223942902 AACTTATCCTTCAAAAATGAGGG + Intergenic
922392884 1:225165087-225165109 AATTTGCCATTCAGATATGAGGG - Intronic
922736335 1:227982850-227982872 AACTTATCCTTCAAAAATGAGGG - Intergenic
923253882 1:232201801-232201823 AAATTATCCTTCAGGAATGAAGG + Intergenic
923359366 1:233194296-233194318 AAGATATCCTTCAAAAGTGAAGG + Intronic
923486667 1:234439023-234439045 AAAATATCCTTCAGAAATGAAGG + Intronic
923512250 1:234662505-234662527 AAGACACCCATCAGGAATGAAGG + Intergenic
923709620 1:236376400-236376422 AAATTATCCTGCACAAATGAAGG - Intronic
923834653 1:237596902-237596924 AAGCTATCCTTCAGAAATGAAGG + Intronic
923921721 1:238573449-238573471 AAATTACTCTTCAGGAATAAAGG + Intergenic
923956592 1:239029331-239029353 AAGATATCCTTCAAAAATGTGGG + Intergenic
924068526 1:240252498-240252520 AAGTTACCCTCCATAAATGATGG - Intronic
924260303 1:242222776-242222798 AAGTTTGACTTCAGAGATGATGG + Intronic
924341909 1:243045068-243045090 AACTTATCCTTCAAAAATGAGGG + Intergenic
924478240 1:244400845-244400867 AAATTATCCTTCAAATATGAAGG - Intergenic
924618749 1:245641068-245641090 CAGTTATTCCTCAGAAATGAAGG - Intronic
924690881 1:246348990-246349012 GAATTACCCTTCAAAAGTGAAGG + Intronic
924837327 1:247664414-247664436 AATCTATCCTTCAGAAATAAGGG - Intergenic
924885220 1:248208566-248208588 AAGCTATGCTTCAGAAATGAAGG - Intergenic
1062883997 10:1002647-1002669 AAGCTATCCTTCAGAAATAAGGG - Intronic
1063081942 10:2775664-2775686 ATATTAACCTTGAGAAATGATGG - Intergenic
1063471248 10:6288008-6288030 AAATTATCTTTCAGAAGTGAAGG - Intergenic
1063871443 10:10421817-10421839 AAGTTACCCGGCATAAAAGAGGG - Intergenic
1064159875 10:12936191-12936213 AAATTATCCTTCAAAAGTGATGG - Intronic
1064572751 10:16712936-16712958 AAGTTATCCTTCAGAAATGAAGG - Intronic
1064977144 10:21129054-21129076 AAATTATCCTTCAGAAGTGAGGG + Intronic
1065041583 10:21703237-21703259 AAATTATCCTTCATAAATGAAGG - Intronic
1065384690 10:25123230-25123252 AAGTTATGTTTCAGAAATTATGG + Intergenic
1065518567 10:26549983-26550005 AAGCTATTCTTCAGAAATGAAGG - Intronic
1065654157 10:27929670-27929692 AAGTTATCCTTCAAATGTGAAGG - Intronic
1065708047 10:28489284-28489306 AGGTTCCCCTTCAGGAATGAAGG + Intergenic
1066143620 10:32533640-32533662 AAATTATCCTTCAAATATGAAGG - Intronic
1066487436 10:35860425-35860447 AAATTAAGCTTCATAAATGAAGG + Intergenic
1066498478 10:35966063-35966085 AAATTATCCTTCAAAAGTGAAGG + Intergenic
1067325822 10:45265504-45265526 AAGCTGTCCTTCAGAAATGAAGG + Intergenic
1067368607 10:45660818-45660840 ATATTATCCTTCAGAAATGAAGG + Intronic
1067540550 10:47148289-47148311 AAAATATCCTTCAGAAATGAAGG + Intergenic
1067581023 10:47445968-47445990 AAGTTACTCTTTAGGAATGAAGG + Intergenic
1067906633 10:50297859-50297881 CAGCTATCCTTCATAAATGAAGG + Intergenic
1067975328 10:51018212-51018234 AAATTATCCTTCAGCAATAAAGG - Intronic
1068000589 10:51329663-51329685 AAGCTGTCCTTCAGAAATGAAGG - Intronic
1068069514 10:52179326-52179348 AAACTATCCTTCAGTAATGAAGG - Intronic
1068172949 10:53420216-53420238 AAACTACGCTTCATAAATGAAGG - Intergenic
1068612094 10:59071356-59071378 AAGTTAGCAGTCAGAAATCAAGG - Intergenic
1068888423 10:62122939-62122961 AAGTTAGCCTTCAGAAATGAAGG - Intergenic
1069012391 10:63388383-63388405 ATGTTATCCTTCATAAATGATGG + Intronic
1069262599 10:66416708-66416730 AAATTATCCTTCATAAATGAAGG + Intronic
1069269806 10:66512741-66512763 AAGCTATTCTTTAGAAATGAAGG - Intronic
1069330370 10:67284717-67284739 AAGTTACTCTTTTGGAATGAGGG - Intronic
1069391944 10:67945354-67945376 AAGATATCCTTCAAACATGAAGG + Intronic
1069434878 10:68371937-68371959 AAAATATCTTTCAGAAATGAAGG + Intronic
1069586377 10:69606093-69606115 AAACTATCCTTCAGAAATGAAGG + Intergenic
1069644460 10:69982586-69982608 AAACTATCCTTCTGAAATGAAGG + Intergenic
1070060567 10:72979393-72979415 AAGCTATCCTTCAAAAATGAAGG - Intergenic
1070177362 10:73982903-73982925 ATTTTACCTTTCAAAAATGAAGG - Intergenic
1070226534 10:74514051-74514073 AAGCTAACCTTCAGAAATAAAGG - Intronic
1070316177 10:75314797-75314819 AAACTATACTTCAGAAATGAAGG + Intergenic
1070543677 10:77436024-77436046 AAATGGCCCTTAAGAAATGAAGG + Intronic
1070663437 10:78326567-78326589 AAGCTATCCTTCAAACATGAAGG - Intergenic
1071004753 10:80869992-80870014 AAGCTATCCTTCAGAAATGAAGG + Intergenic
1071109597 10:82139822-82139844 AGCTTAACCTTCAGATATGAAGG - Intronic
1071217111 10:83419174-83419196 AAGTTACTCTTCTAATATGAAGG - Intergenic
1071593983 10:86904499-86904521 AAAATATCCTTCAAAAATGAAGG + Intronic
1071723913 10:88176837-88176859 AAGCTATCTCTCAGAAATGAAGG - Intergenic
1071744133 10:88395988-88396010 AAACTATCCTTCAGAAATGAAGG + Intronic
1072020758 10:91397278-91397300 AAGCTGTCCTTCAGAAATGAAGG + Intergenic
1072040022 10:91597988-91598010 AAATTATCCTTCTGAAATCACGG - Intergenic
1072146242 10:92641411-92641433 AAAATACCTTTCAGGAATGAAGG - Intronic
1072165746 10:92811365-92811387 TAGTTACCCTTCACAAATCCCGG - Intergenic
1072199653 10:93146746-93146768 CACTTTCCCTTCTGAAATGACGG + Intergenic
1072341949 10:94460354-94460376 AAGTTATCCTTCAAAAGTGAAGG - Intronic
1072860885 10:99004882-99004904 AAGCTGTCCTTCAGAAATGAAGG - Intronic
1072877926 10:99192789-99192811 AAAATATCCTTCAGACATGAAGG + Intronic
1072938840 10:99740383-99740405 AAAATACCTTTCAAAAATGAAGG - Intronic
1073039182 10:100588387-100588409 AAAATATCTTTCAGAAATGAAGG + Intergenic
1073437866 10:103532505-103532527 AAGCTATCCTTCAGAAATTAGGG - Intronic
1074171459 10:110942794-110942816 AAACTATCCTTCAAAAATGAAGG - Intronic
1074634048 10:115293699-115293721 AAGCTATCCTTCAGAAATTAAGG - Intronic
1074647379 10:115474197-115474219 ATGTTGCCCTTCAGAAATGAAGG - Intronic
1074697759 10:116066026-116066048 AAATTAACTTTAAGAAATGAGGG - Intronic
1075232812 10:120698155-120698177 AAGCTGTTCTTCAGAAATGAAGG - Intergenic
1075491464 10:122874493-122874515 GAATTACCTTTCAGAAGTGAAGG - Intronic
1075678410 10:124314152-124314174 AAGTTTCCCTTCCAAAATGTGGG - Intergenic
1075901343 10:126044993-126045015 AAGCTACCCTTCAGCAAGGCTGG + Intronic
1076250594 10:128981092-128981114 AAGTCACCTTCCAGAAATCAAGG + Intergenic
1076576220 10:131471113-131471135 GAATTACCCTTCAAAAGTGAGGG - Intergenic
1076870824 10:133193215-133193237 AAAATATCCTTCAGAAATTAAGG + Intronic
1076941422 10:133612500-133612522 AATCTGTCCTTCAGAAATGAAGG + Intergenic
1076968635 11:118613-118635 AACTTATCCTTCAAAAATGAAGG + Intergenic
1077343393 11:2035894-2035916 CAGTTGCCCTTCAGAAAAGGAGG - Intergenic
1077759656 11:5079067-5079089 AATCTATCCTTCAGAAATGAAGG + Intergenic
1077839966 11:5963413-5963435 AAGCTCTCCTTCAAAAATGAAGG - Intergenic
1077965666 11:7130023-7130045 AAAATATTCTTCAGAAATGAAGG - Intergenic
1078048803 11:7943760-7943782 AAGCTATCCTTCAGAATGGAAGG - Intergenic
1078204062 11:9212688-9212710 AAAATATCCTTCAAAAATGAGGG + Intronic
1078591518 11:12644499-12644521 AAATTATCTTTCAAAAATGAAGG + Intergenic
1078746642 11:14121840-14121862 AAGATATCCTTCAAAAATGAGGG - Intronic
1078964582 11:16323409-16323431 AAGTTACTATTCAAAACTGATGG + Intronic
1079512149 11:21223904-21223926 AAACTAACCTTCAGAAATGATGG - Intronic
1079533897 11:21487355-21487377 AAATTACCCTTCATAAGTGAGGG + Intronic
1079583834 11:22100158-22100180 AAACTATCCTTCAGACATGAAGG + Intergenic
1079935617 11:26612736-26612758 AAGCTATCCTTCAGAAATGAAGG - Intronic
1079980112 11:27142299-27142321 AAGCTGCCCTTCAGAAATAAAGG + Intergenic
1080318049 11:30972367-30972389 AAGTTACCCTTCATTAATGAAGG + Intronic
1080334178 11:31176799-31176821 AAGCTATCCTTAAGAAATGAAGG + Intronic
1080907270 11:36559080-36559102 AAACTATCCCTCAGAAATGAAGG - Intronic
1081180164 11:39975007-39975029 AAGTTACAATTGTGAAATGAAGG - Intergenic
1081191627 11:40110415-40110437 AAGTTACCTTCCAAAAATCAAGG - Intergenic
1081232812 11:40607108-40607130 AAATCATCCTTCAAAAATGAAGG + Intronic
1081244565 11:40748309-40748331 AAATTATCCTTCAGAAATAAAGG + Intronic
1081985796 11:47303065-47303087 AAGTTGTGCTTCAGAAATGAAGG - Intronic
1082122934 11:48399248-48399270 AAATTACCCTTTGAAAATGAAGG + Intergenic
1082251727 11:49989742-49989764 AAATTACCCTTTGAAAATGAAGG - Intergenic
1082556636 11:54570524-54570546 AAATTACCCTTTGAAAATGAAGG + Intergenic
1082644431 11:55703726-55703748 AGCTATCCCTTCAGAAATGAAGG + Intergenic
1082686258 11:56242626-56242648 AAGCTAGTCTTCAGAAATGATGG + Intergenic
1082911257 11:58377204-58377226 AAGTTATCCTTCAGAAATGAAGG + Intergenic
1082917431 11:58452790-58452812 AAGTTGTCCTTTAGAAATGAAGG + Intergenic
1083040697 11:59682609-59682631 AAGCTGTCCTTCAGAAATGAAGG + Intergenic
1083124175 11:60546625-60546647 AAGCTATCCTTCAGAAACGAAGG + Intergenic
1083128134 11:60593575-60593597 AAATTATACTTCAGAAGTGAAGG + Intergenic
1083509274 11:63192232-63192254 AAACTAAGCTTCAGAAATGAAGG + Intronic
1084471220 11:69360409-69360431 AAATTGCCCTTCAGAAAGGTTGG + Intronic
1084770339 11:71338870-71338892 AATTCAACCTTCAGAAATGATGG + Intergenic
1084784169 11:71432185-71432207 AATTTACCCTGAAGAAATCAAGG - Intronic
1084998723 11:73009636-73009658 AAATTATCCTTCATAAATGAAGG - Intronic
1085539231 11:77251453-77251475 AATCTATTCTTCAGAAATGAGGG - Intronic
1085859645 11:80216734-80216756 AAACTATCCCTCAGAAATGAAGG + Intergenic
1085860524 11:80228192-80228214 AAAGTATCCTTCTGAAATGAAGG + Intergenic
1085978830 11:81695914-81695936 AGATTATCCTTCATAAATGAGGG + Intergenic
1086129621 11:83387351-83387373 GAGTGATCCTTCAGAAGTGAAGG + Intergenic
1086829448 11:91541656-91541678 AAGCTGTACTTCAGAAATGAGGG + Intergenic
1086880210 11:92145013-92145035 AAGCTGTCTTTCAGAAATGAAGG - Intergenic
1086996389 11:93361179-93361201 AAAATACCCCTCAGGAATGAAGG + Intronic
1087080466 11:94166396-94166418 AAGTTATCCTTCAAACATAAAGG - Intronic
1087227609 11:95619668-95619690 AAATTATCCTTCATAAATAACGG + Intergenic
1087353450 11:97062411-97062433 AAATTATCCTTCATAAATGAAGG + Intergenic
1087370301 11:97275373-97275395 AAGGTATCCTTCTGAAATGAAGG + Intergenic
1087462737 11:98465725-98465747 AAATTATCTTTCAAAAATGAAGG - Intergenic
1087488722 11:98793636-98793658 AAGCTATCTTTCATAAATGAAGG + Intergenic
1087681471 11:101223104-101223126 AAGCTATCATTCAGAAACGAGGG - Intergenic
1087696715 11:101386879-101386901 AAAATATCCTTCAAAAATGAGGG - Intergenic
1087700150 11:101428093-101428115 AAATTATCCTTCAGAAATGAAGG - Intergenic
1087808896 11:102588830-102588852 GAGTTATCTTTCAAAAATGAAGG - Intronic
1087859122 11:103131672-103131694 AAAATATCCTTCAGGAATGAGGG - Intronic
1087877671 11:103376876-103376898 AAGCTATCCTCCAGAAATGAAGG - Intronic
1088382747 11:109214833-109214855 AAAATACTATTCAGAAATGAAGG - Intergenic
1088395112 11:109359199-109359221 AAGATACCCTTTAAAATTGATGG - Intergenic
1088419848 11:109634160-109634182 AAGTTGTTCTTCAGAAATAAAGG - Intergenic
1088425267 11:109695247-109695269 AAGCTATCCTTCGAAAATGAAGG + Intergenic
1089186698 11:116621347-116621369 AAAATATGCTTCAGAAATGAAGG + Intergenic
1089569863 11:119398461-119398483 AAGCTACTCTTCAGAAATGAAGG + Intergenic
1089854442 11:121530385-121530407 AACATATCCTTCAGGAATGAAGG - Intronic
1089886893 11:121834125-121834147 AAACTATTCTTCAGAAATGAAGG + Intergenic
1090157054 11:124449787-124449809 AAGCTATCCTTCAGAAATGAAGG + Intergenic
1090317035 11:125802050-125802072 AAACTGTCCTTCAGAAATGAAGG - Intergenic
1090407144 11:126483310-126483332 ATGTGAGCTTTCAGAAATGAAGG - Intronic
1090842561 11:130505131-130505153 AAAATATCCTTCTGAAATGAAGG - Intergenic
1090911785 11:131127502-131127524 AAGTTGCTCTTCATAAATGAAGG - Intergenic
1091044093 11:132310445-132310467 AAGTTACCTTTCAGATCTGTTGG - Intronic
1091083954 11:132702294-132702316 AAATTGTCTTTCAGAAATGAAGG - Intronic
1091247917 11:134115446-134115468 AAGTTACCCAATAGAAAAGAAGG - Intronic
1091370505 11:135053726-135053748 AAACTGCCCTTCAAAAATGATGG - Intergenic
1202826379 11_KI270721v1_random:91083-91105 CAGTTGCCCTTCAGAAAAGGAGG - Intergenic
1091505540 12:1064018-1064040 AAGCTATCTTTCAGAAATGAAGG - Intronic
1091827892 12:3527880-3527902 AAAATATCTTTCAGAAATGACGG - Intronic
1091839516 12:3610097-3610119 AAACTATCCTTCAAAAATGAAGG + Intronic
1091859093 12:3762874-3762896 AAACTATCCTTCACAAATGAAGG + Intronic
1091892256 12:4068370-4068392 AAATTATCCTTCAAAAGTGAAGG - Intergenic
1091914391 12:4258913-4258935 AAATTATTCTTCAAAAATGAAGG - Intergenic
1091966986 12:4752912-4752934 AAAATATCCTTCAGACATGAAGG - Intronic
1092313550 12:7384694-7384716 AAGTTACCCTTCAAAAATGAAGG + Intronic
1092320381 12:7466549-7466571 AAATTATCCTTCAAACATGAAGG + Intronic
1092492989 12:8963176-8963198 AAAATACCTTTCAGAAATGAAGG + Intronic
1092504650 12:9084092-9084114 AAGCTGTCTTTCAGAAATGAGGG + Intronic
1092568113 12:9690263-9690285 AAGTTGTCCTTCAAGAATGAAGG + Intronic
1092700145 12:11219336-11219358 AAACTAACCTTCATAAATGAAGG + Intergenic
1092700161 12:11219492-11219514 AAACTAACCTTCATAAATGAAGG + Intergenic
1092735045 12:11573935-11573957 AAATTATCCTTCAAAAATGAGGG - Intergenic
1092828766 12:12423490-12423512 AAACTATCCTTCAAAAATGAGGG - Intronic
1092941482 12:13411484-13411506 AAGTTATCCTTCGCATATGAAGG + Intergenic
1093109883 12:15138001-15138023 AAATTACTCTTCAAAAGTGAAGG - Intronic
1093159475 12:15728984-15729006 AAATTATCCTTCAAAAGTGAAGG - Intronic
1093263567 12:16971896-16971918 AAACTACACTTCAGAAATGAAGG - Intergenic
1093339349 12:17951888-17951910 AAGCTGGCCTTCAGAAATGAAGG + Intergenic
1093339440 12:17953784-17953806 AAGCTGGCCTTCAGAAATGAAGG - Intergenic
1093361452 12:18234342-18234364 AAATTATCCTTCATAAATGAGGG - Intronic
1093383496 12:18522471-18522493 AAGTTGTCCTTCAGAAATGAGGG - Intronic
1093473571 12:19531100-19531122 AAATTATCCTTCAAAAATTAGGG - Intronic
1093488993 12:19683519-19683541 AAATTCCCCTTCAGCACTGAGGG + Intronic
1093571916 12:20676313-20676335 AAGTTGTCCTTTATAAATGAAGG - Intronic
1093872721 12:24311325-24311347 TAATGAACCTTCAGAAATGATGG - Intergenic
1094258780 12:28466616-28466638 AAATTATCCTTCAGTCATGAAGG + Intronic
1094296029 12:28906229-28906251 AAATTATCCTTCAAAAATGATGG + Intergenic
1094471812 12:30808937-30808959 AAGTTATCTTTCAGATATGAAGG + Intergenic
1094734011 12:33212181-33212203 AAGTTGTCTTTCAGAAATGAAGG + Intergenic
1095656051 12:44670141-44670163 AAGCTATCCCTCAAAAATGAAGG + Intronic
1095776378 12:46014842-46014864 AAGCTATCCTTCAAATATGAAGG - Intergenic
1095803148 12:46289701-46289723 AAGCTGTCCTTCAAAAATGAAGG + Intergenic
1095804708 12:46305928-46305950 AAATTATCCTTCAGAAGTGAGGG + Intergenic
1095911022 12:47426484-47426506 AAGTTATTCTTCATGAATGAAGG + Intergenic
1096033687 12:48444458-48444480 AATTTCTCCTTTAGAAATGAAGG + Intergenic
1096169072 12:49451849-49451871 AAGCTATCTTTCAAAAATGAAGG - Intronic
1096892302 12:54784287-54784309 AAGCTACCCTTCAAAAATAGAGG - Intergenic
1096961202 12:55579627-55579649 AAGCCATCCTTCAGAAATGAAGG - Intergenic
1097075914 12:56394157-56394179 AAAATATCCTTCAGGAATGAAGG + Intergenic
1097358839 12:58633662-58633684 AAGCTATCCTTCAGAAAGGAAGG + Intronic
1097362946 12:58678418-58678440 AAATTATCCTTCATAAATTAAGG - Intronic
1097425852 12:59444080-59444102 AAAATACCCTTCAAAAATGAAGG - Intergenic
1097477901 12:60082039-60082061 AAGCCATCCTTCAGAAATGGAGG - Intergenic
1097486886 12:60213986-60214008 AAGTTACCCTTCAAGTATGAGGG - Intergenic
1097629434 12:62042120-62042142 AGGATTCCCTTCAGATATGAAGG - Intronic
1097773068 12:63612182-63612204 AACATACCTTTCAAAAATGAAGG + Intronic
1097906803 12:64928927-64928949 AAACTAAGCTTCAGAAATGAAGG - Intergenic
1098207212 12:68124482-68124504 AAGCTGTCCTTTAGAAATGAAGG - Intergenic
1098292119 12:68966413-68966435 AAGACACCCTTCTGAAATAATGG - Intronic
1098395105 12:70008730-70008752 AAGTTATTTTTCACAAATGAAGG + Intergenic
1098414022 12:70213394-70213416 AATCTTTCCTTCAGAAATGAAGG - Intergenic
1098568830 12:71966296-71966318 AAGTTACACTTTAGAAATTAAGG + Intronic
1098571097 12:71988277-71988299 AAGAAACACTTCAGAAATGGTGG + Intronic
1098591861 12:72223459-72223481 AAGTTGCCCTTGAGCAATTATGG - Intronic
1098725349 12:73957810-73957832 AAATTATTCTTCAGAAGTGAAGG - Intergenic
1098983261 12:76983083-76983105 AAGCTATTCTTCAGAAATGAAGG - Intergenic
1099075881 12:78107647-78107669 AAATTATCCTTCATAAATGAAGG + Intronic
1099159354 12:79222036-79222058 AAGCTATCTTTCAGAAATAAAGG - Intronic
1099192288 12:79572964-79572986 AAATTATCCTTCACAAATGAAGG + Intergenic
1099327989 12:81244075-81244097 AAATTATCCTTCAAAAATTAAGG - Intronic
1099341275 12:81438091-81438113 AATTTAACCTTTAGAAATAATGG - Intronic
1099423191 12:82489736-82489758 AAGCTGTCCTTCAGGAATGAAGG + Intergenic
1099572412 12:84340357-84340379 AAGTGATCCTTCAGAACTGAGGG - Intergenic
1099587829 12:84544291-84544313 AAGTTATCCTTCATTAATGAAGG - Intergenic
1100150383 12:91729546-91729568 ACCATACCCTTCAGGAATGAAGG + Intergenic
1100639595 12:96469541-96469563 AAAATATCCTTCAGAAACGAAGG - Intergenic
1100900974 12:99239812-99239834 AAATTATGCTTCATAAATGAAGG + Intronic
1100931080 12:99610156-99610178 ACAATAGCCTTCAGAAATGAAGG + Intronic
1101476663 12:105056307-105056329 AAAATATCCTTCAGAAATGAAGG + Intronic
1101688022 12:107045274-107045296 AAGATATCCTTCAGAAACAAGGG + Intronic
1101980521 12:109402461-109402483 AAGTTCACCTTGAAAAATGAAGG + Intronic
1102443711 12:112984893-112984915 AAGCTATCCTTCAAAAATGAAGG - Intronic
1103721093 12:122975952-122975974 AAGTGACCCTTCAGGGATCAGGG - Intronic
1104576985 12:129975392-129975414 AAAATATCTTTCAGAAATGAAGG + Intergenic
1104678910 12:130735423-130735445 AAATTATCCTTCAAAAATGAAGG - Intergenic
1105294972 13:19080174-19080196 AAATTATCCTCCAGAAGTGAAGG + Intergenic
1105478780 13:20754212-20754234 AAATTATTCTTCATAAATGAAGG - Intronic
1105877954 13:24576125-24576147 AAGTTATCTTTCATAAATGAAGG - Intergenic
1106119172 13:26844397-26844419 AAAATACCCCTCAGGAATGAAGG + Intergenic
1106306249 13:28513629-28513651 AAATTATCCTTCAAAAGTGAGGG - Intergenic
1106428105 13:29652927-29652949 AATTTGTCCTTCAAAAATGAAGG - Intergenic
1106462740 13:29987356-29987378 AAACTATCCTTCAGAAGTGAAGG - Intergenic
1106500769 13:30326642-30326664 AAAATATCCTTCAGGAATGAAGG + Intergenic
1106637895 13:31550666-31550688 AAATTATCCTTCAAAAGTGAAGG - Intergenic
1106723290 13:32457629-32457651 AAGTTATCCTTCAAAAATTAAGG + Intronic
1106723816 13:32463819-32463841 AAACTATCCTTCAGAAATGAAGG + Intronic
1107245919 13:38293617-38293639 AAATTGTCCTTCAAAAATGAAGG + Intergenic
1107592709 13:41925161-41925183 AAACTGCCCTTCAGAAATTAAGG + Intronic
1107756383 13:43627852-43627874 GAATTATCCTTCAGGAATGAAGG - Intronic
1108040416 13:46334623-46334645 AAGTTATGATTCAGAAAGGAAGG + Intergenic
1108157914 13:47605720-47605742 AAATTATCCTTCAAATATGATGG + Intergenic
1108328776 13:49362995-49363017 AAAATACCCTTCAGGCATGAAGG + Intronic
1108946352 13:56029942-56029964 AAGTTACCTTTCAAAAATATTGG + Intergenic
1109045118 13:57400854-57400876 AAGTGATCTTTCAGAAATTATGG - Intergenic
1109071698 13:57777687-57777709 AACTTATCCTTCATAAATAAAGG - Intergenic
1109315744 13:60747283-60747305 TACCAACCCTTCAGAAATGAAGG - Intergenic
1109554462 13:63953947-63953969 GAGTTATCCTTCAAACATGAAGG - Intergenic
1109583344 13:64368382-64368404 AAATGGCCCTTCAGGAATGAAGG + Intergenic
1109653285 13:65355705-65355727 AAGCTGTACTTCAGAAATGAAGG + Intergenic
1109681731 13:65759962-65759984 CAGTTATCCTTCATAAATGAAGG + Intergenic
1109755888 13:66760082-66760104 AAGCTATCTTTCTGAAATGAAGG - Intronic
1109807971 13:67469290-67469312 AAGTTATCCTTCATAAATGAAGG - Intergenic
1109828603 13:67755968-67755990 AGTTTAACCTTCAGGAATGAAGG - Intergenic
1109928221 13:69176067-69176089 AAATTACGCTTCAAAAATGAAGG + Intergenic
1109942348 13:69386516-69386538 AAGTCATCCTTCAGAAATGAGGG + Intergenic
1110081307 13:71316968-71316990 AAATTACTCTGCAGAGATGAGGG - Intergenic
1110134739 13:72052164-72052186 AAGAAAGCCTTCAAAAATGAAGG - Intergenic
1110724862 13:78810242-78810264 AAACTCTCCTTCAGAAATGAAGG - Intergenic
1111722035 13:91957691-91957713 AAGTTATCCTTTATAAATAAAGG + Intronic
1112060433 13:95734263-95734285 AAGTTATCCTTCATAAATGAAGG - Intronic
1112080214 13:95960934-95960956 AAGTTATCCTTCATAAATGAAGG + Intronic
1112749065 13:102562944-102562966 AAGCTATCCTTCAAAAATGAGGG - Intergenic
1112844956 13:103630722-103630744 AAAATACCCTTCAAGAATGACGG - Intergenic
1113855405 13:113442128-113442150 AAAATATCTTTCAGAAATGAAGG - Intronic
1113873212 13:113577104-113577126 AAACTACCCTTCAAAAACGAGGG + Intergenic
1113954833 13:114093302-114093324 AAGCTATCATTCAGAAATGAAGG - Intronic
1113984394 13:114302298-114302320 AATTTACCCTTGAGACAGGAAGG + Intronic
1114820452 14:26011570-26011592 AAAATACCCTTCAAACATGAAGG + Intergenic
1115082412 14:29472363-29472385 AAGCTACCCTTCAAAAATGAAGG - Intergenic
1115303500 14:31911364-31911386 AAGCTGTACTTCAGAAATGAGGG - Intergenic
1115540369 14:34413840-34413862 AAGCTGTCCTTCAGATATGAAGG + Intronic
1115619901 14:35131348-35131370 AAAATATCCTTCAGACATGAAGG - Intronic
1115695691 14:35896590-35896612 AAATTATTCTTCATAAATGAAGG - Intronic
1115861396 14:37689719-37689741 AAATTATCCTTCAGACATGAAGG + Intronic
1115867644 14:37765784-37765806 AAACTAGCCTTCAAAAATGAAGG - Intronic
1115873480 14:37833926-37833948 AAGTTATTGTTCAAAAATGATGG - Intronic
1116226556 14:42160941-42160963 AACAGACCCTTCAGAAATGAAGG - Intergenic
1116355018 14:43916608-43916630 AAAATATCCTTCAGACATGAAGG + Intergenic
1116475739 14:45336741-45336763 AAACTATCCTTCAGAAATGAAGG - Intergenic
1116506785 14:45692657-45692679 AAATTACCCTTCAAATCTGAAGG - Intergenic
1116685933 14:48038643-48038665 AAGTTATCCTTCACAAATGAAGG - Intergenic
1117184355 14:53225370-53225392 AAGGTATGCTTCAGAAATGACGG - Intergenic
1117345156 14:54824460-54824482 AAATTGTTCTTCAGAAATGAAGG + Intergenic
1117651629 14:57913917-57913939 AAATTATCCTTCAAAAGTGAAGG - Intronic
1117759531 14:59012726-59012748 ATATTACCCTTCATAAATGAAGG - Intergenic
1117918180 14:60700759-60700781 AAGCTATCCTTCAGCAATAAAGG - Intergenic
1117940400 14:60958263-60958285 AAGCTATCCTTCACCAATGAGGG - Intronic
1118018753 14:61689353-61689375 AAATTAACCTTCAAAAATGTTGG - Intergenic
1118499010 14:66339106-66339128 AAGTTATCATTCAAAAATGAAGG + Intergenic
1118518404 14:66552660-66552682 TAAATATCCTTCAGAAATGAGGG - Intronic
1118520559 14:66578728-66578750 AAGTTGTCCCTCAGAAATGAAGG + Intronic
1118546534 14:66895664-66895686 AAGTTACCATTCAAGAATGGGGG + Intronic
1118562863 14:67106138-67106160 AAGCTATCCTTTGGAAATGAGGG - Intronic
1118569501 14:67178966-67178988 AAGCTATCCTTCAGGAATGAGGG + Intronic
1118724276 14:68617601-68617623 AAGTTAAAATACAGAAATGAAGG - Intronic
1118933198 14:70262202-70262224 ACGTTACCCTTCAGTATTTATGG + Intergenic
1118964336 14:70565973-70565995 AAGCTGTCCTTCAGAAATGAAGG + Intergenic
1119072776 14:71604619-71604641 CAGTTATCCTTCATAAATGAAGG - Intronic
1119394297 14:74314879-74314901 CAGTGCCCCTTCTGAAATGAAGG + Intronic
1119741774 14:77018335-77018357 AAGTTTCCCATCAGCAAAGAGGG + Intergenic
1119796239 14:77400114-77400136 AAGTTATCCTTCTAAAGTGAAGG + Intronic
1120151234 14:81036500-81036522 AATTTATACTTCAGAAATGAAGG + Intronic
1120777149 14:88450542-88450564 AAATTAAGCTTCATAAATGAAGG - Intronic
1121399907 14:93665778-93665800 AAGCTATCCTTCAAGAATGAAGG + Intronic
1121480254 14:94262855-94262877 AAAATATCCTTCAGGAATGAAGG - Intronic
1121784572 14:96647487-96647509 AAGTTGTCATTCATAAATGAAGG - Intergenic
1122656559 14:103265405-103265427 AAGCTATCCCTCAAAAATGAAGG - Intergenic
1123111871 14:105875073-105875095 AAATTATCCTTCAAACATGAAGG - Intergenic
1124171673 15:27379655-27379677 AAACTACCCTTCAAAAATGAAGG - Intronic
1124173078 15:27394690-27394712 AAATTACCCTTCCAAAACGAAGG - Intronic
1124245200 15:28064035-28064057 AAACTGCCCTTCAAAAATGAGGG - Intronic
1124346579 15:28926758-28926780 AAAGTATCCTTCAAAAATGAAGG - Intronic
1124417842 15:29488833-29488855 AAAATACCCTTGAAAAATGAAGG + Intronic
1124823589 15:33071387-33071409 AAGTCATGCTTCATAAATGAAGG - Intronic
1125246997 15:37651952-37651974 AAGGTACTCTTCATAAATGATGG + Intergenic
1125365452 15:38910321-38910343 AAGTTATCCTTCAAGTATGAAGG - Intergenic
1125377702 15:39049735-39049757 AGGCTAGCCTTCAGAAATGAAGG + Intergenic
1125846953 15:42864647-42864669 AAATTATCCTTCAGAAATGAAGG + Intronic
1125980280 15:43994982-43995004 AAGCTGTCCTTCAGAAATGAAGG - Intronic
1126224335 15:46252764-46252786 AAATTATCCTTCAAAAGTGAAGG + Intergenic
1126252586 15:46586555-46586577 AACTTATCCTTCATAAATGAGGG - Intergenic
1126255317 15:46618239-46618261 AAGATACCTTTCAGAAATACAGG - Intergenic
1126273270 15:46846806-46846828 AAACTATCCTTCAGAAATGAAGG - Intergenic
1126440398 15:48682556-48682578 AAATTATCCTTCACAAGTGAAGG - Intergenic
1126480411 15:49112408-49112430 AAGTTATCCTTCATAAATGAAGG + Intronic
1126490150 15:49227961-49227983 AAATCATCCTTCATAAATGAAGG - Intronic
1126655342 15:50971181-50971203 AAGCTATCCTTCAGAAATAAAGG - Intronic
1126815948 15:52453333-52453355 AAGCTATCCTTCAAACATGAAGG + Intronic
1126858708 15:52863245-52863267 AAATTATCCTTCAGAAAATAGGG + Intergenic
1126871728 15:52996546-52996568 AAGTTCACCTTCACAAATGTGGG + Intergenic
1126996543 15:54450974-54450996 AAGTTATCCTTCATAAATAAAGG - Intronic
1127014674 15:54670227-54670249 AAACTAACCTTCATAAATGAAGG + Intergenic
1127339269 15:58023703-58023725 AAATTATCCTTCACAAATGAGGG + Intronic
1127403382 15:58614586-58614608 AAACTATCCTTCAGAAATGAGGG - Intronic
1127403388 15:58614641-58614663 AAACTAACCTTCAGAAATGAGGG + Intronic
1127694496 15:61432013-61432035 AAACTAACCTTCATAAATGAAGG - Intergenic
1127712617 15:61615086-61615108 AAACTATCCTTCAAAAATGAGGG + Intergenic
1127824177 15:62689619-62689641 AAATTATCCTTCATGAATGAAGG - Intronic
1128441832 15:67717259-67717281 TAGTTACCTTTCAGAAACTAAGG + Intronic
1128956239 15:71948778-71948800 AAAGTATCCTTCAAAAATGAAGG - Intronic
1129070780 15:72948729-72948751 CAGTTATCCTTCATAAATAAAGG + Intergenic
1129499973 15:76026436-76026458 AAGATATCCTTCAGGAATAAAGG + Intronic
1129573682 15:76717190-76717212 AAACTATCCTTCAGAAATGAAGG + Intronic
1130142377 15:81238864-81238886 AAACTACCCTTCAGGAATGATGG - Intronic
1130166423 15:81464906-81464928 AAGTTATCTGTCATAAATGAAGG - Intergenic
1130218223 15:81993210-81993232 AAGCTATCCTTCAGAAATGAAGG + Intergenic
1130249641 15:82290359-82290381 AAATTACTCTTCATAAGTGAAGG + Intergenic
1130344800 15:83033053-83033075 AAAATATCCTTCAAAAATGAAGG + Intronic
1130398564 15:83528034-83528056 AAGTTATCCTTCATAAAATAAGG - Intronic
1130450467 15:84046138-84046160 AAATTACTCTTCATAAGTGAAGG - Intergenic
1130692998 15:86102526-86102548 AAGTTATCCTTCATAAATGAAGG - Intergenic
1130786777 15:87106114-87106136 AGGTTAACCTTTATAAATGAAGG + Intergenic
1131004973 15:88970535-88970557 TAGCTATCCTTCAGAAATGAAGG - Intergenic
1131499763 15:92950790-92950812 AAGCTTCCTTTCAGCAATGAGGG - Intronic
1131640669 15:94289372-94289394 AAAATATCCTTCAGAAATGAAGG + Intronic
1131660306 15:94507117-94507139 AAGTTATCCCTTAGAAATGAAGG + Intergenic
1131768217 15:95704016-95704038 AAATTATCCTTCAGCATTGAAGG - Intergenic
1131769719 15:95723684-95723706 AAAGTATTCTTCAGAAATGAAGG - Intergenic
1131794187 15:95997188-95997210 AATTTGCCTTTGAGAAATGATGG - Intergenic
1131987347 15:98057164-98057186 AAGTTATCCTTCATCAATGAAGG - Intergenic
1132297009 15:100745863-100745885 AAATTATCCTTCAAAAGTGAAGG - Intergenic
1132439039 15:101840846-101840868 AAATTATCCTTCAAACATGAAGG - Intergenic
1132993372 16:2809205-2809227 AACCTATCTTTCAGAAATGAGGG - Intergenic
1132995084 16:2818538-2818560 AGGGTCCCCTGCAGAAATGAAGG - Intronic
1133375663 16:5284707-5284729 AAGCTGTCCTTCAAAAATGAAGG - Intergenic
1133571716 16:7047279-7047301 AAAATATCCTTTAGAAATGAAGG - Intronic
1135280001 16:21146107-21146129 AAGTCACCCTTCAAAAATTAGGG + Intronic
1135293602 16:21260890-21260912 AAGGTACCCTTCAGAGGTGGAGG - Intronic
1136284213 16:29231737-29231759 AAATAACCCTTTACAAATGAAGG + Intergenic
1136313522 16:29433027-29433049 AAGTTACTCTACAGAAAAGATGG - Intergenic
1136326965 16:29534792-29534814 AAGTTACTCTACAGAAAAGATGG - Intergenic
1136441656 16:30274777-30274799 AAGTTACTCTACAGAAAAGATGG - Intergenic
1137341819 16:47614967-47614989 TAACTACCCTTCAGTAATGAAGG - Intronic
1137880733 16:52045337-52045359 AAGATGTCCTTCAGAAATGAAGG - Intronic
1137957841 16:52851043-52851065 AAGTTATTCTTCATAAATGTAGG - Intergenic
1138020700 16:53478028-53478050 AAGTTATCTTTCAGAAATGAAGG - Intronic
1138176524 16:54903537-54903559 AAATTACCCTTCAAAAGTAAAGG + Intergenic
1138712398 16:58984288-58984310 AAGCTGTCCTTCAGAAATGAGGG + Intergenic
1139098734 16:63738299-63738321 AAATTATCCTTCAAAAGTGAAGG + Intergenic
1139100093 16:63755486-63755508 AAGCTATCCTTCAGATATGAAGG + Intergenic
1139141695 16:64271313-64271335 AAGTAGTCCTTCAGAAGTGATGG + Intergenic
1139888447 16:70228509-70228531 AAGTTACTCTACAGAAAAGATGG - Intergenic
1140158341 16:72457465-72457487 AAGCTGTCCTTCAGAAATAAGGG - Intergenic
1140318690 16:73926433-73926455 AAAATATCCTTCAGGAATGAAGG - Intergenic
1140325953 16:74003720-74003742 AAGCTATCCTTCAAAAATGATGG - Intergenic
1140560924 16:75980635-75980657 AGTTTACCCTTCTGAAATGATGG + Intergenic
1140568348 16:76071750-76071772 AAACTATGCTTCAGAAATGAAGG - Intergenic
1140570626 16:76102488-76102510 AAGCTTTCCTTCAGAAATGAAGG - Intergenic
1140617683 16:76686442-76686464 TAATTATCCTTCAAAAATGAAGG + Intergenic
1141024652 16:80534196-80534218 AAAATACCCTTCAGTAATAAAGG - Intergenic
1141496375 16:84413208-84413230 AAATTATCCTTCAGAAAATACGG - Intronic
1142089247 16:88201246-88201268 AAATAACCCTTTACAAATGAAGG + Intergenic
1142333497 16:89471389-89471411 AAGTTACCCTGCAGCCCTGAAGG + Intronic
1142452042 16:90180512-90180534 AACTTATCCTTCAAAAATGAAGG - Intergenic
1143227620 17:5320283-5320305 AAGTTATCCTTCAAATATGAAGG + Intronic
1144048853 17:11480028-11480050 AAATTATCCTTCAGAAGTGAAGG - Intronic
1144195648 17:12892185-12892207 AAAATATTCTTCAGAAATGAAGG - Intronic
1146298350 17:31669167-31669189 AAACTACGCTTCATAAATGAAGG - Intergenic
1146576675 17:33999992-34000014 AAGCTGTCCTTGAGAAATGAAGG - Intronic
1146828344 17:36044276-36044298 AAAATAGCCTTCAAAAATGAAGG - Intergenic
1148375561 17:47142281-47142303 TATTTTCCCTTCTGAAATGATGG + Exonic
1149113047 17:53057601-53057623 AAATTGTCCTTCAAAAATGAAGG + Intergenic
1149168510 17:53781885-53781907 AAATTAAGCTTCATAAATGAAGG + Intergenic
1149364350 17:55926579-55926601 AAGTTATACTTTAGAAATGAAGG - Intergenic
1149526817 17:57362862-57362884 AAGTTTCCATTTAAAAATGAAGG + Intronic
1149550179 17:57533923-57533945 TAGATCCCCTTCAGGAATGAAGG - Intronic
1149674666 17:58448635-58448657 AAGCTATCCTTCAAACATGAAGG + Intronic
1149731355 17:58949847-58949869 AAGCTATTCTTCAAAAATGAAGG - Intronic
1149768022 17:59296431-59296453 AAGTTACCGGCAAGAAATGAGGG - Intergenic
1149912473 17:60578955-60578977 AACTTTCCCTGCAGAAATGTAGG - Intronic
1149931457 17:60760438-60760460 AAATTATCCTTCATGAATGAAGG - Intronic
1149943525 17:60897150-60897172 AAATTACCCTTCATAAATGAAGG - Intronic
1150195023 17:63288930-63288952 AAATTATCCTTCAGAAGTAAAGG - Intronic
1150897636 17:69232796-69232818 AAGCTGTCCTTCAGAAATGAAGG - Intronic
1150916295 17:69440680-69440702 AAAATACCCTTCAGAAATGAAGG - Intronic
1151004249 17:70415411-70415433 AAGCTACCATTGAGAAATGATGG + Intergenic
1151023835 17:70653825-70653847 AAAATATCCTTCACAAATGATGG + Intergenic
1151123979 17:71825156-71825178 ATGGGAGCCTTCAGAAATGAGGG - Intergenic
1151142162 17:72004020-72004042 CAGTTACCCATCAGAAAGGCAGG + Intergenic
1151503631 17:74511294-74511316 AAAATACCCTTCAAACATGAAGG - Intergenic
1153122806 18:1750999-1751021 AAATTATTCTTCAAAAATGAAGG + Intergenic
1153365361 18:4249541-4249563 CAGTAACCGTTCAGTAATGATGG + Intronic
1153370803 18:4313693-4313715 AAGAGAACCTTCTGAAATGATGG + Intronic
1153544670 18:6193525-6193547 AAGAGAACCTTCAGAAAAGAGGG + Intronic
1153562900 18:6389191-6389213 AAATTAACTTTCACAAATGAAGG + Intronic
1153648669 18:7219673-7219695 AGGCTATCCTTCAGAATTGAAGG - Intergenic
1154231997 18:12565332-12565354 AAATTACCCATCAGAAGTGAAGG + Intronic
1155018597 18:21873045-21873067 AAATTATCCTTCAAAAATAAAGG + Intergenic
1155088208 18:22477988-22478010 AAGTTATACTTCATAAGTGAAGG + Intergenic
1155109364 18:22698789-22698811 AGATAACCCTTAAGAAATGAAGG - Intergenic
1155486077 18:26344461-26344483 AAAATATCCTGCAGAAATGAAGG + Intronic
1155486373 18:26347244-26347266 AAACTATCCTTCAGAAATGAAGG + Intronic
1155756177 18:29499222-29499244 AAGTTTTCCTTCAGATATGAAGG + Intergenic
1155762500 18:29585538-29585560 AAGTTGTTCTTCAGAAATAAAGG + Intergenic
1155766531 18:29641556-29641578 AAATTACACTTCAAAAGTGAAGG - Intergenic
1155807500 18:30190815-30190837 AAATGATCCTTCATAAATGAAGG - Intergenic
1155882038 18:31161885-31161907 AACTCACACCTCAGAAATGATGG + Intronic
1155981328 18:32183155-32183177 AAATTATCCTTCAAAAGTGAAGG - Intronic
1156135649 18:34033942-34033964 AAATTAACCCTCATAAATGAAGG + Intronic
1156428404 18:37042483-37042505 AAACTAACCTTCAAAAATGAAGG - Intronic
1156432888 18:37094400-37094422 AAGTTATCCTTCAAAAATGAAGG + Intronic
1156594674 18:38534391-38534413 TATTTGTCCTTCAGAAATGAAGG + Intergenic
1156619854 18:38837113-38837135 AAATTGCCCTTCAAAAGTGAAGG + Intergenic
1156653368 18:39253748-39253770 AACTTACACTTGATAAATGAAGG + Intergenic
1156695657 18:39763360-39763382 AAATTATTCTTTAGAAATGAAGG + Intergenic
1156893196 18:42214010-42214032 AAACTACACTTCATAAATGAAGG - Intergenic
1157398662 18:47367316-47367338 AAGCTATTCTTCAGAAATGAAGG - Intergenic
1157458055 18:47855569-47855591 AAGCTGTCCTTCAGAAATGAAGG - Intronic
1157708341 18:49828299-49828321 AAACTACCCTTCAAGAATGAAGG + Intronic
1157973902 18:52303351-52303373 TATCTGCCCTTCAGAAATGAAGG + Intergenic
1158017063 18:52796557-52796579 AAGGTATCTTTCAAAAATGAAGG - Intronic
1158097811 18:53794238-53794260 AAGCTACGCTTTATAAATGAAGG + Intergenic
1158148173 18:54339627-54339649 AAGTTATCTTTCAAAAATAAAGG + Intronic
1158735798 18:60077211-60077233 AAGTTATCTTTCATTAATGAAGG + Intergenic
1159301853 18:66583034-66583056 AATTTACCCTTGACAAATAAGGG - Intronic
1159416709 18:68159448-68159470 AAGCTATACTTTAGAAATGAAGG - Intergenic
1159560516 18:69987774-69987796 AAGTAAATCTTCAGAAATGAAGG + Intergenic
1159627259 18:70709149-70709171 AATATACCCTTCAAAAATGTTGG - Intergenic
1159680467 18:71344362-71344384 AAGCTATCCTACGGAAATGAAGG - Intergenic
1159747614 18:72257474-72257496 AAGTTTCCCCTCAGAAATGCAGG + Intergenic
1159821358 18:73149167-73149189 AAGTTATCCTTTAGAAATGAAGG - Intergenic
1159823754 18:73179090-73179112 AAGTTGTCTCTCAGAAATGAAGG + Intronic
1159849466 18:73510331-73510353 AAATTATCCTTCAGAAGTGAAGG + Intergenic
1160311746 18:77798900-77798922 AAACTATCCTTCAGGAATGAAGG - Intergenic
1160465942 18:79076392-79076414 AAATTATCCTTCAGGAATGAAGG - Intronic
1160645444 19:188539-188561 AACTTATCCTTCAAAAATGAAGG + Intergenic
1161741813 19:6025676-6025698 AAAATACCCTTCAGCAATGAAGG - Intronic
1162002579 19:7756495-7756517 AAGTTATTCTTCAAAAATGAAGG - Intergenic
1162243350 19:9377006-9377028 AAAATGGCCTTCAGAAATGAAGG - Intronic
1162692616 19:12446442-12446464 AAAATATCCTTCAGACATGAAGG - Intronic
1163853336 19:19679771-19679793 AAGGTAACCTGCGGAAATGAAGG - Exonic
1163975061 19:20842885-20842907 AAATTAACCTTCATAAGTGAAGG + Intronic
1164497580 19:28782034-28782056 AAATTAAGCTTCATAAATGAAGG - Intergenic
1164569240 19:29358112-29358134 AAGTTGTCTTTCAAAAATGAGGG + Intergenic
1164946878 19:32302842-32302864 AAGCTATCCTTCAGAAATGAGGG - Intergenic
1165017586 19:32892728-32892750 AAGTTATCCTTCATAAATGAAGG + Intronic
1165165538 19:33851667-33851689 AAATTTTCCTTCACAAATGAAGG + Intergenic
1165337817 19:35184547-35184569 AATCTATCCTTTAGAAATGAAGG + Intergenic
1165537406 19:36460958-36460980 AAAATATCCTTCAGTAATGAAGG + Intronic
1165583867 19:36895219-36895241 AAGCCATCCTTCAAAAATGAAGG + Intronic
1165646231 19:37440248-37440270 AACTTATCTTTCAAAAATGAAGG + Intronic
1166206404 19:41272431-41272453 AAGTTACCCTGCAGGTAAGAAGG - Intronic
1166623036 19:44321728-44321750 AAGTTATCCTTCAAATATGAAGG - Intergenic
1167190480 19:47985398-47985420 AAATTATTCTTCAGAAGTGAAGG + Intronic
1167304453 19:48699140-48699162 ATGGGAGCCTTCAGAAATGAAGG + Intronic
1167728027 19:51232146-51232168 AAGCTATCTTTCAGAAAAGAAGG - Intronic
1168634603 19:57986109-57986131 AAATTATCCTTCAAAAATGAAGG + Intronic
924968996 2:106923-106945 AAATTATCCTTTATAAATGAAGG - Intergenic
925127297 2:1468452-1468474 AAGCTAAGCTTCATAAATGAAGG - Intronic
925325208 2:3013901-3013923 AATCTAACCTTCAGATATGAAGG + Intergenic
925326942 2:3030427-3030449 AAAATATCCTTCAGGAATGAAGG + Intergenic
925488659 2:4367478-4367500 AAGCTGTCCTTTAGAAATGAAGG - Intergenic
925570502 2:5306370-5306392 GAAGTATCCTTCAGAAATGAAGG - Intergenic
925671907 2:6319092-6319114 AAATTAAGCTTCACAAATGAAGG + Intergenic
925951832 2:8921638-8921660 AAATTATCCTTCAAGAATGAAGG - Intronic
926244192 2:11110444-11110466 AAATTATCATTCAGGAATGATGG + Intergenic
926261738 2:11270057-11270079 AAATTATCCTTCAAAAGTGATGG - Intronic
926575598 2:14576779-14576801 AAAATACCCTTCAGGAATGAAGG - Intergenic
926617582 2:15012801-15012823 AAACTACCCTTCAGAAATGAAGG + Intergenic
926921256 2:17942443-17942465 CATTTAACCATCAGAAATGATGG - Intronic
927052378 2:19343046-19343068 AAATTAACCTTCAAGAATGAAGG + Intergenic
927080745 2:19627557-19627579 AAGCTATCATTCAAAAATGAAGG + Intergenic
927352090 2:22127568-22127590 AAGCTGCCCTTCAGAAATGAAGG + Intergenic
928067262 2:28177305-28177327 AAGTTATCTTTCACAAATGAAGG + Intronic
928297118 2:30093435-30093457 AAAATACCCTTTAGGAATGAAGG + Intergenic
928484323 2:31713852-31713874 AAAATATCCTTCAGACATGAAGG + Intergenic
928739225 2:34330372-34330394 AAATTACCCTTGAGATATCAAGG + Intergenic
928757109 2:34540397-34540419 AAATTATCCTTCATAAATGAAGG - Intergenic
928825160 2:35411850-35411872 AACTTACCGATTAGAAATGAAGG - Intergenic
928849218 2:35722196-35722218 AAGCTATCCTTCAGAAATGAAGG + Intergenic
929164805 2:38870942-38870964 AAGCTATCTTTCAAAAATGAAGG + Intronic
929734596 2:44533558-44533580 AAATTATTCTTCATAAATGAAGG + Intronic
929785993 2:44991752-44991774 AAACCATCCTTCAGAAATGAAGG - Intergenic
929812511 2:45202589-45202611 AAGTTTCCCTTCAAAAATAAAGG + Intergenic
930252939 2:49055806-49055828 AAGCTACATTTCAGAAATGAAGG + Intronic
930294146 2:49532326-49532348 AAACTGCCCTTCAAAAATGAAGG + Intergenic
931134327 2:59378889-59378911 AAGTTACTATTCAAAAATGAAGG + Intergenic
931505331 2:62920376-62920398 AAACTGCCCTTCAAAAATGAGGG + Intronic
932526355 2:72473998-72474020 AAATTATTCTTCATAAATGAAGG - Intronic
933003303 2:76954979-76955001 ACAATATCCTTCAGAAATGAAGG + Intronic
933398083 2:81756701-81756723 AAACTAACCTTCATAAATGAAGG + Intergenic
933629800 2:84643114-84643136 AAATTATCCTTCAAAAGTGAAGG - Intronic
933863728 2:86497169-86497191 AAATTATCCTTCAAGAATGAAGG - Intergenic
933988838 2:87617963-87617985 CAGATATCCTTGAGAAATGAAGG + Intergenic
934693140 2:96377387-96377409 AAGCTGTCCTTCAAAAATGAAGG - Intergenic
934878744 2:97952949-97952971 AAGCTATCCTTCAAAAAAGAAGG + Intronic
934982344 2:98853384-98853406 AAATTATCCTTCAATAATGAAGG + Intronic
935018692 2:99209806-99209828 AAAATACCCTTCAAATATGAAGG - Intronic
935208302 2:100915697-100915719 AAAATATCCTTCAGGAATGAAGG + Intronic
935390728 2:102550005-102550027 AAATTATCCTTGAGAAATGAAGG + Intergenic
935464252 2:103377444-103377466 AAACTATCTTTCAGAAATGAAGG - Intergenic
935491417 2:103724928-103724950 AAGTTGTCCTTCACAAATGAAGG - Intergenic
935505919 2:103902733-103902755 AAAATACGCTTCAGAAGTGAAGG - Intergenic
935531763 2:104241262-104241284 AAACTATCCTTCAGAAATAAAGG + Intergenic
935605130 2:104964628-104964650 AAAATATCCTTCAAAAATGAAGG - Intergenic
935738281 2:106124239-106124261 AAGCTACCCTCCAAAAAAGATGG + Intronic
935964512 2:108460674-108460696 AAATTATCCTTCATAAATGAAGG - Intronic
936292972 2:111241301-111241323 AAATTATCCTTCAAGAATGAAGG + Intergenic
936305006 2:111332860-111332882 CAGATATCCTTGAGAAATGAAGG - Intergenic
936380123 2:111977285-111977307 AAAATACCTTTCAAAAATGAAGG - Intronic
936595460 2:113843044-113843066 AAGTTATCTTTCAGTAAAGAGGG + Intergenic
936766654 2:115858171-115858193 AAGCCAACCTTCAGAAATGAAGG - Intergenic
936942259 2:117897200-117897222 AAATTATCCTTTAAAAATGAAGG - Intergenic
937068135 2:119035216-119035238 AAGCTATCCTTCAAATATGAAGG + Intergenic
937137702 2:119568940-119568962 AAATTATCCTTCAAAAGTGAAGG - Intronic
937194211 2:120135749-120135771 AAGATACCCTTCAAACATGAAGG + Intronic
937545113 2:123006899-123006921 GAGTTATCCTTCCAAAATGAAGG + Intergenic
937614215 2:123901408-123901430 AAGTTATCATTCAAAAATGAGGG - Intergenic
937959858 2:127449299-127449321 AAATTATCCTTCAAAAGTGAAGG - Intronic
938127268 2:128683645-128683667 AAGCTGCCCTCCAGAAATGTTGG - Intergenic
938142434 2:128807376-128807398 AAATTATCCATCAGAAATGAAGG - Intergenic
938208998 2:129449196-129449218 AAAATACCTTTTAGAAATGAAGG + Intergenic
938232875 2:129677073-129677095 AAATTATCCTTCAGAAATAGGGG - Intergenic
938538180 2:132262486-132262508 TATTTTCCCTTCTGAAATGATGG - Intergenic
938707698 2:133947015-133947037 AACTTAACCCTCAGAAATGCTGG + Intergenic
938784538 2:134613666-134613688 AAATTGTCCTTCAAAAATGAAGG + Intronic
938800009 2:134753312-134753334 AAGATATTCTTCAAAAATGAAGG + Intergenic
939065377 2:137477823-137477845 AAGTTACCCTTCATAAATGAAGG - Intronic
939080312 2:137653165-137653187 AAGTTATCCTCCAGATATAAAGG - Intronic
939449381 2:142353246-142353268 AAATTAAGCTTCATAAATGAAGG + Intergenic
939703569 2:145423296-145423318 AAACTATCCTTCAGAAATGGAGG + Intergenic
939847502 2:147266446-147266468 AAATTATCCTTCAAAAATGAAGG - Intergenic
939976387 2:148721269-148721291 AAAATACCCTTCAAAAGTGAAGG - Intronic
940091087 2:149918122-149918144 AAGCTGTCCTTCAGAAATAAAGG + Intergenic
940429581 2:153574080-153574102 AAGATATCCTTCACATATGAAGG - Intergenic
940463713 2:154001896-154001918 AAGCTATCCTTCAAACATGAAGG - Intronic
940557839 2:155254886-155254908 AAATTATCCTTCATAAGTGAAGG - Intergenic
940741280 2:157511393-157511415 AAAATATCCTTCAAAAATGAAGG + Intergenic
940786162 2:157983492-157983514 AAATTGCCCTTCAAACATGAAGG - Intronic
940923778 2:159340661-159340683 AAGAAAGCCTTCAGAAATGAAGG + Intronic
940949395 2:159655288-159655310 AAATTAGCTTTCAGAAATGAAGG - Intergenic
940950757 2:159670865-159670887 GAAGTATCCTTCAGAAATGATGG - Intergenic
941101819 2:161305135-161305157 AAACTATCCTTCAAAAATGAAGG - Intergenic
941125303 2:161577290-161577312 AAATTATCCTTCAGGAATTAAGG - Intronic
941233969 2:162945986-162946008 AAATTAACCTTCAAACATGAAGG + Intergenic
941477180 2:165964460-165964482 AAGTTATCTTTCAAATATGAAGG - Intergenic
941521796 2:166554246-166554268 AAGGTATCTTTCAAAAATGAAGG + Intergenic
941674679 2:168330806-168330828 AATTTATCTTTCATAAATGAAGG + Intergenic
941832362 2:169976496-169976518 AAGCTATCCTACAGAAATAATGG - Intronic
942056347 2:172187181-172187203 AAATTATCCTTCAAAAATGAAGG - Intergenic
942100534 2:172578065-172578087 AAACTATCCTTCAAAAATGAAGG - Intronic
942119347 2:172761508-172761530 AAAATATCCTTCAGGAATGAAGG + Intronic
942295698 2:174515035-174515057 AAATTATCCTTCAAAAGTGAAGG - Intergenic
942364575 2:175210787-175210809 AAATTATCCTTCAAAAGTGAAGG - Intergenic
942736982 2:179125530-179125552 ACGTTACCCTTCTGATGTGAGGG - Intronic
942832255 2:180251142-180251164 AAGTTACTCTTAAAAATTGAAGG + Intergenic
942838427 2:180329506-180329528 AAAATACCCTTCAAACATGAAGG + Intergenic
942939560 2:181600100-181600122 AAATTAAGCTTCATAAATGAAGG + Intronic
943017491 2:182530676-182530698 AAAATATTCTTCAGAAATGAAGG + Intergenic
943088012 2:183337756-183337778 AAACTGTCCTTCAGAAATGAGGG - Intergenic
943199451 2:184801059-184801081 AACTTACCCTTCAAAAGAGAAGG - Intronic
943309899 2:186312530-186312552 AAAATACCCTTCAAACATGAAGG + Intergenic
943437856 2:187889217-187889239 AAGATAACCTTCCAAAATGAAGG + Intergenic
944078404 2:195757979-195758001 AAGTTACCATACTGAAATCAGGG + Intronic
944269117 2:197760996-197761018 AAGCTATCCTTCAGAAATGAAGG + Intronic
944366144 2:198921920-198921942 AAGCTATCTTTCAAAAATGAAGG + Intergenic
944763684 2:202842392-202842414 AAGTAGACCTCCAGAAATGATGG - Intronic
944829233 2:203515778-203515800 AAATCACCCTTCAAAAGTGAAGG + Intronic
945174185 2:207025123-207025145 AACCTATCCTTCAGAGATGAAGG + Intergenic
945309372 2:208293521-208293543 ATGATACCCTTCAAAAGTGAAGG - Intronic
945354659 2:208825518-208825540 AAGTTACCCTTCAGAAATGACGG + Intronic
945377209 2:209093159-209093181 AAATTAAGCTTCATAAATGAAGG - Intergenic
946197965 2:218049328-218049350 AAATTATCCTTCAAAGATGAAGG - Intronic
946454248 2:219811042-219811064 AAACTATCCTTCAGAAATGAAGG - Intergenic
946547579 2:220761557-220761579 AAAATATTCTTCAGAAATGAAGG - Intergenic
946694154 2:222335204-222335226 AAGTTATCCTTCATAAATGAAGG + Intergenic
946948989 2:224851716-224851738 AAGTAACCCATAAAAAATGAGGG - Intronic
946991783 2:225339444-225339466 AATTTATCCTACAGAAATAAAGG + Intergenic
947043573 2:225951396-225951418 AAGTTACCCTTCATAAATAAAGG + Intergenic
947467705 2:230368214-230368236 AAGGTGTCCTTCAGAAATGAAGG - Intronic
947474323 2:230429189-230429211 AAGCTGTCCTTCAGAAGTGAAGG - Intronic
947678110 2:232003681-232003703 AAAATATCCTTCAGTAATGAAGG - Intronic
947880337 2:233503670-233503692 AAGCTATCCTTCAGAAATAAAGG + Intronic
947939495 2:234037267-234037289 AAATAATCCTTCACAAATGAGGG + Intergenic
948336955 2:237216835-237216857 AAATTATCCTTCAAAAATTAAGG + Intergenic
948511480 2:238468380-238468402 AAGATATCCTTCAGAAATGAAGG - Intergenic
948605758 2:239133773-239133795 AAGTGTCACTTCAGAAATGAGGG - Intronic
948714354 2:239850531-239850553 AAGCTATCCTTTAGAAATGCAGG - Intergenic
948774882 2:240279636-240279658 AAAATATCCTTCAGACATGAAGG + Intergenic
948812628 2:240491652-240491674 AAATTATCTTTCATAAATGAAGG - Intronic
949037727 2:241825266-241825288 CAGTTACCCCGCAGAATTGAAGG + Intergenic
949083468 2:242125062-242125084 AACTTATCCTTCAAAAATGAGGG - Intergenic
1168730581 20:75928-75950 AAGCTATACTTCAGAAATGAAGG + Intergenic
1168885732 20:1252910-1252932 CAGAAACCCTTCTGAAATGAAGG - Intronic
1168894496 20:1313751-1313773 CAGTTTCCCTTGGGAAATGAAGG - Intronic
1169083457 20:2812758-2812780 AAGAGACTCTTCAGAATTGAAGG - Intergenic
1169323810 20:4658319-4658341 AAATTATCCTTCAGAAAAGGAGG + Intergenic
1169412601 20:5384594-5384616 AAGTTATCCTTCATAAATGAAGG + Intergenic
1169625287 20:7561056-7561078 AAATTACTCGTCACAAATGAAGG - Intergenic
1170087184 20:12546876-12546898 AAGTTGATCTTCACAAATGAAGG - Intergenic
1170093513 20:12618914-12618936 AAGTTATTCTTCATAAATGAAGG + Intergenic
1170132807 20:13040827-13040849 AAACTAGCCTTCAAAAATGAAGG - Intronic
1170193685 20:13669017-13669039 AAATTATCCTTCAAAAGTGAAGG - Intergenic
1170266777 20:14475633-14475655 AAGCTTTCCATCAGAAATGAAGG - Intronic
1170330668 20:15207302-15207324 AACTTATCCTTCAGGAATGAAGG - Intronic
1170410429 20:16083613-16083635 AATATATCCATCAGAAATGAAGG + Intergenic
1170646559 20:18201626-18201648 AAGCTATCCTTCAGAAATAAAGG - Intergenic
1170657948 20:18307360-18307382 AAGATACACTTCAAGAATGAAGG - Intronic
1170872636 20:20220759-20220781 ACAGTACCCTTCTGAAATGATGG - Intronic
1170903212 20:20486326-20486348 AAATTATCCTTCAAAAGTGAAGG - Intronic
1171001507 20:21420829-21420851 AAGATATCCTTCATAAATGAAGG - Intergenic
1171113013 20:22501488-22501510 AAGTTTCCCTTCAGAATGGCAGG - Intergenic
1171155437 20:22868442-22868464 AAATTATCCTTCAGAAGTGAAGG + Intergenic
1171908144 20:30918257-30918279 TATTTTCCCTTCTGAAATGATGG + Intergenic
1172659572 20:36558372-36558394 AAGTCACACTTGAGAACTGAAGG - Intergenic
1173230324 20:41190780-41190802 AAATTATCCTTCATAAATGAAGG - Intronic
1173483281 20:43420390-43420412 AAGCTATCCTTCAAAAATGAAGG + Intergenic
1173563681 20:44023847-44023869 AAGTTTCCCTGCAGAAGTGAGGG - Intronic
1173711809 20:45164310-45164332 TAATTATCCTTCAAAAATGAAGG + Intergenic
1173717060 20:45217646-45217668 AAGCTATCCTTCAGAAATGAAGG - Intergenic
1173719076 20:45237386-45237408 AAGTTGTCTTTCAGAAATGAAGG - Intergenic
1173769226 20:45643864-45643886 AAGCTATCCTTCAGAAATGAAGG - Intergenic
1173772761 20:45677597-45677619 AATCTACCCTTCAAACATGAAGG - Intergenic
1173778384 20:45731808-45731830 ACATTATCCTTCAGAAATGAAGG - Intergenic
1174169920 20:48609915-48609937 AAAATACCCTTCAAACATGAGGG + Intergenic
1174804999 20:53597624-53597646 AACTTACCTTTCAGAAGAGAAGG + Intronic
1175288438 20:57854981-57855003 AAAATACCCTTCAAAACTGAAGG - Intergenic
1175548352 20:59796593-59796615 AAGCTATCCTTGAGAAATGGAGG - Intronic
1175797577 20:61781999-61782021 AAAATATCCTTCAAAAATGAAGG + Intronic
1176055764 20:63147585-63147607 AAGCTATCCTTCATAAATGAGGG - Intergenic
1176280062 20:64297687-64297709 AACTTATCCTTCAAAAATGAGGG - Intergenic
1176360584 21:5993633-5993655 AAGTTATCCTTCAGAAATGAGGG - Intergenic
1176369129 21:6052046-6052068 AAGTCACCCAGCAGACATGAGGG - Intergenic
1176553446 21:8241696-8241718 TATTTTCCCTTCTGAAATGACGG + Intergenic
1176572368 21:8424720-8424742 TATTTTCCCTTCTGAAATGACGG + Intergenic
1176580277 21:8469280-8469302 TATTTTCCCTTCTGAAATGACGG + Intergenic
1177072710 21:16530738-16530760 AAAATATCCTTTAGAAATGAAGG - Intergenic
1177106698 21:16965580-16965602 AAGCTATTCTTCAGAAATGAGGG - Intergenic
1177454172 21:21314241-21314263 AAAATCCCCTTCAGACATGAAGG - Intronic
1177698859 21:24610267-24610289 AAGGTATCCTTCAAAAAGGAAGG - Intergenic
1177746478 21:25221009-25221031 AAGTTATCCTTTAGAAGTTAAGG - Intergenic
1177768083 21:25481643-25481665 AAGCTATCTTTCAAAAATGAAGG + Intergenic
1177843766 21:26264478-26264500 AAAATATCCTTCAGAAATGAAGG + Intergenic
1178200757 21:30402151-30402173 AATATATCCTTCAAAAATGAAGG + Intronic
1178243322 21:30927344-30927366 AAACTATCCTTCAGAAATGAAGG + Intergenic
1178526409 21:33333234-33333256 AAACTATCCTTCAGGAATGAGGG + Intronic
1178596579 21:33959214-33959236 AAAATATCCTTCAGGAATGATGG + Intergenic
1178679590 21:34661684-34661706 AAGTTATCCTTCTTAAATGAAGG + Intergenic
1178990269 21:37348643-37348665 AAAATATCCTTCAAAAATGAAGG - Intergenic
1179019822 21:37628940-37628962 AAATTATCCTTCACAAATGAAGG + Intronic
1179562614 21:42225679-42225701 CAGTTACTCTGCAGAGATGACGG + Exonic
1179754390 21:43486495-43486517 AAGTCACCCAGCAGACATGAGGG + Intergenic
1179762934 21:43544917-43544939 AAGTTATCCTTCAGAAATGAGGG + Intronic
1179769328 21:43602822-43602844 AAGTGACCATTCAGGAATGTGGG + Intronic
1179930061 21:44562767-44562789 AAGTTGTCTTTCAGAAATGAAGG + Intronic
1180341580 22:11624419-11624441 TATTTTCCCTTCTGAAATGATGG + Intergenic
1181448358 22:22997840-22997862 AAGCTATCCTTCAGAAATGAAGG + Intergenic
1181485475 22:23228599-23228621 AAAATATCCTTCAGGAATGAAGG - Intronic
1181866618 22:25862561-25862583 AAATTATTCTTCAAAAATGAAGG - Intronic
1182539401 22:31029379-31029401 AAATTATCCTTCAGGAATAATGG - Intergenic
1182971092 22:34577721-34577743 AAATTACCCTTCAAAAGTGAAGG - Intergenic
1183033543 22:35123415-35123437 AAAATATCCTTCAGGAATGAAGG - Intergenic
1184632541 22:45794724-45794746 AAAATATCCTTCAAAAATGAAGG + Intronic
1184755616 22:46514305-46514327 TAATCACCCTTCAGAAATGCCGG - Intronic
1184888590 22:47365525-47365547 AAGTTGTTCTTCAGAAATAAAGG - Intergenic
1185090579 22:48768262-48768284 AAAATATCCTTCAGTAATGAAGG - Intronic
1185115616 22:48934512-48934534 AAGCTATTCTTCAGAAATGAAGG - Intergenic
1203258444 22_KI270733v1_random:158724-158746 TATTTTCCCTTCTGAAATGACGG + Intergenic
949162900 3:902197-902219 AAGCTGTCCTTCAGCAATGAAGG + Intergenic
949427964 3:3940117-3940139 AAATTAAGCTTCATAAATGAAGG - Intronic
949475036 3:4435772-4435794 AAAATTCCCTTCAGGAATGAAGG + Intronic
949607248 3:5666757-5666779 AAGTTATTTTTCAAAAATGAAGG + Intergenic
949744578 3:7274494-7274516 AAATTACTCTTCAAAAGTGAAGG - Intronic
949754135 3:7390100-7390122 AAATTAAGCTTCATAAATGAAGG - Intronic
949793917 3:7824864-7824886 AAGTTATCCTTCAGAAATGAAGG + Intergenic
949868941 3:8570548-8570570 GAGTGACCCATCAGATATGAAGG - Intergenic
950701244 3:14750220-14750242 AAGCTATCCTTCAAAAATGAAGG - Intronic
951134070 3:19083153-19083175 AAATTATCCTTCAAAAATGAAGG + Intergenic
951241650 3:20293542-20293564 AAGTCATCATTCAAAAATGAAGG - Intergenic
951281978 3:20762278-20762300 AAGCTGTCCTTCAGAAATGAAGG - Intergenic
951328352 3:21333287-21333309 AAGCTGACCTTCAGAAATGAGGG + Intergenic
952016938 3:28969058-28969080 AAATTACCCTTCTTAAATGAAGG - Intergenic
952243526 3:31560497-31560519 AAATTATCCTTCATAAATGAAGG - Intronic
952439409 3:33310702-33310724 AAGCTGTCCTTCAGAAATGAAGG - Intronic
952594610 3:35000952-35000974 AAAATATCCTTCAGAAATGAAGG + Intergenic
952699836 3:36315488-36315510 AAGTTATCTTTCATAAATGAAGG - Intergenic
952939871 3:38434470-38434492 AAGTTACCCTTCATAAATGAAGG + Intergenic
953038075 3:39230314-39230336 AAAGTATCCTTCAGAAATGGAGG - Intergenic
953101012 3:39827828-39827850 AAGCTATCCTTCAGAATTGAAGG - Intronic
953112081 3:39952766-39952788 AAATTATCTTTCAAAAATGAGGG - Intronic
953220546 3:40967619-40967641 AACTTATTCTTCATAAATGAGGG - Intergenic
953729432 3:45433836-45433858 AAAATATCCTTCAGAAACGAAGG - Intronic
954007147 3:47600632-47600654 AAGTTACTCCTTAGAAAGGAAGG - Intronic
954588180 3:51755118-51755140 AAATTATCCTTCAAAAGTGAAGG - Intergenic
954953925 3:54501867-54501889 AAATTACCCTTCACAAGTAAAGG - Intronic
955118739 3:56033615-56033637 AAGCTGTCCTTCAGAAATTAAGG - Intronic
955450585 3:59063086-59063108 AAACTACGCTTCATAAATGAAGG - Intergenic
955618920 3:60840144-60840166 AAGTGGCCCATCAGAAATGAAGG + Intronic
956164816 3:66388751-66388773 AACCTATCCTTCAAAAATGAAGG + Intronic
956275651 3:67498055-67498077 AAGTGACATTTCAGAAATCAAGG + Intronic
956372434 3:68577975-68577997 AAGCTATCCACCAGAAATGAAGG - Intergenic
956698712 3:71940292-71940314 TAGTCCCCCTTCAGGAATGAGGG + Intergenic
956812579 3:72878532-72878554 AAATTATCCTTCAAAAGTGAAGG - Intergenic
956852445 3:73242188-73242210 AAACTACCCTTCAAAAATAAAGG + Intergenic
957066407 3:75526497-75526519 AAGCTATCCTTCACAAATGAAGG + Intergenic
957219099 3:77359518-77359540 TAGTGAGCCTTCAAAAATGAAGG + Intronic
957289877 3:78266415-78266437 AAATTATTCTTCATAAATGAAGG - Intergenic
957484662 3:80842988-80843010 AAATTATCCTTCAAACATGAAGG + Intergenic
957570633 3:81943728-81943750 AAGTTGCCCTTCAGAAATCAAGG - Intergenic
957787157 3:84897880-84897902 AAGCTATCCTTCAAAAATAAAGG - Intergenic
957814683 3:85280276-85280298 AAACTACCCTTCAACAATGAAGG - Intronic
957907444 3:86576553-86576575 AAAATACCCTTCAAATATGAAGG - Intergenic
957972651 3:87403054-87403076 AAATTAAACTTCAGAAGTGAAGG + Intergenic
957998193 3:87717797-87717819 AAGCTATCCTTCAAACATGAAGG + Intergenic
958545644 3:95546135-95546157 AAGTTACCTTTCAAATATGAAGG + Intergenic
958571726 3:95892957-95892979 AACTTGTCCTTCAAAAATGAAGG - Intergenic
958678406 3:97294840-97294862 AAGTTATCCTTCATAAATGAAGG - Intronic
958695335 3:97520452-97520474 AAGTTATCCTTCATAAATGAAGG - Intronic
958722229 3:97858120-97858142 AAGCTATCCCTCAGAAATGAAGG - Intronic
958760341 3:98298761-98298783 AAGATATCCTTCAAACATGAAGG + Intergenic
958789642 3:98636372-98636394 AAGGTATTCTTCATAAATGAAGG + Intergenic
958839687 3:99188488-99188510 AAAGTACCCTTCAAACATGAAGG + Intergenic
959045221 3:101466500-101466522 AACCTATCCTTCAAAAATGAAGG + Intronic
959218364 3:103482420-103482442 AAATTAACCTTCATAAGTGAAGG - Intergenic
959223184 3:103548760-103548782 GAGTTCCACATCAGAAATGATGG + Intergenic
959235835 3:103720409-103720431 AAGATCTTCTTCAGAAATGAAGG - Intergenic
959528971 3:107410075-107410097 AATCTGCCCTTCAGAAATGAGGG + Intergenic
959638694 3:108606169-108606191 AAATTACCCTTTAGAAAATAGGG - Intronic
959766377 3:110035060-110035082 AAGTTATCCTTGAAATATGAAGG - Intergenic
959865834 3:111268926-111268948 CAGTTACTCTGCAGAAATGAAGG + Intronic
960019659 3:112934381-112934403 AAACTATCCTTCAGAAATAAAGG + Intronic
960038625 3:113126966-113126988 AAGATACTCTTCAAAGATGATGG - Intergenic
960206834 3:114912174-114912196 AAGCTGTCCTTCAAAAATGAAGG + Intronic
960581854 3:119287385-119287407 AAGCTATCCTTTACAAATGAAGG - Intergenic
960675290 3:120188038-120188060 AATATATCTTTCAGAAATGAAGG + Intronic
960777386 3:121273249-121273271 AAATTGTTCTTCAGAAATGAAGG - Intronic
961083795 3:124049039-124049061 AAGTTATCCTTCAGAGAACAGGG - Intergenic
961286738 3:125811562-125811584 AAGATATCCTTCACAAATGAAGG - Intergenic
961493884 3:127276512-127276534 TGGTTACCCATCTGAAATGAGGG - Intergenic
961575110 3:127829195-127829217 AAAATATCCTTCAGGAATGAAGG - Intergenic
961963549 3:130878624-130878646 AAGCTAACTTTCAGAAATGAAGG - Intronic
962057917 3:131892333-131892355 ATGCTATTCTTCAGAAATGAAGG + Intronic
962262514 3:133922668-133922690 TAGTTACATTTTAGAAATGAAGG + Intergenic
962453728 3:135545815-135545837 AAATTATCCTTCAAAAGTGAAGG - Intergenic
962734104 3:138308998-138309020 AAGCTATCCTTCAAATATGAAGG + Intronic
962823354 3:139074659-139074681 AAGTTATTATTCATAAATGAAGG + Intronic
962899612 3:139748096-139748118 AAATTATCCTTCAAAAATAAAGG + Intergenic
962972055 3:140410457-140410479 AAGTTATTCTTCAGAAATTAAGG + Intronic
963387761 3:144618865-144618887 AAACTAGCCTTCATAAATGAAGG - Intergenic
963443891 3:145376483-145376505 AAAATACCCTTCAAACATGAAGG + Intergenic
963551312 3:146727371-146727393 AAGCTAAGCTTCACAAATGAAGG + Intergenic
963829898 3:149995129-149995151 AAGTTATCCTTCATAAGTGAAGG + Intronic
964075831 3:152690176-152690198 AAACTAACCTTCATAAATGATGG + Intergenic
964230584 3:154462280-154462302 AATTTATCCTCCAGAAATGTGGG - Intergenic
964247895 3:154674848-154674870 ATTATACCCTTCAAAAATGAAGG - Intergenic
964269737 3:154942103-154942125 AAATTATCCCTCAGAAATGAAGG + Intergenic
964393532 3:156221811-156221833 AAACTACGCTTCATAAATGAAGG + Intronic
964406291 3:156352362-156352384 AAGTTCACCTTCAGAGTTGATGG - Intronic
964415119 3:156439366-156439388 AACTTACCTTTCAGAATTGTTGG + Intronic
964521076 3:157568014-157568036 AAGGTGTCCTTCAGAAATGAAGG - Intronic
964548312 3:157859371-157859393 AATTTACCCATCAGAGAAGAAGG + Intergenic
964704081 3:159599954-159599976 AAATTATCCTTCATAAATGAAGG - Intronic
964901837 3:161669465-161669487 AAATTACCCTTCATAAAGGAAGG - Intergenic
964960210 3:162412983-162413005 AAATTACCTTTCAAAAGTGAAGG + Intergenic
965291170 3:166882952-166882974 AAATTAACTTTCATAAATGAAGG + Intergenic
965311879 3:167138612-167138634 AAGATAACTTTCAGAAAAGAGGG + Intergenic
965854196 3:173068010-173068032 AAATTATCCTTCAAACATGAAGG + Intronic
966075684 3:175934638-175934660 AAATTATCCTTCAAAAGTGAAGG + Intergenic
966100724 3:176266270-176266292 AAGCTAACCTTAAAAAATGAAGG - Intergenic
966284701 3:178280216-178280238 AAGTTATTCTTCAGAAATGAAGG + Intergenic
966346041 3:178981419-178981441 AAGTTATCCTTCATAAATGAAGG - Intergenic
966360574 3:179124925-179124947 AAGGTTTCCTTCACAAATGAAGG + Intergenic
966477310 3:180365148-180365170 AAGTTATCCTTCAGAAGCGAAGG - Intergenic
966674890 3:182574120-182574142 AATATACCTTTCAGAAATGAAGG + Intergenic
966706546 3:182922663-182922685 AAGGGACCCTTGAGGAATGACGG - Intergenic
966970099 3:185037213-185037235 AAGCTAGCTTTCAAAAATGAAGG - Intronic
967081059 3:186049949-186049971 AATTTTCCCTTCAAAAATGGAGG + Intronic
967551298 3:190798610-190798632 AAAATATCCTTCAGACATGAAGG + Intergenic
967779630 3:193421318-193421340 AAGCTGTCCTTCAGAAGTGAAGG + Intronic
967835006 3:193954870-193954892 AAACTATCCTTCAGGAATGAAGG - Intergenic
967944819 3:194795737-194795759 AAGTTATCCTTCATAAATGAAGG - Intergenic
968253137 3:197241304-197241326 AAATTACCCTTCACATATGAAGG + Intronic
968372239 3:198230987-198231009 AACTTATCCTTCAAAAATGAAGG - Intergenic
968390185 4:186229-186251 AAGTTAAGCTTCATAAGTGAAGG - Intergenic
968439444 4:615168-615190 AAATTATCCTTCAAAAGTGAAGG - Intergenic
968444774 4:646221-646243 AAATTATCCTTAAGAAGTGAAGG - Intronic
968709607 4:2103868-2103890 AATATAACCTTCATAAATGAAGG + Intronic
968793152 4:2683073-2683095 AAATTATCCTTCAAAAGTGAAGG - Intronic
969011011 4:4062554-4062576 AAGCTATCCTTCACAAATGAAGG + Intergenic
969231085 4:5831781-5831803 ATGTTACCTTTAAGAAATGAAGG - Intronic
969275411 4:6131855-6131877 AAATTATCCTTCAAAAATGAAGG + Intronic
969743055 4:9047342-9047364 AAGCTATCCTTCACAAATGAAGG - Intergenic
969802437 4:9579422-9579444 AAGCTATCCTTCACAAATGAAGG - Intergenic
970283125 4:14480021-14480043 AAGCTAAGCTTCATAAATGAAGG + Intergenic
970379058 4:15488296-15488318 AAGTTATCCTTTAAACATGAAGG - Intronic
971597840 4:28554399-28554421 AGATTTCCCTTCAGAAATGAAGG - Intergenic
971703546 4:30011263-30011285 AAGTTATCCTTCATAAATGAAGG - Intergenic
971726885 4:30326138-30326160 AAATTAAGCTTCACAAATGAAGG - Intergenic
972122031 4:35715016-35715038 AAATTATCCTTCATAAATGAAGG + Intergenic
972128042 4:35794024-35794046 AGGCTACCCTACAGAAATAAAGG + Intergenic
972185899 4:36527987-36528009 AAATTATTCTTCAAAAATGAAGG - Intergenic
972251490 4:37307367-37307389 AACTTATCCTTCAGAAATCAAGG - Intronic
972449088 4:39179056-39179078 AAATTATCCTTCACAAGTGAAGG - Intergenic
972723955 4:41729435-41729457 AAGTTACGCTGTAGAAATTATGG - Intergenic
972902784 4:43705312-43705334 AAGCTGTCTTTCAGAAATGAAGG + Intergenic
972936020 4:44136856-44136878 AAATTATCCTTCAAAAGTGAAGG - Intergenic
973079265 4:45969888-45969910 AAACTATCTTTCAGAAATGAAGG + Intergenic
973571019 4:52239781-52239803 AAATTCCCCTTAAAAAATGAAGG + Intergenic
973579618 4:52330059-52330081 AAGCTGTCATTCAGAAATGAAGG - Intergenic
973678356 4:53288653-53288675 AAGCTTTCCTTCAGGAATGAAGG + Intronic
973799464 4:54461978-54462000 AAATTAACCTTCATAAGTGAAGG + Intergenic
974127298 4:57711640-57711662 AAATTAAGCTTCATAAATGAAGG + Intergenic
974196595 4:58583857-58583879 AAACTAACCTTCATAAATGAAGG - Intergenic
974371803 4:61026526-61026548 AAATTACCTTTCAAAAATGAAGG - Intergenic
974589813 4:63930890-63930912 AAGTTATCCTTCGTGAATGAAGG - Intergenic
974854422 4:67442345-67442367 AAATTATCCTTCAAAAATAAAGG + Intergenic
975203438 4:71617698-71617720 AAGTTAAGCTTCATAAGTGAAGG + Intergenic
975261371 4:72303445-72303467 AAGATATCCTTCAAAAATGAGGG + Intronic
975773122 4:77751790-77751812 AAACTATCCTTCAGAAATCAAGG + Intronic
975833535 4:78396470-78396492 AAGCTGTCATTCAGAAATGAAGG - Intronic
976020933 4:80624888-80624910 AAACTATTCTTCAGAAATGAAGG + Intronic
976040835 4:80882818-80882840 AAGCTATCCTTCAGAAATGAAGG + Intronic
976073390 4:81269128-81269150 AAGCTATCCTTCACAAATGAGGG - Intergenic
976574389 4:86652497-86652519 AAATTATCCTTCAAACATGAAGG - Intronic
976631639 4:87243682-87243704 AAGCTAACCTTTAAAAATGAAGG + Intergenic
976664872 4:87579672-87579694 AATTCACTCTTCAGAAATGTTGG - Intergenic
976888744 4:90017949-90017971 AAATTATCCTTTAGAAGTGAAGG + Intergenic
976963702 4:91010134-91010156 AAGCTATCCTTAAGAAATGAAGG - Intronic
977010833 4:91630490-91630512 AAGTTATACTTAAGTAATGAAGG + Intergenic
977219861 4:94325927-94325949 AAGCTATCCTTCAAAAATGAAGG - Intronic
977359286 4:95982352-95982374 AGGTTCCCCTTCAGAAATTGAGG - Intergenic
977398048 4:96496085-96496107 AAACTACCCTTCAGAAATGAAGG + Intergenic
977418148 4:96762274-96762296 AACTTATCCTTCAAAAATGAAGG - Intergenic
977459102 4:97301724-97301746 AAGCTGTCCTTCAGAAATGAAGG + Intronic
977481734 4:97586723-97586745 AAATTATCCTTCAGGAATCAAGG + Intronic
977520300 4:98074185-98074207 GAGATATCATTCAGAAATGAAGG - Intronic
977830184 4:101581443-101581465 AAGTTATCCTTCAGAAATAAAGG - Intronic
977841817 4:101715982-101716004 AAGCTATCTTTCAAAAATGAAGG + Intronic
977926641 4:102707332-102707354 AATTTATCCTTCATAAATAAAGG + Intronic
978081974 4:104604737-104604759 AAAATGTCCTTCAGAAATGAAGG - Intergenic
978117773 4:105042664-105042686 AAGCTGTCCTTCAGAAATGAAGG + Intergenic
978130042 4:105185182-105185204 AAGTTTTCGTTCAAAAATGAAGG - Intronic
978201813 4:106031386-106031408 AAACTACACTTCATAAATGAAGG - Intergenic
978538836 4:109793909-109793931 AAACTATCCTTCACAAATGAAGG - Intronic
978666195 4:111184745-111184767 AAATTATCCTTCAAAAGTGAAGG - Intergenic
978762002 4:112362981-112363003 AAATTAAGCTTCATAAATGAAGG + Intronic
978888312 4:113792388-113792410 AAGTTATCCTTTAAATATGAAGG + Intergenic
978916291 4:114129250-114129272 AAATTAGGCTTCATAAATGAAGG + Intergenic
978930811 4:114309466-114309488 AAACTATCCTTCATAAATGAAGG + Intergenic
978950759 4:114556222-114556244 AAGTTACTCCCCAGAAAAGATGG - Intergenic
979365906 4:119822962-119822984 AAGCTGTTCTTCAGAAATGAAGG + Intergenic
979500858 4:121438300-121438322 AATTTATCCTTCATAAATGATGG - Intergenic
979644403 4:123051684-123051706 AAACTATCCTTCAGAAATAAAGG - Intronic
979964167 4:127057274-127057296 CAGCTATCCTTCAGAAAGGAAGG + Intergenic
980117854 4:128696909-128696931 AACTTACCCATCAGAAAATAAGG + Intergenic
980144623 4:128966745-128966767 AAGTTATACTTCAAAAATGAAGG - Intronic
980152358 4:129062631-129062653 AGACTACCCTTCAGAAATGTAGG - Intronic
980202255 4:129670793-129670815 CAGATCCCCTTCAGAAATGAAGG - Intergenic
980303284 4:131022452-131022474 AAATTAACTTACAGAAATGAAGG - Intergenic
980533878 4:134089906-134089928 AACATACCCTTCATAAATAAGGG + Intergenic
980693217 4:136322232-136322254 AAAATATCCTTCAGACATGAAGG + Intergenic
981093700 4:140757501-140757523 AAGTTCCTCTTCCCAAATGATGG + Intergenic
981154760 4:141421830-141421852 AAAATACCCTTCAGACATGAAGG - Intergenic
981169650 4:141606159-141606181 AAGTTACCCTTCATGCTTGATGG - Intergenic
981178148 4:141706659-141706681 AAGCTATCCTTCAAAAATGAAGG - Intronic
981285787 4:143017879-143017901 AAGCTATCTTTCAGAACTGAGGG - Intergenic
981421214 4:144552194-144552216 AAGTAAACCTTTAGAAATAAAGG + Intergenic
981430288 4:144649643-144649665 AAGTTAAGTTTTAGAAATGAGGG - Intronic
981884942 4:149663530-149663552 AAGGTTTCCTTCAGAAATAAAGG - Intergenic
982170634 4:152657879-152657901 AAGTTATCCTTCAAAAACAAAGG + Intronic
982405878 4:155020021-155020043 AAATTAAGCTTCATAAATGAAGG - Intergenic
982545917 4:156732977-156732999 AAAATATCCTTCAGAAGTGAAGG + Intergenic
982772218 4:159407125-159407147 ACTATACCCTTCTGAAATGAAGG + Intergenic
982796258 4:159648665-159648687 AAGCAATCATTCAGAAATGAAGG - Intergenic
982837115 4:160132691-160132713 AAGCTATCCTTTTGAAATGAAGG + Intergenic
983022635 4:162698362-162698384 AAGCTATCATTCAGAAATGAAGG - Intergenic
983102842 4:163646290-163646312 AAGCTCTCCTTCAGAAATGAAGG + Intronic
983277616 4:165637141-165637163 AAACTAACCTTCATAAATGAAGG + Intergenic
983455640 4:167959886-167959908 AAGCTATCCTTCAAATATGAAGG + Intergenic
983488797 4:168363207-168363229 AAGCTATCCTTCAGAAATGAAGG + Intronic
983493331 4:168414131-168414153 AAAATATCCTTCAGACATGAAGG + Intronic
983588128 4:169377640-169377662 AAGCTATTCTTCAGAAATGAGGG + Intergenic
983593888 4:169443949-169443971 AAGCTATCCTTCAAAAATGAAGG + Intronic
983655735 4:170081914-170081936 AAATTATCCTTCAAATATGATGG + Intronic
983666177 4:170187131-170187153 AAGTTGCCCTTCAGAATTGAAGG - Intergenic
983762786 4:171433352-171433374 AACATACACTTCAGAAATGAAGG + Intergenic
983894689 4:173069495-173069517 AAGTTATCCCTCAGAAATGAAGG - Intergenic
983894728 4:173070226-173070248 AACTGACCCTTAAGAAATGGAGG - Intergenic
984209412 4:176827100-176827122 AAATTACCCTTCAAAAATAAAGG + Intergenic
985076954 4:186225209-186225231 AAGCTGTCCTTCAGAAAGGAAGG - Intronic
985090362 4:186356538-186356560 AAGTTTCACTTCAAATATGAAGG + Intergenic
985229689 4:187801122-187801144 AAAATATCCTTCAGACATGAAGG + Intergenic
985562337 5:594956-594978 AGAATACCCTTCAGAAATGAAGG + Intergenic
986162035 5:5238958-5238980 GTGTTACCCTTCAAAAATGTAGG - Intronic
986277341 5:6288436-6288458 AAATTATCCTTCAAAAATGAAGG + Intergenic
986465591 5:8019304-8019326 ACGTTTTTCTTCAGAAATGAGGG + Intergenic
986552378 5:8972846-8972868 AAGTTATCCTTCAAAAATGAAGG - Intergenic
986553785 5:8989459-8989481 AAGCTATCCTTCAGAAATATAGG - Intergenic
986873944 5:12082966-12082988 AAGTTACATTTCTTAAATGAAGG + Intergenic
987091940 5:14515938-14515960 AATATATCCTTCAAAAATGAAGG - Intronic
987265593 5:16250901-16250923 AAACTATCCTTCAGAAATGAAGG + Intergenic
987272719 5:16328810-16328832 AAATTATCCTTCAAAAGTGAAGG + Intergenic
987436739 5:17904458-17904480 AAATTAAGCTTCAGAAATGAAGG - Intergenic
987713540 5:21535415-21535437 AAGATGTCCTTCTGAAATGAAGG + Intergenic
987718871 5:21609346-21609368 AAGTTACAAATGAGAAATGAGGG + Intergenic
988237371 5:28562516-28562538 AAGTTATCATTCATAGATGAAGG + Intergenic
988642174 5:33051784-33051806 AAGTTGTCCTCCAGAAATGAAGG + Intergenic
988828600 5:34966020-34966042 AAGCTATTCTTCAAAAATGAAGG - Intergenic
989018819 5:36974957-36974979 AAATTCTCCTTCAGACATGAAGG - Intronic
989081634 5:37629012-37629034 AAGCTATCCTTCAGAAATGAAGG - Intronic
989148637 5:38274603-38274625 AAGCTGTCCTTCAGAAATGAAGG + Intronic
989373964 5:40740384-40740406 AAAATATCTTTCAGAAATGAAGG - Intronic
989506673 5:42233756-42233778 AAATTATCCTTCAAAAGTGAAGG - Intergenic
989828244 5:45885478-45885500 AAATTAAGCTTCATAAATGAAGG - Intergenic
990053595 5:51541043-51541065 AAGTTATCCATCAGGAATAAAGG - Intergenic
990180747 5:53157578-53157600 AGATTCCCCTTCAGGAATGAAGG - Intergenic
990244038 5:53844891-53844913 AAACTATCCTTCAAAAATGAAGG + Intergenic
990260969 5:54022041-54022063 AAAATATCCTTCAGAAATGAAGG + Intronic
990396291 5:55383410-55383432 AAGTTACCTTTCAAAAATGAAGG - Intronic
990733973 5:58839860-58839882 AAGCCATCCTTTAGAAATGATGG - Intronic
990928833 5:61062955-61062977 AAGCTGTTCTTCAGAAATGAAGG + Intronic
991149991 5:63356501-63356523 AAATTAATCTTCAAAAATGAAGG - Intergenic
991161097 5:63504158-63504180 AAGTTAAGCTGCATAAATGAAGG - Intergenic
991224137 5:64249461-64249483 AAGCTGTCCTTCACAAATGAAGG + Intronic
991233666 5:64367115-64367137 AAGTTTTCCTTCAGAATTGAAGG + Intronic
991323220 5:65399993-65400015 AAATTATCCTTCAAAAGTGAAGG - Intronic
991331671 5:65499262-65499284 AAATTACCCCTTAGGAATGAGGG - Intergenic
991455594 5:66800157-66800179 AAGTTATCCTGCAGAAAACATGG - Intronic
991726570 5:69541509-69541531 GAATTACCCTTCATAAATCAAGG + Intronic
991868387 5:71086365-71086387 GAATTACCCTTCATAAATCAAGG - Intergenic
992092625 5:73331953-73331975 AAAATATCCTTCAGGAATGAAGG - Intergenic
992170432 5:74096333-74096355 AAGATACACTTCATAAGTGAAGG + Intergenic
992883708 5:81136380-81136402 AAGTTATGCTTCAAAAGTGAAGG - Intronic
992906640 5:81353090-81353112 AAGTTATCCCTCAGAAAAGAAGG - Intronic
993022454 5:82607453-82607475 AAGTTATCCTTCATAAACTAAGG + Intergenic
993414117 5:87604757-87604779 AAATTATCCTTCAAATATGAAGG - Intergenic
993544803 5:89198473-89198495 AAGCTGTCCTTCAGAAATGAAGG - Intergenic
993623528 5:90194920-90194942 AAGATACCCTTCAAACATGAAGG + Intergenic
993846571 5:92951902-92951924 AAGTTGCCATTCATAAATGAGGG - Intergenic
993933252 5:93968948-93968970 AAGTTATCCTTCAAAAGTGAGGG + Intronic
993937037 5:94017233-94017255 AAGCTATCCTTCAAATATGAAGG - Intronic
994062010 5:95488581-95488603 AAGTTATTCTTCATAAATGAAGG + Intronic
994229128 5:97293769-97293791 AAATTATCCTTCAAACATGAAGG - Intergenic
994307884 5:98228585-98228607 AAGTTATATCTCAGAAATGAAGG + Intergenic
994381471 5:99076886-99076908 AAATTATCCTTCAAAAGTGAAGG - Intergenic
994427437 5:99608606-99608628 AAGATACCTTTCAAAACTGAAGG + Intergenic
994505992 5:100643440-100643462 AAGTTTCCCATAAGAAATCAAGG - Intergenic
994629665 5:102268893-102268915 AAGCTATTCTTCAGAAATAAAGG - Intronic
994640682 5:102405579-102405601 AAAATATCCTTCAGGAATGAAGG + Intronic
994792851 5:104253396-104253418 AAGTTATCCTTCAAATATGAAGG - Intergenic
994879929 5:105477132-105477154 AAGTTGTCCTTCAGCGATGAAGG + Intergenic
994893371 5:105668696-105668718 AAATTATCCTTCAAACATGAAGG - Intergenic
995053399 5:107731916-107731938 TAGTTTCCCTTTACAAATGAAGG - Intergenic
995143614 5:108761861-108761883 AAGTTACACTTCTAAAATGTGGG - Intronic
995278878 5:110309957-110309979 AAGTTATCCTTCAAATATGAAGG + Intronic
995315410 5:110765798-110765820 AAACTACCCTTCAAGAATGAAGG + Intergenic
995614530 5:113946191-113946213 AAGCTGTCCATCAGAAATGAAGG + Intergenic
995626803 5:114088113-114088135 AAAATATCCTTCAAAAATGAAGG - Intergenic
996066829 5:119089106-119089128 AAGTTATCCTTCTAATATGAAGG - Intronic
996103298 5:119468352-119468374 AAGCTATCCTTCAGAAATAAAGG - Intronic
996433470 5:123406629-123406651 AAATTATCCTTCAAAAGTGAAGG + Intronic
996433535 5:123408068-123408090 AAATTATCCTTCAAAAGTGAAGG - Intronic
996458465 5:123712570-123712592 AAATTATCCTTCAAAAATAAAGG - Intergenic
996608854 5:125356039-125356061 AAATTACACTTCACAAATGAAGG - Intergenic
996642141 5:125769103-125769125 AAGCTACCCTTCAGAAAAAAAGG - Intergenic
996683992 5:126259471-126259493 AAGCTATCCTTCAAAATTGAAGG + Intergenic
996696356 5:126400690-126400712 AAGCTGTCCTTCAGAAATAAAGG - Intronic
996931464 5:128894503-128894525 AAGATATCCTTCAAACATGAAGG - Intronic
996994176 5:129674986-129675008 AAAATATCCTTCAGAGATGAAGG - Intronic
997085980 5:130799244-130799266 AAGCTGTCCTTGAGAAATGAAGG + Intergenic
997415059 5:133721517-133721539 AAGCTGTCCTTCAGAAATGAAGG - Intergenic
997496215 5:134328900-134328922 AAGATATCTTTCAAAAATGAAGG + Intronic
997576583 5:134982598-134982620 AAATTATCCTTCAAAAATGAAGG + Intronic
997664487 5:135618735-135618757 AAATTTTCCTTCATAAATGAAGG - Intergenic
997671435 5:135677760-135677782 CAATTATCCTTCACAAATGAAGG - Intergenic
997891432 5:137680459-137680481 AAGAAACTCTTTAGAAATGAAGG + Intronic
998210046 5:140188991-140189013 AAGGGAACCTTCAGGAATGATGG - Intronic
998255002 5:140578486-140578508 AAACTATCCTTCAAAAATGAAGG + Intronic
998288941 5:140893602-140893624 GAGCTATACTTCAGAAATGAAGG - Intronic
998688949 5:144565368-144565390 AAGCTATCTTTCAGAAATGAAGG - Intergenic
998907812 5:146925380-146925402 AAACTATCCTTCAAAAATGAGGG - Intronic
999024908 5:148217786-148217808 GAGCTATTCTTCAGAAATGAAGG + Intergenic
999475153 5:151891520-151891542 TAGTTGCCCTGCAGAAATGTAGG - Intronic
999549061 5:152664020-152664042 AAGATGTCCTTCAAAAATGAAGG + Intergenic
999660301 5:153855310-153855332 AAGCTATCCTTCAAATATGAAGG - Intergenic
1000262999 5:159607338-159607360 AAAATGCCCTTCAAAAATGAAGG - Intergenic
1000545233 5:162592007-162592029 AAAGTATCCTTCATAAATGATGG + Intergenic
1000739832 5:164954722-164954744 AAATGATCCTTCAGAGATGAAGG + Intergenic
1000834535 5:166137316-166137338 AAGCTATCCTTAAGAAATGAAGG + Intergenic
1001499344 5:172217104-172217126 AAATTATCCTTCAAAACTGAAGG + Intronic
1001758454 5:174188415-174188437 AAGTTACCATTTACAGATGAGGG + Intronic
1001964650 5:175901748-175901770 AGGTTCCCCTTCAGAAATAAAGG + Intergenic
1002009624 5:176267345-176267367 AAATTATCCTTCAAAAATAAGGG + Intronic
1002084596 5:176765344-176765366 AAGTTATCCTTCAGAAGTGAAGG - Intergenic
1002217097 5:177644944-177644966 AAATTATCCTTCAAAAATAAGGG - Intergenic
1002412555 5:179094635-179094657 AAGCTATCTTTCAGAAATGAAGG - Intergenic
1002551857 5:180000143-180000165 AAGCCATCCTTCAGAAATGGGGG - Intronic
1002677023 5:180925552-180925574 AATCTGTCCTTCAGAAATGAGGG + Intronic
1002687192 5:181022382-181022404 AAGTTGTCCTTTAGAAATGAGGG + Intergenic
1002687201 5:181022508-181022530 AAGTTGTCCTTTAGAAATGAGGG - Intergenic
1002731480 5:181336531-181336553 AACTTATCCTTCAAAAATGAAGG - Intergenic
1002753060 6:137558-137580 AACTTATCCTTCAAAAATGAGGG + Intergenic
1002982745 6:2157857-2157879 ATTTTACCCTTGAGGAATGAAGG - Intronic
1003156536 6:3601696-3601718 AAGTTATCCTTCATAAATGAAGG - Intergenic
1003237616 6:4310884-4310906 AAACTATCCTTCAAAAATGAAGG + Intergenic
1003622837 6:7717048-7717070 AAGCTATCCTTCAAGAATGAAGG + Intergenic
1003689902 6:8343340-8343362 AACTTACCGTCCAGAAAGGAGGG - Intergenic
1003775410 6:9355497-9355519 AAGTTATCCTTCAAATACGAAGG + Intergenic
1004053520 6:12112141-12112163 AATTTAGCTTTCAAAAATGAAGG - Intronic
1004159953 6:13204482-13204504 AGGTTCCCCTCCAGAAATGTGGG + Intronic
1004811722 6:19270289-19270311 AAGCTAACCTTAGGAAATGAAGG + Intergenic
1005183472 6:23135661-23135683 AAATTATCCATCAAAAATGAAGG - Intergenic
1005680602 6:28203884-28203906 AAATTATCCTTCAAAAGTGAAGG + Intergenic
1005853565 6:29842092-29842114 AAACTCTCCTTCAGAAATGATGG - Intergenic
1005985473 6:30871298-30871320 AAAATACCCTTCATGAATGAAGG - Intergenic
1006724050 6:36183430-36183452 AAGCTATCCTTCACAAATCAAGG + Intergenic
1006757498 6:36429292-36429314 TAATTACCCTTAAGAAATGTTGG + Intronic
1006969785 6:38030681-38030703 AAAATACCCTGCAGAAATAAAGG + Intronic
1007815387 6:44520977-44520999 AAATTATCCTTCATAAATGAAGG - Intergenic
1008020503 6:46572407-46572429 AAGCTGTCCTTCAAAAATGAAGG - Intronic
1008671738 6:53775909-53775931 AAGCTAAGCTTCATAAATGAAGG + Intergenic
1008715635 6:54286031-54286053 AAGTGACCCTTTAGAACTGATGG - Intergenic
1008751887 6:54744879-54744901 AAGCTATTCTTTAGAAATGAAGG - Intergenic
1008882040 6:56389831-56389853 AAATTATCCTTCAAACATGAAGG + Intronic
1008997631 6:57677061-57677083 AAGCTATCCTTCAGAAATGAAGG + Intergenic
1009003179 6:57746482-57746504 AAGATGTCCTTCTGAAATGAAGG - Intergenic
1009043024 6:58204213-58204235 AAATTATCCTTCATAAGTGAAGG - Intergenic
1009186128 6:60576409-60576431 AAGCTGTCCTTCAGAAATGAAGG + Intergenic
1009218859 6:60958465-60958487 AAATTATCCTTCATAAGTGAAGG - Intergenic
1009354597 6:62727031-62727053 AAGTTATTCTTCATAAATGAAGG - Intergenic
1009462959 6:63935975-63935997 AATTTACCATTCAGAAGTGAAGG - Intronic
1009504475 6:64458409-64458431 AAGCCATCCTTCAGAAATAAAGG - Intronic
1009616012 6:66008493-66008515 AAATTATCCTTCATAAAGGAGGG - Intergenic
1009663426 6:66645550-66645572 AAGCTGTCTTTCAGAAATGAAGG - Intergenic
1009688074 6:66989353-66989375 AAGCTGTCCTTCAGAAAGGAGGG - Intergenic
1009800088 6:68526378-68526400 AAGCTAAGCTTCATAAATGAAGG - Intergenic
1009993485 6:70873295-70873317 AAACTATCCTTCAAAAATGAAGG - Intronic
1010017241 6:71119705-71119727 AAACTAAGCTTCAGAAATGAAGG - Intergenic
1010306802 6:74333677-74333699 AAATTATCCTTCACAAATGAAGG - Intergenic
1010514427 6:76755431-76755453 AAAATACCCTTCAAACATGAAGG + Intergenic
1010625108 6:78129489-78129511 AAACAATCCTTCAGAAATGAAGG + Intergenic
1010856383 6:80845691-80845713 AAACTGTCCTTCAGAAATGAAGG + Intergenic
1011056176 6:83205785-83205807 AAAATATCCTTCAGAAATTAAGG - Intergenic
1011096409 6:83669986-83670008 AAATTACCCAAGAGAAATGAAGG - Intronic
1011271300 6:85582260-85582282 AAAATACCCTTCAAACATGAAGG + Intronic
1011296240 6:85829269-85829291 CAGTTATCCTTCATAAAAGAAGG + Intergenic
1011318893 6:86068114-86068136 AAGCTATCTTTCAGAAATGAGGG - Intergenic
1011324491 6:86134653-86134675 AAGCTATCCTTTGGAAATGAAGG + Intergenic
1011340692 6:86309808-86309830 AAGCTATTCTACAGAAATGAAGG + Intergenic
1011369817 6:86623990-86624012 AAATTACCATTCAATAATGAGGG - Intergenic
1011372699 6:86655053-86655075 AAAATACCCTTCAGGAATGAAGG + Intergenic
1011500518 6:87983343-87983365 AAGCTATCCTTCAGAAATGATGG + Intergenic
1011508148 6:88070782-88070804 AAATTATCCTTCAAATATGAAGG - Intergenic
1011522986 6:88230149-88230171 AAGCTGTCCTTCAGAAATGAAGG + Intergenic
1011528310 6:88291045-88291067 AAAATATCCTTCAGAGATGAAGG + Intergenic
1011564478 6:88660048-88660070 AAATTAAGCTTCATAAATGAAGG + Intronic
1011696209 6:89915854-89915876 AAGATATTCTTCATAAATGAAGG - Intergenic
1011707488 6:90016755-90016777 AAGATAACTTTCAAAAATGAAGG - Intronic
1012025704 6:93987472-93987494 AAGCAATCCTTCAGAAATGAAGG + Intergenic
1012033917 6:94107635-94107657 AAGTAGCCCTTGAGAAATGTGGG + Intergenic
1012491709 6:99789364-99789386 GTGGCACCCTTCAGAAATGATGG + Intergenic
1012504805 6:99932101-99932123 AAAATACCCTTCAAACATGAAGG - Intronic
1012615303 6:101270308-101270330 AAGCTATCCTTTAAAAATGAAGG + Intergenic
1012782131 6:103574955-103574977 ATTTCTCCCTTCAGAAATGAAGG - Intergenic
1012823979 6:104124578-104124600 AAAATATCCTTCAGACATGAAGG - Intergenic
1013184101 6:107742698-107742720 CAGTTATCCTTCAAATATGAAGG + Intronic
1013340672 6:109212377-109212399 AAGTTAACCTTCAGAAATGAAGG - Intergenic
1013564427 6:111342931-111342953 AAATTATCCTTCAAAAATAAGGG + Intronic
1013672795 6:112423260-112423282 AAATTAAGCTTCAGAAGTGAAGG + Intergenic
1013702716 6:112793541-112793563 AATATATCCTTCAAAAATGAGGG - Intergenic
1013725333 6:113088596-113088618 AAAATTTCCTTCAGAAATGAAGG + Intergenic
1013763406 6:113545488-113545510 AAGATATTCTTCAGAAATGAGGG + Intergenic
1013914002 6:115312269-115312291 AATTTATCTTTCAGAAATGAAGG - Intergenic
1014060098 6:117062032-117062054 AAATTATCCTTCATAAATGAAGG - Intergenic
1014122551 6:117741709-117741731 AAGCTATTCTTCATAAATGAAGG + Intergenic
1014173489 6:118305914-118305936 ACTTGACCCTTCAGAAATGAAGG - Intronic
1014320440 6:119922441-119922463 AAGCTATTCTTCAGAAATGAAGG - Intergenic
1014339462 6:120186083-120186105 AAGCTTTCCTTCAGAAGTGAAGG - Intergenic
1014411237 6:121124265-121124287 AAGCTATCCTTAAGAAATGAAGG - Intronic
1014481419 6:121942662-121942684 AAACTATCCTTCAAAAATGAAGG - Intergenic
1014818748 6:125961921-125961943 CAGAATCCCTTCAGAAATGAGGG + Intronic
1014932495 6:127350657-127350679 AGGCTGTCCTTCAGAAATGAAGG + Intergenic
1015558506 6:134488257-134488279 TCTATACCCTTCAGAAATGAAGG + Intergenic
1016138806 6:140582608-140582630 AGGGTATCCTTCATAAATGAAGG + Intergenic
1016188471 6:141229028-141229050 AAATTATCCTTCAGGAATGAAGG - Intergenic
1016196242 6:141345752-141345774 AAATTATCCTTCAAAAATTATGG - Intergenic
1016342377 6:143077433-143077455 AAAATATCCTTCAGGAATGAAGG - Intronic
1016531491 6:145062798-145062820 AAGCTACCCTTCAGAAAGGAAGG + Intergenic
1016612155 6:146002195-146002217 AAAATACCCTTCAAACATGAAGG + Intergenic
1016660430 6:146571642-146571664 AAGCTATTCTTCAGAAATGGAGG + Intergenic
1016793494 6:148091605-148091627 AAGCTGTCCTTCAGAAATGAAGG + Intergenic
1017217811 6:151930770-151930792 AAATTATCCTTCAAAAGTGAAGG - Intronic
1017353280 6:153470716-153470738 AAATTATATTTCAGAAATGAAGG - Intergenic
1017624189 6:156331426-156331448 AAGATATCCTTCAAATATGAAGG - Intergenic
1017933984 6:158988110-158988132 AAGTTATCCCTCAAATATGAAGG - Intronic
1017974189 6:159340214-159340236 AAATTATCCTTCACAAATGAAGG + Intergenic
1018073968 6:160193020-160193042 AAGCTATTCTTCAGAAATGAAGG + Intronic
1018083885 6:160284645-160284667 AAAATACCTTTCAAAAATGAAGG - Intergenic
1018228350 6:161652409-161652431 AAATTATCATTCATAAATGAAGG + Intronic
1018598561 6:165512341-165512363 AAATTATCTTTCACAAATGAAGG - Intronic
1019027540 6:168981509-168981531 AAACTGACCTTCAGAAATGAAGG + Intergenic
1019035690 6:169056101-169056123 AAGCTACACTGCAGAAATAAAGG - Intergenic
1019036110 6:169060918-169060940 AAGATACTCTTTAAAAATGAAGG - Intergenic
1019084296 6:169459860-169459882 AAGTTGCCCTTCAAAAGTAAGGG + Intronic
1019108875 6:169693237-169693259 AAATTAAGCTTCACAAATGAAGG + Intronic
1019131247 6:169878009-169878031 AAGTTATCCTTCAGGTACGAAGG - Intergenic
1019141290 6:169945603-169945625 AAATTATCCTTCAAAAATGAAGG + Intergenic
1019815741 7:3198795-3198817 AAAACATCCTTCAGAAATGAAGG - Intergenic
1019819245 7:3228986-3229008 AAAATATCTTTCAGAAATGAAGG - Intergenic
1019865040 7:3700102-3700124 AAACTATCCTTCAGGAATGAAGG + Intronic
1020052973 7:5094928-5094950 AAATTATCCTTCAAAAATGAAGG + Intergenic
1020515207 7:9108903-9108925 AAATTATCCTTCAAACATGAAGG + Intergenic
1020542979 7:9484845-9484867 AAGCTACACTTTAGAAATGAAGG - Intergenic
1020761859 7:12277744-12277766 AAGTTATCCTTCCTAAATGAAGG - Intergenic
1020773502 7:12425380-12425402 AAAATACCTTTCAAAAATGATGG - Intergenic
1020781687 7:12524432-12524454 ATGTTACCTTTTAGAGATGAGGG + Intergenic
1020864872 7:13546580-13546602 AAGTAATCCTTCACACATGAAGG + Intergenic
1021060754 7:16107521-16107543 AAGCTATATTTCAGAAATGAAGG + Intronic
1021230427 7:18081063-18081085 AAGTTGTTCTTTAGAAATGAAGG - Intergenic
1021630814 7:22645488-22645510 AAGCTGACCTTCAGAAATGAAGG - Intergenic
1021765643 7:23945684-23945706 AAATTATCCTTCTCAAATGAAGG + Intergenic
1021802349 7:24319608-24319630 AAATTATCCTTCAAAAGTGAAGG + Intergenic
1021870373 7:25000493-25000515 AAACTAACCTTCATAAATGAAGG - Intergenic
1022365074 7:29705696-29705718 AACATACCTTTCAAAAATGAAGG - Intergenic
1022432734 7:30342474-30342496 AAGCTACGCTTCACAAATGAAGG - Intronic
1022617369 7:31945464-31945486 AAATTATCCTTCATAAATGAAGG - Intronic
1022661080 7:32367082-32367104 AAGCTATCCTTCAGAAATGAAGG + Intergenic
1022853569 7:34292594-34292616 AAATTATTCTTCAGACATGAAGG - Intergenic
1022870199 7:34470178-34470200 AAGTTATCTTTCATAAATGAAGG - Intergenic
1022985872 7:35652772-35652794 AAGTTATCCTTCATAAATGAAGG + Intronic
1023208762 7:37780637-37780659 AAAATACCCTACATAAATGAAGG - Intronic
1023232353 7:38048480-38048502 AAGTTATCCTTCACAAATGAAGG - Intergenic
1023468638 7:40488704-40488726 ATGTTATCCTTCAGAAATAAAGG - Intronic
1023573467 7:41597292-41597314 AAATTATCTTTCAAAAATGATGG + Intergenic
1023642645 7:42275880-42275902 AAGTACCATTTCAGAAATGATGG - Intergenic
1023722033 7:43105970-43105992 AAATTACACTTCAGATATGTTGG + Intergenic
1023887491 7:44369980-44370002 AAGCTACCCTTTAGAAATGAGGG + Intergenic
1024015400 7:45309814-45309836 GAGTTATCTTTCATAAATGAAGG - Intergenic
1024021677 7:45376841-45376863 AAACTATCATTCAGAAATGAAGG + Intergenic
1024076625 7:45823716-45823738 AACTTATCCTTCAAAAATGAGGG - Intergenic
1024126197 7:46297976-46297998 AAATTATTCTTCAGGAATGAAGG + Intergenic
1024453048 7:49570924-49570946 AAGCTGTCCTTCAAAAATGAAGG + Intergenic
1024703890 7:51936966-51936988 AAGTTGTCCTTGAGAAATGAAGG - Intergenic
1024713169 7:52041146-52041168 AAAATAGCCTTCAGAAATGAAGG + Intergenic
1024811231 7:53214791-53214813 AAGCTGTCCTTCAAAAATGAAGG + Intergenic
1025040467 7:55639778-55639800 AAGCTATCCTTCAAACATGAAGG - Intergenic
1025127794 7:56357709-56357731 AACTTATCCTTCAAAAATGAGGG + Intergenic
1026074541 7:67154441-67154463 AAACTATCCTTCAGAAATGAAGG - Intronic
1026271843 7:68843622-68843644 AAAAAACCCTGCAGAAATGATGG + Intergenic
1026702326 7:72657735-72657757 AAACTATCCTTCAGAAATGAAGG + Intronic
1026885487 7:73940514-73940536 AAATTATCCTTCAGAAATGAAGG - Intergenic
1027350650 7:77307736-77307758 AAGCTATCCTTCAGAAATGAAGG - Intronic
1027378627 7:77580013-77580035 AATTTACCCTACAGCAATGCTGG + Intronic
1027402182 7:77821076-77821098 AAGCTATCTTTCAGAAATGAAGG - Intronic
1027808457 7:82860459-82860481 AAAATACCCTTCAAACATGAAGG + Intronic
1028197966 7:87928649-87928671 AAGTAAGGCTTCATAAATGAAGG + Intergenic
1028398160 7:90395140-90395162 AAGTAATCCTTCAAATATGAAGG + Intronic
1028519108 7:91709332-91709354 AAGTAATCCTTCATAAGTGAAGG + Intronic
1028626444 7:92882430-92882452 AAGCTATCCTTCATAAATGAAGG + Intergenic
1028877453 7:95839807-95839829 AACCTGTCCTTCAGAAATGAAGG - Intronic
1029103615 7:98155683-98155705 AAAATATCCTTCAGGAATGAAGG + Intronic
1029107275 7:98188600-98188622 AAGATATCCTTCGGAAATGAAGG - Intronic
1029171539 7:98632912-98632934 AAGCTATCCTTCAAAAATGAAGG + Intergenic
1029340336 7:99938374-99938396 AAAGTATCCTTCAAAAATGAAGG - Intergenic
1029921101 7:104265052-104265074 AAATTATCCTTCAAAAGTGAAGG - Intergenic
1030180478 7:106703264-106703286 AAATTATCCTTCAAAAGTGAAGG - Intergenic
1030183476 7:106735689-106735711 AAACTGTCCTTCAGAAATGAGGG - Intergenic
1030421169 7:109308352-109308374 AAGTAAATCATCAGAAATGAAGG + Intergenic
1030450069 7:109697784-109697806 AATTTATCCTTTAGAAATGAAGG + Intergenic
1030608027 7:111659407-111659429 AAGTTCACCTTCAGCAATTATGG + Intergenic
1030701963 7:112649841-112649863 AAGTTGTCCTTGAGAAATGAAGG + Intergenic
1030709587 7:112734545-112734567 AAGCTACACTTTAGAAATGAAGG - Intergenic
1030755915 7:113287725-113287747 AAATTATCCTTCAAAAGTGAAGG + Intergenic
1031425681 7:121602754-121602776 ACGTGACCTTTCTGAAATGATGG - Intergenic
1031472596 7:122184229-122184251 AAAATATCCTTCAAAAATGAAGG + Intergenic
1031568804 7:123332125-123332147 AATTCACCCTTCATAAATGAAGG + Intergenic
1031683748 7:124707510-124707532 AAATTATCCTTCATACATGAAGG - Intergenic
1031847156 7:126819910-126819932 AATATAACCTTCAGCAATGATGG + Intronic
1032007602 7:128315750-128315772 AACTTATCCTTCAAAAGTGAAGG + Intronic
1032931098 7:136672032-136672054 AAGCTATCCTTCACAACTGAAGG - Intergenic
1032962744 7:137057713-137057735 AAAGTACCCTTCAAAAATAAAGG + Intergenic
1033142140 7:138837239-138837261 AAGTTCCATTTCAGACATGAAGG + Intronic
1033289140 7:140067301-140067323 AAACTATCTTTCAGAAATGAAGG + Intergenic
1033412761 7:141134346-141134368 AAGTTAGCTTTCAAAAATTAAGG + Intronic
1033638452 7:143236478-143236500 AAGCTATCCTTCACTAATGAAGG - Intergenic
1033677242 7:143555028-143555050 AAATTATCCTTCATAAATGAAGG - Intergenic
1033694593 7:143774407-143774429 AAATTATCCTTCATAAATGAAGG + Intergenic
1033728591 7:144148542-144148564 AAGCTGTCCTTCAGAAATGAAGG + Intergenic
1033879828 7:145867546-145867568 AAGTTATTCATCAAAAATGAAGG - Intergenic
1034026093 7:147706369-147706391 AAGTTGTCATTCATAAATGAAGG - Intronic
1034381562 7:150699617-150699639 AAATTACCTTTCAAAAATGAAGG + Intergenic
1034596902 7:152205105-152205127 CAGTTACCTTGCAGAGATGATGG - Exonic
1034608656 7:152343808-152343830 AAATTATCCTTCAAAAGTGAAGG + Intronic
1034871119 7:154684689-154684711 TAGTTACCCTTCAGATAAAAAGG + Intronic
1035347715 7:158215781-158215803 AAGTTATCCTTCAGGAATCAGGG + Intronic
1035357803 7:158288913-158288935 AAGCTGTTCTTCAGAAATGAAGG - Intronic
1035490860 7:159276833-159276855 AAATTGTCCCTCAGAAATGAGGG - Intergenic
1035512033 8:197746-197768 AACTTATCCTTCAAAAATGAAGG + Intronic
1035903289 8:3480794-3480816 AATCTATCCTTCAGAAATAAAGG + Intronic
1036061815 8:5331159-5331181 ATGCTTTCCTTCAGAAATGAAGG - Intergenic
1036252546 8:7175219-7175241 AAGCTATCCTTCACAAATGAAGG + Intergenic
1036364952 8:8112243-8112265 AAGCTATCCTTCACAAATGAAGG - Intergenic
1036885984 8:12553851-12553873 AAGCTATCCTTCACAAATGAAGG + Intergenic
1036893596 8:12612933-12612955 AAGCTATCCTTCGCAAATGAAGG + Intergenic
1036998899 8:13694093-13694115 AAGCTGTCCTTCAGAAATTAAGG - Intergenic
1037160923 8:15771149-15771171 AAGTTATCCTTTTAAAATGAAGG + Intergenic
1037168792 8:15864590-15864612 AAGCTATTCTTCAGAAAGGAAGG + Intergenic
1037282676 8:17260692-17260714 AAGTTATCTTTCAAATATGAAGG - Intronic
1037439564 8:18901768-18901790 AAGCTATCCTTTAGAGATGAGGG - Intronic
1038129780 8:24717230-24717252 AAATTATTCTTCAGCAATGAAGG + Intergenic
1038221564 8:25613597-25613619 AAATTAACCTTCATAAGTGAAGG - Intergenic
1038225406 8:25652550-25652572 AAGTTATGCTTCATAAATGATGG - Intergenic
1038632362 8:29258169-29258191 AGGTGACCCTTAGGAAATGAAGG - Intronic
1038784149 8:30595524-30595546 AAATAATCTTTCAGAAATGAAGG - Intronic
1038879122 8:31588143-31588165 TAGATACCCCTCAGGAATGAAGG + Intergenic
1039029983 8:33298771-33298793 AAAATATCCTTCAAAAATGAGGG + Intergenic
1039267659 8:35843227-35843249 AGATTGTCCTTCAGAAATGAAGG + Intergenic
1039402435 8:37281129-37281151 AAGCTAACCTTCATAAGTGAAGG + Intergenic
1039635175 8:39157030-39157052 AAACTATCCTTCAAAAATGAAGG - Intronic
1039646366 8:39288652-39288674 AAGCTTTTCTTCAGAAATGAAGG - Intergenic
1039760280 8:40567183-40567205 AAGTTCGCTTTCAGAAATGTTGG - Intronic
1040063666 8:43126589-43126611 AAGCTATCCTTCAAAATTGAAGG - Intergenic
1040362575 8:46681652-46681674 AAATTAAGCTTCATAAATGAAGG - Intergenic
1040626512 8:49155888-49155910 AAACTAAGCTTCAGAAATGAAGG + Intergenic
1040643649 8:49371620-49371642 AAAATATCCTTCAGGAATGAAGG - Intergenic
1040655102 8:49498880-49498902 AAAATATCCTTCAGGAATGATGG - Intergenic
1040839200 8:51766573-51766595 AAGTTATCCTCCAAAAGTGAAGG - Intronic
1040868316 8:52073145-52073167 AAGTTATTCTATAGAAATGAAGG - Intergenic
1041079177 8:54200124-54200146 AAACTATCCTTCAGAAAGGAAGG - Intergenic
1041212096 8:55562503-55562525 AAATCATCCTTCAAAAATGAAGG - Intergenic
1041410471 8:57548304-57548326 AAGTTATCCTTCATAAAAGTGGG + Intergenic
1041606739 8:59790847-59790869 AAGCCATCCTTGAGAAATGAAGG + Intergenic
1041749301 8:61241883-61241905 AAAATATCCTTCAGGAATGAAGG - Intronic
1041782972 8:61597782-61597804 AAGCTATCCTTCAAAAATGAAGG + Intronic
1041951521 8:63508991-63509013 AAATTAAGCTTCATAAATGAAGG - Intergenic
1041994416 8:64036335-64036357 AAGTTGTCCTTCAGCAATGAAGG + Intergenic
1042005931 8:64179830-64179852 AAGCTGTGCTTCAGAAATGAAGG + Intergenic
1042129841 8:65577450-65577472 AAATTATCCTTTATAAATGAAGG - Intergenic
1042233341 8:66581848-66581870 AAGCTATCCTTCAGAAATGAGGG + Intronic
1042373840 8:68025236-68025258 AAACTATCCTTCAAAAATGAAGG - Intronic
1042633479 8:70846202-70846224 AAGTTATCCTTCATAAATGAAGG + Intergenic
1043016864 8:74949629-74949651 TGGTTACCCTTGAGGAATGAAGG + Intergenic
1043033063 8:75163283-75163305 AAGCTATCCTTCAAATATGAAGG - Intergenic
1043144147 8:76630798-76630820 AAGTTATCTTTCAAAAGTGAAGG + Intergenic
1043302507 8:78751397-78751419 AATTTAGCCTTCAAAAGTGAAGG + Intronic
1043412803 8:80016453-80016475 AAGTTATCCTTCAAAAATGAAGG + Intronic
1043551988 8:81384974-81384996 AAATTATCCTTCTTAAATGAAGG - Intergenic
1043569117 8:81581724-81581746 AAGTTATTTTTCATAAATGAAGG + Intergenic
1043841055 8:85105164-85105186 AAGTTATCCTTCATAAACCAAGG - Intergenic
1044072569 8:87780158-87780180 AAGTTATCCTTCATAAATTAAGG + Intergenic
1044089532 8:87981768-87981790 AACTAACTCTTCCGAAATGAGGG - Intergenic
1044123791 8:88432519-88432541 AAGCTACTCTTCAAAAATGAAGG + Intergenic
1044253719 8:90034958-90034980 AAAATACCCTTCAAAAATCAAGG - Intronic
1044359777 8:91269324-91269346 AAGTTAACCTTCAAATGTGAAGG - Intronic
1044451551 8:92341377-92341399 AAATTGTCCTTCAGTAATGAGGG - Intergenic
1044467886 8:92527808-92527830 AAGCTATTCTTCAGAAATAAAGG + Intergenic
1044765714 8:95572102-95572124 AAGCTGTCCTTCAGAAATGAAGG - Intergenic
1045120042 8:99027590-99027612 AAACTACCCTTCAGAAATGAAGG - Intronic
1045586349 8:103541383-103541405 AAGCTGTTCTTCAGAAATGAAGG + Intronic
1045620225 8:103968948-103968970 AAATTATCCTTCAAAAGTGAAGG - Intronic
1045790681 8:105979844-105979866 AATATATTCTTCAGAAATGAAGG + Intergenic
1045945525 8:107790727-107790749 AAATTATCCTTCATAAATGAAGG + Intergenic
1046150181 8:110213187-110213209 AAAATACCCTTCAAGAATGAAGG + Intergenic
1046267644 8:111851911-111851933 AATCTATCCTTCAGAAATGAAGG - Intergenic
1046298954 8:112260220-112260242 AAGGTATACTTAAGAAATGATGG - Intronic
1046880556 8:119302188-119302210 AAGCTGTCCTTCAGAAATGAAGG + Intergenic
1047217870 8:122893061-122893083 AAGCTATCCTTCAGAAATAAAGG - Intronic
1047265845 8:123308041-123308063 AAGCTGTCCTTCAAAAATGAGGG - Intergenic
1047376176 8:124299323-124299345 AAAATATCCTTCAAAAATGAAGG - Intergenic
1048127570 8:131653997-131654019 AAACTATCCTTCAAAAATGAAGG + Intergenic
1048566525 8:135604873-135604895 AAACTATCCTTCAAAAATGAAGG - Intronic
1048644260 8:136400599-136400621 AAGCTATCCTTCGTAAATGAAGG + Intergenic
1049965813 9:778286-778308 AAGCTATCCTTCAGAAATGAAGG + Intergenic
1050006648 9:1139140-1139162 AAGCTGTCCTTCAGAAATAAGGG - Intergenic
1050075630 9:1859928-1859950 AAGCTATCCTTCAGAAATCAAGG + Intergenic
1050109877 9:2203566-2203588 AAGTTATCCTTCCAAAATGAAGG + Intergenic
1050374990 9:4961563-4961585 AAATTATCCTTCAAAAGTGAAGG - Intergenic
1050406673 9:5315846-5315868 AAGCTATCCTTTAGAGATGAAGG + Intergenic
1050489654 9:6174615-6174637 AAGCTATTCTTCAGAAACGAAGG + Intergenic
1050610206 9:7344343-7344365 AATTTACCCTTTAGAAAGAAGGG + Intergenic
1050960001 9:11717979-11718001 AAGCTATCCTTCAGAAATGAAGG - Intergenic
1051012506 9:12435359-12435381 AAATTAACCTTAATAAATGAAGG - Intergenic
1051016643 9:12484275-12484297 AAATTATCCTTCAGAAGTAAAGG + Intergenic
1051198545 9:14590648-14590670 AAAATATGCTTCAGAAATGAGGG + Intergenic
1051201951 9:14635582-14635604 AAATTATCCTTCATAAATAAAGG + Intronic
1051280681 9:15440421-15440443 AAACTATCCTTCAGGAATGAAGG - Intronic
1051443231 9:17110805-17110827 AGGCTACCCTTCAGAAATAAAGG - Intergenic
1051773716 9:20610666-20610688 GAGTTACACATCAGAAAGGATGG - Intronic
1051814206 9:21086768-21086790 AAGTTGACCTTCAGAAATGAGGG + Intergenic
1051814613 9:21090783-21090805 AAATTATCCTTCAAAAGTGAAGG - Intergenic
1052072717 9:24102307-24102329 AAGTTATCCTTCAGAAATGTGGG + Intergenic
1052087470 9:24285598-24285620 AAAATATCCTTCATAAATGATGG - Intergenic
1052103111 9:24475533-24475555 AAGTTACCCTTCTTACATTATGG - Intergenic
1052199368 9:25759202-25759224 AAAATAGCTTTCAGAAATGAAGG + Intergenic
1052199623 9:25762761-25762783 AAGGTGTCCTTCAGAAACGAAGG + Intergenic
1052364653 9:27598600-27598622 GAGTTACCCTTTAGACATAATGG + Intergenic
1052649146 9:31277399-31277421 AAGTTATTCTTCATAAACGAAGG + Intergenic
1052695050 9:31867706-31867728 AAGCTATCCTTCATAAATGAAGG - Intergenic
1052764116 9:32622916-32622938 TAGTTACCCAAGAGAAATGAAGG - Intergenic
1052899571 9:33780308-33780330 AAATTAAACTTCATAAATGAAGG + Intronic
1053046571 9:34925093-34925115 AAGCTATTATTCAGAAATGAGGG - Intergenic
1053181455 9:35974906-35974928 AAGCTATCCTTCAGAAATGAAGG - Intergenic
1053460382 9:38264672-38264694 AAGTTATTCTTCAAAAATGAAGG + Intergenic
1053863934 9:42415956-42415978 AATCTGCCCTTCAAAAATGAAGG + Intergenic
1054845568 9:69793348-69793370 AAATTATCCTTCAAAACTGAAGG - Intergenic
1054881555 9:70149644-70149666 AACTGATCCTTCAGGAATGAAGG - Intronic
1055170407 9:73251320-73251342 AAAATATCCTTCAGAAATGAAGG + Intergenic
1055653279 9:78429309-78429331 AGGCTATCCTTCAAAAATGAAGG - Intergenic
1055684034 9:78751456-78751478 AAGCTATCCTTCAGAAATGAGGG - Intergenic
1055744252 9:79425499-79425521 AAGCTATCCTTTAGAAATGAAGG - Intergenic
1055767957 9:79685229-79685251 AAATTACCCAGCAGGAATGAGGG - Intronic
1055833337 9:80408804-80408826 AAATTATCCTTCAAAAATGTAGG + Intergenic
1056026845 9:82506509-82506531 AAATTAAGCTTCATAAATGAAGG + Intergenic
1056038903 9:82639303-82639325 AACTTACCCTTTGTAAATGAAGG + Intergenic
1056039664 9:82650530-82650552 AAGCTATTCTTCAGAAACGAAGG - Intergenic
1056087377 9:83164039-83164061 AAACTATCCTTCAAAAATGAAGG + Intergenic
1056127243 9:83546409-83546431 AAATTAAGCTTCATAAATGAAGG + Intergenic
1056184181 9:84116934-84116956 AAATTATCCTTCAAACATGAAGG - Intergenic
1056416738 9:86384202-86384224 AAGCTTTCCTTCAAAAATGATGG - Intergenic
1056556347 9:87692790-87692812 AAGTTATGCTTCATAAGTGAAGG - Intronic
1056595597 9:88005458-88005480 AAAATACCTTTCAAAAATGAAGG + Intergenic
1056742699 9:89273565-89273587 AAGTTGTCTTTCATAAATGAAGG - Intergenic
1056814041 9:89788049-89788071 AAATTATTCTTCAGAAATAAAGG + Intergenic
1056876249 9:90334293-90334315 AAATTATCCTTCAAAAGTGAGGG + Intergenic
1056994280 9:91442181-91442203 AAGCTGTCCTTAAGAAATGAAGG - Intergenic
1057156433 9:92844699-92844721 AAAGTATCCTTCAAAAATGAAGG + Intergenic
1057320564 9:94008955-94008977 AAAATACCCTTTAGAAATGAAGG + Intergenic
1057462648 9:95277813-95277835 AAACTACCTTTCAAAAATGAAGG + Intronic
1057523655 9:95780899-95780921 AAGTGACCCTTCAGAGATTCCGG + Intergenic
1057539223 9:95949633-95949655 AAACTGCCCTTCAAAAATGAGGG + Intronic
1057932739 9:99210228-99210250 AAGCTGTCCTTCATAAATGAAGG - Intergenic
1057980116 9:99652023-99652045 AAACTAAGCTTCAGAAATGAAGG + Intergenic
1058204708 9:102089244-102089266 AAATTACCCTTCAAAAATGAAGG + Intergenic
1058316607 9:103575007-103575029 AAGCTATCCTTCAGATATGAAGG + Intergenic
1058319694 9:103613736-103613758 AAGCAGTCCTTCAGAAATGAGGG - Intergenic
1058491009 9:105499502-105499524 AAATTATCCTTCAGTAGTGAAGG - Intronic
1058512496 9:105735527-105735549 AAGCTATTCTTCAGAAATTAAGG - Intronic
1058789717 9:108430859-108430881 AAACTACCCTTCAAAAATGATGG + Intergenic
1059073897 9:111168695-111168717 AAGCTGTCTTTCAGAAATGAAGG + Intergenic
1059288973 9:113204496-113204518 AAAATATCCTTCAAAAATGAAGG - Intronic
1059787444 9:117600819-117600841 AAACTATCTTTCAGAAATGAGGG + Intergenic
1059844603 9:118260670-118260692 AAGCTATCTTTCAGAAATGAAGG - Intergenic
1059951877 9:119473351-119473373 AAAATATCCTTCAAAAATGAAGG + Intergenic
1060080005 9:120635055-120635077 AAGCTATCCTTCAGAAATAAGGG - Intronic
1060223709 9:121778077-121778099 ATGTTAGACTTCAGAACTGAGGG - Intronic
1060233754 9:121845311-121845333 AAATTATCCTCCAGAAATGAAGG + Intronic
1060641191 9:125240808-125240830 ACGTTCCCCTTCAGGAGTGAAGG + Exonic
1060669400 9:125455985-125456007 AAAATATCCTTCAGAAAGGAAGG - Intronic
1061469343 9:130811057-130811079 AAAATACCTTTCAAAAATGAAGG + Intronic
1061830991 9:133294595-133294617 AAGCTAGCCTTCATAAATGAAGG + Intergenic
1062692904 9:137853780-137853802 AAGTTATCCTTCAGAAATGAAGG - Intronic
1062719680 9:138032616-138032638 AAAATACCCTTCAGGAATGAAGG - Intronic
1062727740 9:138085797-138085819 AAGCTATCCTTCAGAAATGAGGG + Intronic
1062755885 9:138289041-138289063 AACTTATCCTTCAAAAATGAAGG - Intergenic
1203474638 Un_GL000220v1:140740-140762 TATTTCCCCTTCTGAAATGACGG + Intergenic
1186645921 X:11507220-11507242 CTGTGACCCTTCAGAAATAAGGG + Intronic
1186736726 X:12473208-12473230 AAGCTAACCTTCATAAGTGAAGG + Intronic
1186985196 X:15005274-15005296 AAGCTATCCTTCCAAAATGAAGG + Intergenic
1187310726 X:18138815-18138837 AAATTATCCTTCACTAATGAAGG + Intergenic
1187798636 X:23034298-23034320 AAATAATCCTTCAGAAATAATGG - Intergenic
1187826585 X:23337174-23337196 AAGTTGCCCTTTAGATATGGAGG - Intronic
1188011868 X:25065031-25065053 AAATTATCCCTCAGAAAAGAAGG + Intergenic
1188064934 X:25647319-25647341 AAGTTATCTTTCAAATATGAAGG - Intergenic
1188066437 X:25666467-25666489 AAAATACCCTTCAGAAATGAAGG - Intergenic
1188114837 X:26230717-26230739 AAATTATCCTTCAGAAGAGAAGG - Intergenic
1188138158 X:26514968-26514990 AAACTGTCCTTCAGAAATGAAGG + Intergenic
1188393219 X:29646858-29646880 AAGCTGTCCTTCAGAAATGAAGG + Intronic
1188663735 X:32792137-32792159 AAGGTAGCCTTCATAAATCAAGG + Intronic
1188729947 X:33633675-33633697 AAGTTATCCTTCATAAATGAAGG + Intergenic
1188746069 X:33845996-33846018 AAGCTTTCCTTCAGAAATGAAGG - Intergenic
1188815113 X:34703891-34703913 AAATTATCCTTCAAACATGAAGG - Intergenic
1188831189 X:34898955-34898977 AAGCTATCCTTCAGAAATTATGG + Intergenic
1188924430 X:36022216-36022238 AAATTATCCTTCAAACATGAAGG - Intergenic
1189426080 X:40901321-40901343 AAAATATCCTTCAGGAATGAAGG + Intergenic
1189441494 X:41040097-41040119 AACATATCCTTCAGAAATGAAGG + Intergenic
1189478182 X:41373293-41373315 AAAATATCCTTCAGAAATGTAGG - Intergenic
1189564445 X:42226746-42226768 AAATGATCCTTCATAAATGAAGG - Intergenic
1189628394 X:42923389-42923411 AAAATACCCTTCAAACATGAAGG + Intergenic
1189661085 X:43300428-43300450 AAATTACCTTTCATAAATGAAGG - Intergenic
1189823796 X:44896720-44896742 AAAATATTCTTCAGAAATGAAGG - Intronic
1189875854 X:45434942-45434964 AAACTATCCTTCAGGAATGAAGG - Intergenic
1189890310 X:45594437-45594459 AAAATATCCTTCAGAGATGATGG - Intergenic
1189931035 X:46011461-46011483 AAATGACCATTCAGAAATGAAGG - Intergenic
1189934049 X:46046519-46046541 AAATTATCCTTCAAAAGTGAAGG + Intergenic
1190032655 X:46989441-46989463 AAAATATCCTTCAGGAATGAAGG - Intronic
1190100869 X:47522155-47522177 AAGCTATCCTTCAAAAATGAAGG + Intergenic
1190112147 X:47597933-47597955 AAATTATCTTTCAAAAATGAAGG + Intronic
1190139020 X:47824918-47824940 AAATTATCCTTCGAAAATGAAGG + Intergenic
1190156146 X:47994306-47994328 AAGTTATCCTTCAGGAATGAAGG + Intronic
1190156327 X:47995908-47995930 AAAATCTCCTTCAGAAATGAAGG + Intronic
1190384019 X:49866993-49867015 AAAATATCCTTCAGGAATGAAGG - Intergenic
1190447857 X:50548052-50548074 AAAATATCCTTCAGGAATGAAGG + Intergenic
1190460873 X:50672939-50672961 AAAATATCCTTCAGGAATGAAGG + Intronic
1190488334 X:50954133-50954155 AAAATATCCTTCAAAAATGAGGG + Intergenic
1190586755 X:51952090-51952112 AAATTATCCTTCAAAAGTGAAGG + Intergenic
1190605865 X:52141205-52141227 AACCTATCCTCCAGAAATGAAGG + Intergenic
1190806151 X:53839082-53839104 AAGCTATCCTTCATAAATGAAGG - Intergenic
1190925166 X:54896692-54896714 AAGTTATTTTTCATAAATGAAGG + Intergenic
1190961354 X:55252165-55252187 AAGTTGTTCTTCAGAAATGAGGG - Intronic
1190968472 X:55325956-55325978 AAAATATCCTTCAGGAATGAAGG - Intergenic
1191022411 X:55876945-55876967 AAGCTGCCTTTCAGAAATAAAGG - Intergenic
1191591164 X:62887040-62887062 AAGCTAACCTTCAGAAATGAAGG - Intergenic
1191615408 X:63164845-63164867 AAATTATCCTTCACAGATGAAGG + Intergenic
1191620890 X:63214078-63214100 AAATTATCCTTCACAGATGAAGG - Intergenic
1191700486 X:64036774-64036796 AAGCTGTCCTTCAGAAATGAAGG + Intergenic
1191704250 X:64077022-64077044 AAATTAATCTTCAAAAATGAAGG - Intergenic
1191767561 X:64714881-64714903 AAGCTACTGTTAAGAAATGAAGG + Intergenic
1191818622 X:65276597-65276619 AAGCTATCCTTTGGAAATGAAGG + Intergenic
1191829608 X:65402080-65402102 AACTTACCCTTCAGAGAACAGGG - Intronic
1191968564 X:66788429-66788451 AAGCTATCCTTCAGGAATAAAGG + Intergenic
1192096353 X:68215774-68215796 AAATTATCCTTCAAAAGTGATGG + Intronic
1192188571 X:68975948-68975970 AAAATATCCTGCAGAAATGAAGG - Intergenic
1192361254 X:70441428-70441450 AAAATATCCTTCAGGAATGAGGG + Intergenic
1192383187 X:70638388-70638410 AAGCTATCCTTCAGAAATGAAGG + Intronic
1192548720 X:72036230-72036252 AAAATATCCTTCAGGAATGATGG - Intergenic
1192659293 X:73025259-73025281 AATCTTCCCTTCAGAAATAAGGG - Intergenic
1192715210 X:73633269-73633291 AAGCTGTCCTTTAGAAATGAAGG - Intronic
1192766840 X:74148375-74148397 AAGTTAAGCTTCACAGATGAAGG + Intergenic
1193071559 X:77311235-77311257 ATGTTACCCTTCAATAATGTAGG + Intergenic
1193208561 X:78778384-78778406 AAACTAACCTTCATAAATGAAGG - Intergenic
1193211594 X:78812218-78812240 AAACTACCCTTCAAAAATGAAGG + Intergenic
1193267562 X:79490195-79490217 AAGTTATCCTTCAAATATGAAGG + Intergenic
1193277287 X:79604379-79604401 AAGCTAAGCTTCATAAATGAAGG + Intergenic
1193319620 X:80106269-80106291 AACTTATCCTTCAAAAATGCTGG + Intergenic
1193457766 X:81752403-81752425 AAATTAAGCTTCATAAATGAAGG - Intergenic
1193509367 X:82381109-82381131 AAGGCATCCTTCAAAAATGAAGG - Intergenic
1193622295 X:83770801-83770823 AAGCTATACTTCAGAAATCATGG - Intergenic
1193664788 X:84301998-84302020 AAATCATCCTTCAGACATGAAGG + Intergenic
1193665612 X:84311876-84311898 AAAATATCCTTCAGATATGAAGG + Intergenic
1193757750 X:85429208-85429230 AAGCTATCCCTCAGAAATGAAGG - Intergenic
1193899454 X:87159614-87159636 AAAATATCCTTCAGACATGAAGG - Intergenic
1193902171 X:87194253-87194275 AAGCTATCCTTCAAAAATCAGGG + Intergenic
1193953812 X:87833976-87833998 AAATTATCCTTCATAAATGAAGG - Intergenic
1194020666 X:88688094-88688116 AAGCTGTCCTTTAGAAATGAAGG - Intergenic
1194224750 X:91243115-91243137 AAATTAAGCTTCAAAAATGAAGG - Intergenic
1194249477 X:91556759-91556781 AAACTATTCTTCAGAAATGAAGG - Intergenic
1194457355 X:94121707-94121729 AAATTACTCTTCAAATATGAAGG - Intergenic
1194561737 X:95429869-95429891 AAAATATCCTTCAGACATGAAGG + Intergenic
1194568763 X:95526543-95526565 AAGTGATACTGCAGAAATGAAGG + Intergenic
1194800440 X:98266045-98266067 CAGTTATTCTTCACAAATGAAGG + Intergenic
1194807058 X:98343083-98343105 AAGTTAGCCTTCTTAAATAAAGG - Intergenic
1194872432 X:99148711-99148733 AAATTATCTTTCATAAATGAAGG + Intergenic
1194877689 X:99209276-99209298 AAGCTGTCCTTCAGAAATGAAGG - Intergenic
1194904390 X:99556615-99556637 AAGCTATTGTTCAGAAATGAAGG - Intergenic
1194952438 X:100142836-100142858 AAATTACTCTTCAGAAATAAAGG + Intergenic
1195019592 X:100813126-100813148 AAACTGCCCTTCAGAAATGAGGG + Intergenic
1195147060 X:102028632-102028654 AAGTTACCCTTCAAAAATAAAGG + Intergenic
1195152842 X:102091152-102091174 GAATTATCTTTCAGAAATGAAGG - Intergenic
1195172048 X:102279373-102279395 AAGATATCCTTCAAACATGAAGG - Intergenic
1195186812 X:102407720-102407742 AAGATATCCTTCAAACATGAAGG + Intronic
1195226111 X:102795648-102795670 AAACTAAGCTTCAGAAATGAAGG - Intergenic
1195264044 X:103162759-103162781 AAATTATCCTTCAGAAATTGAGG - Intergenic
1195307091 X:103594664-103594686 AAATTATCCTTCAAAAGTGAAGG - Intergenic
1195417809 X:104639749-104639771 AAAGTATCCTTCATAAATGAAGG - Intronic
1195496775 X:105545297-105545319 AAACTATCCTTCAAAAATGAAGG - Intronic
1195512473 X:105733105-105733127 AAATTATCCTTCAAAAGTGATGG - Intronic
1195576196 X:106453807-106453829 AAACTATCTTTCAGAAATGAAGG - Intergenic
1195639957 X:107162611-107162633 AAAATGTCCTTCAGAAATGAAGG + Intronic
1195839636 X:109159070-109159092 AAGCTATCCTTCAGATGTGAAGG + Intergenic
1195845801 X:109226875-109226897 AAAATACACTTCAGAAATCAAGG + Intergenic
1196126544 X:112107549-112107571 AAGCTGGCATTCAGAAATGAAGG - Intergenic
1196182763 X:112712265-112712287 AAGGTATCCTTCAAAACTGAAGG - Intergenic
1196213476 X:113022830-113022852 AAATTATCTTTCAGAAGTGAAGG + Intergenic
1196289914 X:113928189-113928211 AAATTACCCTTCACAAATGAAGG - Intergenic
1196508236 X:116474830-116474852 AAAATACCCTTCAGACATGAAGG - Intergenic
1196699445 X:118651813-118651835 AATGTACCCTTCATACATGAGGG - Intronic
1196864997 X:120063049-120063071 AAGCTACCTTTCAGAAATGAAGG + Intergenic
1196878104 X:120173283-120173305 AAGCTACCTTTCAGAAATGAAGG - Intergenic
1197000522 X:121433625-121433647 AATTTATTCTTCAGAATTGATGG + Intergenic
1197027934 X:121777950-121777972 AAACTACCCTTCATAAATGAAGG - Intergenic
1197030945 X:121814970-121814992 AAATTATCCTTCAAAACTGAGGG - Intergenic
1197081577 X:122424989-122425011 AAATTAAGCTTCATAAATGAAGG - Intergenic
1197105159 X:122704854-122704876 AAATTACCCTTCAAACATGAAGG + Intergenic
1197121068 X:122893418-122893440 AAGCTATCTTTCAAAAATGAAGG - Intergenic
1197167107 X:123390360-123390382 AAGTTGCCTTTCATAAATGAAGG - Intronic
1197643335 X:128991175-128991197 AAGTTATCCTTTATAAATGAAGG - Intergenic
1197661333 X:129177171-129177193 AAATTATCATTCAGAAATGAGGG - Intergenic
1197666212 X:129226545-129226567 AAAATATCCTTCAGGAATGAAGG + Intergenic
1197682032 X:129395433-129395455 AAGCTGTCCTTCAGAAATGAGGG + Intergenic
1198127889 X:133664649-133664671 ATGTTATGCTTGAGAAATGAGGG + Intronic
1198192131 X:134317660-134317682 AAGCTGTCCTTCAGAAATAAAGG + Intergenic
1198232364 X:134703444-134703466 AAGTTATCATTCACAACTGAGGG + Intronic
1198327238 X:135586026-135586048 AAACTAACCTTCACAAATGAAGG + Intergenic
1198616619 X:138464749-138464771 AAACTACGCTTCATAAATGAAGG + Intergenic
1198688730 X:139256870-139256892 AAAATATCCTTCAGGAATGAAGG - Intergenic
1198787702 X:140308041-140308063 AAATTATCCTTCACAAATAAAGG + Intergenic
1198896842 X:141465027-141465049 AAATTATCCTTCACAAGTGAAGG - Intergenic
1198946694 X:142024061-142024083 AAAATATCCTTCAGATATGAAGG - Intergenic
1199003404 X:142668005-142668027 AAGCTGTCTTTCAGAAATGAAGG - Intergenic
1199072283 X:143491389-143491411 AAATTATCCTTCAAAAGTGAAGG - Intergenic
1199159747 X:144595197-144595219 AAAATATCCTTCAAAAATGAAGG - Intergenic
1199182434 X:144874272-144874294 AAATTACTCTTCAAAAATGAAGG - Intergenic
1199218430 X:145288943-145288965 AAGGTGTCCTTCAGAAATGAAGG - Intergenic
1199282996 X:146023712-146023734 AAATTAAGCTTCATAAATGAAGG + Intergenic
1199332087 X:146574403-146574425 AAATTATCCTTCATAAATGAAGG + Intergenic
1199332103 X:146574538-146574560 AAATTATCCTTCATATATGAAGG - Intergenic
1199341752 X:146687142-146687164 AAGATAACCTTCACACATGAAGG - Intergenic
1199347923 X:146763406-146763428 AAATTACCCTAAAGAAATCAAGG - Intergenic
1199569111 X:149249995-149250017 AAACTATCCTTCAAAAATGAAGG - Intergenic
1199865405 X:151843965-151843987 AAGCTATCCTTCAGAACTAAAGG + Intergenic
1199934351 X:152557107-152557129 AAGTTATCTTTAACAAATGAAGG - Intergenic
1200175596 X:154113719-154113741 AAGTTATCCTTCAAGAGTGATGG - Intergenic
1200295995 X:154921073-154921095 ATTTTATCTTTCAGAAATGAAGG - Intronic
1200303692 X:155004236-155004258 AAAGTATCCTTCAAAAATGAAGG + Intronic
1200362966 X:155630464-155630486 AAACTATCCTTCAGAAATGAAGG - Intronic
1200467509 Y:3537816-3537838 AATCTATCCTTCAGAAATAAAGG + Intergenic
1200568435 Y:4797974-4797996 AAACTATTCTTCAGAAATGAAGG - Intergenic
1201053560 Y:9965852-9965874 AAATTAACCTTCATAAGTGAAGG - Intergenic
1201358984 Y:13126150-13126172 AAGGTATCCTTCATAAATGAAGG - Intergenic
1202276047 Y:23120451-23120473 AAGCAATCCTTCATAAATGAGGG + Intergenic
1202289981 Y:23300240-23300262 AAGCAATCCTTCATAAATGAGGG - Intergenic
1202382394 Y:24285860-24285882 AACTTATCCTTCAAAAATGAAGG - Intergenic
1202429040 Y:24754171-24754193 AAGCAATCCTTCATAAATGAGGG + Intergenic
1202441751 Y:24915918-24915940 AAGCAATCCTTCATAAATGAGGG - Intergenic
1202488390 Y:25384265-25384287 AACTTATCCTTCAAAAATGAAGG + Intergenic