ID: 945357425

View in Genome Browser
Species Human (GRCh38)
Location 2:208856762-208856784
Sequence CTGCAGCAGCAGTAGCAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 942
Summary {0: 1, 1: 4, 2: 23, 3: 192, 4: 722}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945357420_945357425 6 Left 945357420 2:208856733-208856755 CCAGTCCGAGGGCAGCAAGGGCA 0: 2
1: 15
2: 40
3: 56
4: 197
Right 945357425 2:208856762-208856784 CTGCAGCAGCAGTAGCAGAGGGG 0: 1
1: 4
2: 23
3: 192
4: 722
945357417_945357425 8 Left 945357417 2:208856731-208856753 CCCCAGTCCGAGGGCAGCAAGGG 0: 1
1: 14
2: 27
3: 69
4: 276
Right 945357425 2:208856762-208856784 CTGCAGCAGCAGTAGCAGAGGGG 0: 1
1: 4
2: 23
3: 192
4: 722
945357421_945357425 1 Left 945357421 2:208856738-208856760 CCGAGGGCAGCAAGGGCAGTACC 0: 7
1: 19
2: 30
3: 61
4: 257
Right 945357425 2:208856762-208856784 CTGCAGCAGCAGTAGCAGAGGGG 0: 1
1: 4
2: 23
3: 192
4: 722
945357419_945357425 7 Left 945357419 2:208856732-208856754 CCCAGTCCGAGGGCAGCAAGGGC 0: 2
1: 16
2: 43
3: 63
4: 234
Right 945357425 2:208856762-208856784 CTGCAGCAGCAGTAGCAGAGGGG 0: 1
1: 4
2: 23
3: 192
4: 722
945357415_945357425 12 Left 945357415 2:208856727-208856749 CCTTCCCCAGTCCGAGGGCAGCA 0: 3
1: 11
2: 37
3: 62
4: 362
Right 945357425 2:208856762-208856784 CTGCAGCAGCAGTAGCAGAGGGG 0: 1
1: 4
2: 23
3: 192
4: 722

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945357425 Original CRISPR CTGCAGCAGCAGTAGCAGAG GGG Intergenic
900008237 1:79684-79706 CTGTAGAGGCAGTGGCAGAGGGG - Intergenic
900237557 1:1599986-1600008 CAGCAGCAGCAGCAGCGGCGGGG + Exonic
900341125 1:2189860-2189882 CTCCAGCGGCAGGAGCAGAGAGG - Intronic
900661945 1:3789154-3789176 CTGCAGCACCAGGAACAGTGCGG + Intronic
900707789 1:4091094-4091116 CTGCAGGAGGAGTAACACAGTGG - Intergenic
900908477 1:5577407-5577429 GTGCAGGAGCAGTAGAAGGGAGG - Intergenic
901049266 1:6418379-6418401 ATGCAGCAGCAGTAGCCTAAGGG - Exonic
902228273 1:15010744-15010766 ATTCAGCAGAAGTAGCAGAGTGG + Intronic
902995803 1:20223762-20223784 CGCCAGCAGGAGTAGCACAGGGG - Intergenic
903137826 1:21320932-21320954 CTGCAGCAGCAGGATCCTAGAGG - Intronic
903249950 1:22045630-22045652 CAGCATGAGCAGTGGCAGAGAGG + Intergenic
903349849 1:22711005-22711027 CAGCGGCAGCAGCAGCAGCGCGG - Exonic
903373031 1:22849126-22849148 GTGCAGCAGCAGTGGGAGTGGGG - Intronic
903413812 1:23168227-23168249 CTGCAGCAGCAGGAGGAGGAGGG - Intronic
904334462 1:29787759-29787781 CTGCTGCATCAGTGGTAGAGAGG + Intergenic
904563622 1:31414191-31414213 CTGTAGCTGCAGCCGCAGAGGGG + Intronic
904961963 1:34340425-34340447 CAGCAGCAACAGCAGCACAGGGG - Intergenic
905805731 1:40875907-40875929 CAGCAGCAGCAGCAGCAATGTGG - Intergenic
907466438 1:54640882-54640904 CTGAAGCAGCAGAAGGAGACTGG + Intergenic
907488075 1:54790758-54790780 CAGCAGCAGCAGCAGCAGCCAGG - Intronic
907534500 1:55137544-55137566 CTCCAGCAGCAGCAGCAGTGGGG - Exonic
908776468 1:67645787-67645809 CTGCAGAAGCTGGAGCAAAGTGG + Intergenic
908825979 1:68133064-68133086 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
909170026 1:72282963-72282985 CAGCAGCAGCAGAAGCAGCGCGG + Intergenic
909691298 1:78410284-78410306 CTGCATCAGCAGTGGAAAAGTGG + Intronic
909806150 1:79875925-79875947 CTGCAGCTGCAGTAGTGGAGAGG - Intergenic
910065187 1:83143409-83143431 CTGCAGGAGCCATAGCGGAGAGG + Intergenic
910065244 1:83143687-83143709 CTGCAGCTGCAATGACAGAGGGG + Intergenic
910171862 1:84386495-84386517 CAGCAGCAGAGGTAGCAGAGGGG + Intronic
910514014 1:88037573-88037595 TGGCAGCAGCAGTGGCAGAAGGG - Intergenic
910674101 1:89800008-89800030 TTGCAGCAGCAGCAGCAAAGGGG + Intronic
910812649 1:91253809-91253831 CTGCAGAGGCAATGGCAGAGAGG - Intergenic
910996144 1:93106231-93106253 ATGCAGCAGGAGTAGTACAGTGG + Intronic
911357938 1:96844445-96844467 GTGCAGCTGCAGCAACAGAGAGG + Intergenic
911368957 1:96973745-96973767 GTGCAGGATCAGTAGCACAGAGG - Intergenic
911539847 1:99145418-99145440 CAACAGCAGCAGGAGCACAGTGG - Intergenic
912595931 1:110875669-110875691 CTGCACCTGCAGTGGCAGATGGG - Intronic
912614616 1:111085615-111085637 CAGCAGCAGCTGTGACAGAGGGG + Intergenic
913334712 1:117698594-117698616 CCGAAGCAGCAGCAGGAGAGAGG + Intergenic
913410193 1:118542597-118542619 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
913609614 1:120497271-120497293 CTGCAACAGCAGCTGGAGAGCGG - Intergenic
914434403 1:147647550-147647572 CTGCAGGAGCAGGTGCCGAGAGG - Exonic
914581576 1:149024573-149024595 CTGCAACAGCAGCTGGAGAGCGG + Exonic
914802584 1:150972274-150972296 CTGCACCTCCATTAGCAGAGAGG + Intronic
914826687 1:151142574-151142596 CAGCAGCAGCAGTAGCAGCAAGG + Exonic
915393155 1:155562436-155562458 CGGCGGCGGCAGCAGCAGAGTGG + Exonic
915409300 1:155688325-155688347 CGGCAGCGGCGGCAGCAGAGTGG + Exonic
915815774 1:158963162-158963184 CTGCAGCAGCAGTGGCAGAGGGG - Intronic
916059208 1:161087282-161087304 CTGCTGCAGCAGCAGCAGAGTGG + Intronic
916268655 1:162917839-162917861 CTGCAGTGGCAGTGGCAGAGGGG + Intergenic
916568909 1:166008217-166008239 CTGCAGGGGCAGTGGCAGAGAGG + Intergenic
916633196 1:166638657-166638679 CTGCAGCTGCTGTGGCAGAGGGG - Intergenic
916664183 1:166950499-166950521 CTGAGGCAGCAGTAACACAGGGG + Intronic
916880593 1:169016499-169016521 TTGCAGCAGGAGTAGGAGAAAGG - Intergenic
917055617 1:170978338-170978360 CTGCTGTGGCAGTAGCAGAGGGG + Intronic
917149393 1:171928675-171928697 CTGCAGAGGCAGTGGCAGAGAGG + Intronic
917208240 1:172601162-172601184 CAGCAGGAGCAGAAGCAGACAGG + Intronic
917367112 1:174244344-174244366 CTGAAGCAGGAGTAGCAGCATGG + Intronic
917585756 1:176425304-176425326 CTACTGTAGCAGTGGCAGAGGGG + Intergenic
917609587 1:176673369-176673391 CAAAAGCAACAGTAGCAGAGGGG + Intronic
919453678 1:197799630-197799652 CTGCAGCTGCAATGGCAGATGGG + Intergenic
919776483 1:201197427-201197449 CTGCAGCAGCGGCAGCAGCCTGG - Intronic
919812150 1:201415475-201415497 CAGCAGCAGCAGAATCAGAGTGG - Intronic
919976285 1:202615176-202615198 ATGAAGCAGCAGCAGCAGATTGG + Intronic
920178225 1:204116662-204116684 CGGCAGCAGCAGGAGCAGGTAGG + Exonic
920727036 1:208445860-208445882 CTGCAGCTGCTGTGGCAGATAGG + Intergenic
920786951 1:209051009-209051031 TCGTAGAAGCAGTAGCAGAGAGG - Intergenic
921012959 1:211161267-211161289 CTACAGAGGCAGTGGCAGAGAGG + Intergenic
921764430 1:218953501-218953523 CAGCAGCAGCAGCAGCAGGAGGG + Intergenic
921764431 1:218953504-218953526 CAGCAGCAGCAGCAGGAGGGAGG + Intergenic
921903132 1:220468814-220468836 CAGCAGCAGCATTTGCAGAAAGG + Intergenic
923391820 1:233519937-233519959 ATGCAGCACAAGAAGCAGAGAGG - Intergenic
923461190 1:234211027-234211049 CTGCTCCAGCAGTAGCTGAAAGG + Intronic
923506290 1:234609196-234609218 TTGCAGCAGCAGCAGCAGCTTGG - Exonic
924458129 1:244234421-244234443 CAGCAGCAGCAGCAGCAGCCAGG - Intergenic
924632394 1:245753097-245753119 ATGCATCACCAGTAGCAAAGGGG + Intronic
1063383584 10:5602094-5602116 CTGCAGCAGGAATAGCACATTGG - Intergenic
1064419569 10:15179261-15179283 CAGCAGCAGCAGTATCTGTGAGG - Intergenic
1064645341 10:17454199-17454221 CAGCAGCAGCAGCAGCAGGCTGG + Exonic
1064701179 10:18023468-18023490 CTGCTACAGCAGTGGCAGAGGGG + Intronic
1065853128 10:29807458-29807480 CTCCAGCCACAGTTGCAGAGAGG + Intergenic
1065879618 10:30027567-30027589 CAGCAGCAGCAGCAGCAGTGAGG - Exonic
1066156457 10:32683709-32683731 CTGCAGCAGCAATGGCAGAGGGG + Intronic
1066224090 10:33365491-33365513 CGTCAGTAGCAGAAGCAGAGAGG + Intergenic
1067560356 10:47300692-47300714 CAGCAGCAGCAGCAGCAGCTGGG - Exonic
1067578834 10:47426288-47426310 CTGCAACTGTAGTGGCAGAGAGG - Intergenic
1067819963 10:49519888-49519910 CTGAGGCAGCAGGTGCAGAGTGG - Intronic
1068097612 10:52511645-52511667 CAGCAGCAGCAGGACCAGAGAGG + Intergenic
1068218298 10:54010922-54010944 CTGCTGTGGCAGTGGCAGAGTGG - Intronic
1068218347 10:54011190-54011212 CTGCAGCAGCAGTGGTAGAGGGG - Intronic
1068335335 10:55627658-55627680 CTGCTGCTGAAGGAGCAGAGGGG - Intronic
1070115588 10:73525810-73525832 CTGCAGCAGCAGTAGTAAAAAGG - Intronic
1070160772 10:73865577-73865599 CAGCAGCAGTGGCAGCAGAGGGG + Intronic
1070870589 10:79748281-79748303 CTGCAGAGACAGTGGCAGAGAGG - Intergenic
1071023191 10:81082846-81082868 CTGCAGTGGCAGTGGCAGAGGGG + Intergenic
1071052823 10:81472885-81472907 CTGCAGCAGCAGCGCCAGATGGG - Intergenic
1071637507 10:87270493-87270515 CTGCAGAGACAGTGGCAGAGAGG - Intergenic
1071657738 10:87467458-87467480 CTGCAGAGACAGTGGCAGAGAGG + Intergenic
1071813300 10:89206915-89206937 GTGCAGCAGCAGGAGCAGCTCGG + Exonic
1071882106 10:89910894-89910916 CAGCAGCAGCAGTGGCAGCATGG + Intergenic
1073676746 10:105655782-105655804 CTGCAACAGCAAAAGCAGAATGG + Intergenic
1075438470 10:122461669-122461691 CAGCAGCAGCGGGAGAAGAGCGG - Exonic
1075830654 10:125408112-125408134 CTGCAGCAGCAGTGGCCGCATGG - Intergenic
1076136313 10:128047426-128047448 CAGCAGCGGCAGTAGCAGCCAGG - Exonic
1076140872 10:128077734-128077756 CAGAAGCAGCAGCAGCAGACAGG + Exonic
1076229542 10:128808617-128808639 CTGTGGCAGCCCTAGCAGAGAGG - Intergenic
1076352262 10:129825369-129825391 CTGCAGCAGCAGAGGGAGGGAGG + Intergenic
1076372957 10:129966865-129966887 GGGCAGGAGCAGCAGCAGAGGGG + Intergenic
1077211371 11:1372297-1372319 CTGCAGCTGCTGTACCAGGGTGG + Intergenic
1077370016 11:2177448-2177470 GGGCAGCAGCAGTAGCAGAAGGG - Intergenic
1078074796 11:8148794-8148816 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1078993278 11:16670460-16670482 CTGCAGAGGCAGTGGCAGAGAGG - Intronic
1079181380 11:18196747-18196769 CAGCAGCAGCAGTACCAGATAGG - Intronic
1079812471 11:25012489-25012511 CTTCAGCAGCACCAGCAGAAGGG - Intronic
1079837265 11:25350441-25350463 CTGCAGTGACAGTGGCAGAGGGG + Intergenic
1079837318 11:25350721-25350743 CGGCAGCTGCAATGGCAGAGGGG + Intergenic
1079882697 11:25945606-25945628 CTGCAGTGGCAGTGGCTGAGGGG - Intergenic
1080344354 11:31307800-31307822 ATTCAGCAGCAGTATCAGAAGGG - Exonic
1080689091 11:34540943-34540965 CTTCAGGGGCAGAAGCAGAGAGG - Intergenic
1080943205 11:36942646-36942668 CTGGAGCAGCAACATCAGAGAGG + Intergenic
1081634581 11:44712296-44712318 CTGCAGCAGCAGTGGCAGGTTGG + Intergenic
1081801080 11:45859766-45859788 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1081812824 11:45922920-45922942 CAGCAGCAGCAGCAACAGCGCGG - Exonic
1082004553 11:47412363-47412385 CTGCAGCAGCAGCAACAGCTGGG + Exonic
1082615760 11:55357246-55357268 CTGCAGTGGCAGTGGGAGAGAGG - Intergenic
1082883253 11:58058754-58058776 CAGCAGCTGCAGAAGCAGATCGG - Intronic
1082936118 11:58658628-58658650 CTGCAGGTGCAGGAGGAGAGAGG + Intronic
1083186293 11:61019751-61019773 CTGCAGCAGCACTGGCATGGGGG - Exonic
1083971610 11:66080261-66080283 CTGGAGAAGCAGCAGCAGACAGG + Intronic
1084086581 11:66857749-66857771 CAGCAGCAGCAGGAGCGGCGGGG - Exonic
1084697038 11:70761915-70761937 CAGCAGCAGCAGCAGCAGCCGGG - Intronic
1084738220 11:71119792-71119814 CGGCAGCAGCAGTAGCACCTTGG - Intronic
1084758092 11:71251805-71251827 CAGCAGCAGCTGTCGCGGAGAGG - Intronic
1084764967 11:71302241-71302263 CAGCAGCAGCAGTAGGAGCATGG + Intergenic
1085022244 11:73217224-73217246 CACCAGGAGCAGTAGCAGAGTGG - Intergenic
1085305661 11:75484337-75484359 CAGCAGCAGCTGCACCAGAGGGG + Intronic
1085635808 11:78158762-78158784 CTGCAGCAGAGGCAACAGAGAGG - Intergenic
1085782678 11:79423662-79423684 CTGGAGCAGCAGGCGCAGGGAGG + Intronic
1086303931 11:85459727-85459749 CTGCAGCTGCAATTCCAGAGGGG + Intronic
1086486912 11:87315117-87315139 CAGTAGCAGCAGTAGTAGGGGGG - Intronic
1087091162 11:94274569-94274591 CTCCAGCAGCAGAAGGAGAGAGG - Intergenic
1087206763 11:95404545-95404567 CTGCAGCTGCTGTAGGAGATGGG + Intergenic
1087392058 11:97548443-97548465 CAGCAGCAGCAGCAGCAGCCTGG + Intergenic
1087859392 11:103135558-103135580 CTGGAGCATCAGTACCAGATGGG + Exonic
1088704230 11:112447575-112447597 CAGGAAGAGCAGTAGCAGAGTGG - Intergenic
1088729944 11:112671556-112671578 CTTCTGTAGCAGTAGCAGATAGG - Intergenic
1089609457 11:119661355-119661377 CAGCAGTGGCAGCAGCAGAGGGG + Exonic
1090075360 11:123577344-123577366 CTGCAGCGGCAGATGGAGAGAGG - Intronic
1090160022 11:124482744-124482766 GTGGAGAAGCAGAAGCAGAGGGG - Intergenic
1091061103 11:132462957-132462979 TTGCAGCAGCAGGTGCAGAGTGG - Intronic
1091111352 11:132971927-132971949 CAGCAGCAGTAGCAGCAGGGTGG - Intronic
1091111353 11:132971930-132971952 CGGCAGCAGCAGTAGCAGCAGGG - Intronic
1091174127 11:133544739-133544761 CTGGGGCTGCAGTAGCACAGAGG - Intergenic
1091703329 12:2678152-2678174 CTGCATTAGAAGTTGCAGAGTGG + Intronic
1092441420 12:8508490-8508512 CTGCAGTGGTAGTGGCAGAGGGG + Intergenic
1092579339 12:9821319-9821341 CTGCAGAGGCAGTGGCAGATGGG - Intergenic
1092587883 12:9919512-9919534 GTGCAGAGGCAGTGGCAGAGAGG + Intronic
1092597244 12:10021057-10021079 CTGGAGCAGGAGCAGGAGAGAGG - Intergenic
1093498086 12:19780058-19780080 CTGTAGCTGCAGAGGCAGAGGGG + Intergenic
1093690184 12:22101556-22101578 AGGCAGAAGCAGTGGCAGAGAGG - Intronic
1093690194 12:22101611-22101633 CTGCAGAGGCAGTGGCAGAGAGG + Intronic
1094388080 12:29917181-29917203 CTGCAGAACCAGAAGAAGAGTGG - Intergenic
1094523408 12:31216166-31216188 CAGAAGCAGCAGCAGCAGTGAGG - Intergenic
1095835908 12:46638351-46638373 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1096111728 12:49032778-49032800 CAGCAGCAACAGCAGCAGATGGG - Exonic
1096112854 12:49039519-49039541 CAGCAGCTGCAGGAGCAGTGGGG - Exonic
1097585481 12:61510695-61510717 CAGCAGCAGCAGGAGAAGAATGG + Intergenic
1098128474 12:67323560-67323582 CTGCAGAAGCAGTGGCAGAGAGG - Intergenic
1098465591 12:70783302-70783324 CTGCACAACCAGTAGCAGAGAGG - Intronic
1098632482 12:72740883-72740905 CTGCAGTAGCAGTGAGAGAGGGG - Intergenic
1098641131 12:72839418-72839440 CTGCTGTGGCAGTGGCAGAGGGG - Intergenic
1099719508 12:86342426-86342448 CTGCATAGGCAGTGGCAGAGAGG - Intronic
1099996167 12:89781396-89781418 TTGCAGCAGCAGTGTCAGATAGG + Intergenic
1100089630 12:90954375-90954397 GAGCAGCAGCAAAAGCAGAGAGG + Exonic
1101003649 12:100380786-100380808 CAGCAGTGGCAGTCGCAGAGTGG - Exonic
1101007436 12:100414903-100414925 CTGCAGCAGCAGCAGCTCTGGGG - Intronic
1101340895 12:103841189-103841211 GGGCAGCAGCAGTCGCAGAGCGG - Exonic
1101510590 12:105389291-105389313 CGGCAGCAGCAGCAACAGTGGGG - Intronic
1102510916 12:113414845-113414867 GTGCAGCAGGAACAGCAGAGAGG - Intronic
1102869094 12:116399478-116399500 CTGCAGCTGCAGAAGGAGAGTGG - Intergenic
1103074154 12:117968888-117968910 CAGCAGCAGCAGCAGCAGCGCGG - Intronic
1103209548 12:119156573-119156595 CAGCAGCAGCAGTAGCCGCTCGG + Exonic
1104846840 12:131851201-131851223 CGGCAGCAGCAGCAGCATGGTGG - Exonic
1105926266 13:25011563-25011585 CAGCAGGATCAGTATCAGAGAGG + Intergenic
1106308965 13:28535894-28535916 CTGGAGGACCAGCAGCAGAGAGG + Intergenic
1106393848 13:29361233-29361255 GTGTAGCTGTAGTAGCAGAGAGG - Intronic
1106443402 13:29801095-29801117 CTGCATCTGCAATGGCAGAGGGG - Intronic
1106500482 13:30323630-30323652 TTGCAGCAGCAGTAGGAGGAGGG + Intergenic
1106995557 13:35476295-35476317 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1107102568 13:36609908-36609930 CTGCACCAGCAGTGGCAGTATGG - Intergenic
1107175578 13:37394862-37394884 CTGCAGCTGCAGTGGGAGAGAGG - Intergenic
1107187997 13:37546769-37546791 CTGCAGCTGCAATGGCAGAAGGG + Intergenic
1107276712 13:38687427-38687449 CAGCAGCAGCAGCAGCAGCCGGG - Exonic
1107826439 13:44332727-44332749 AGGCAGCAGCAGCAGCAGGGAGG - Intergenic
1107868975 13:44729725-44729747 CTGCAGTTGCAGAGGCAGAGTGG + Intergenic
1107899255 13:44995822-44995844 CAGCAGCAGCAGCAGCAGCTGGG - Intronic
1108248643 13:48542764-48542786 CTGCGGCAGCATTTGCAGGGGGG - Intergenic
1108355493 13:49625656-49625678 CTGTAGAAGCATTAGCACAGTGG - Intergenic
1109093127 13:58073324-58073346 CTGTAGCAGGAGGAACAGAGAGG - Intergenic
1109476618 13:62887320-62887342 CATCAGCAGCAGTGGTAGAGTGG + Intergenic
1110035028 13:70672592-70672614 CTGCAGAGGCAGTGGCAAAGAGG + Intergenic
1110060636 13:71034061-71034083 CTGCAGTGGCAATGGCAGAGGGG - Intergenic
1110666363 13:78122163-78122185 CTGCCGCAGCAGAGGCAGATGGG - Intergenic
1110804156 13:79735793-79735815 CTGCAGCAACAGTGGAAGAAGGG + Intergenic
1111735590 13:92135050-92135072 CTGCAGCAGGAGAACCAGAGAGG - Intronic
1111756331 13:92400335-92400357 CTACAGCAACAGCAACAGAGGGG + Intronic
1113094199 13:106646460-106646482 CCTCAGCAGCAGATGCAGAGAGG + Intergenic
1113226931 13:108169257-108169279 CAGCAGAGGCAGTGGCAGAGAGG - Intergenic
1113301211 13:109021473-109021495 CAGCAGAAGCAGCAGCAGTGTGG + Intronic
1114183226 14:20382306-20382328 CTGCAGCAGCAGGGGGACAGTGG + Exonic
1114261896 14:21043021-21043043 CAGCAGCAGAAGCAGCAGAAGGG - Exonic
1114278707 14:21170278-21170300 CTGCAGAGGCACTGGCAGAGGGG - Intergenic
1114302756 14:21393136-21393158 CTGCAGTAGCAGAAGCTCAGGGG + Exonic
1114614402 14:24060614-24060636 CTGCAGCATCTGGAGCACAGTGG - Exonic
1114988888 14:28263358-28263380 CAGCAGAGGCAGTGGCAGAGAGG - Intergenic
1115058561 14:29162304-29162326 CAGCAGCAGCACCAGCAGAAGGG - Intergenic
1115942750 14:38627561-38627583 TTGCTGCAGCAGTAGCAGGTTGG - Intergenic
1116075739 14:40108487-40108509 CTGCAGGATAAGCAGCAGAGAGG - Intergenic
1116484730 14:45433975-45433997 CGGCAGCAGCAGCAGCAGCAGGG + Intergenic
1116725265 14:48554767-48554789 CAGCAGCAGCAGCAGCAGAGTGG - Intergenic
1117512868 14:56471140-56471162 CAGCAGTGGCAGTAGCAGTGGGG + Intergenic
1118666465 14:68075621-68075643 CTGCAGTGGCAGTGACAGAGGGG + Intronic
1118666529 14:68075896-68075918 CTGCAGCTGCAATGGCAGGGGGG + Intronic
1119395168 14:74320924-74320946 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
1119618567 14:76114493-76114515 CAGCAGCAGCAGAAGCAGCATGG + Intergenic
1119634664 14:76264194-76264216 TGGCAGCAGGAGCAGCAGAGAGG + Intergenic
1119788756 14:77330987-77331009 ATGCAGCAGGGGGAGCAGAGAGG - Intronic
1121020253 14:90575573-90575595 CTGCAGCACCAGTGGGAGGGGGG + Intronic
1121038360 14:90725334-90725356 CAACAGCAGCAGCAGCAGACAGG - Intronic
1121195847 14:92071009-92071031 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1121262631 14:92577515-92577537 CGGCAGCAGCAGCAGCAGAGAGG + Intronic
1122627770 14:103092912-103092934 CTGCAGCACCATCTGCAGAGGGG - Intergenic
1122738696 14:103858482-103858504 CAGCAGCATCAGCAGCACAGGGG - Intergenic
1123496808 15:20834639-20834661 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1123554040 15:21408231-21408253 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1123590287 15:21845596-21845618 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1123681831 15:22769243-22769265 CTGAAGCAGAAGGAGCAGATGGG - Intergenic
1123721375 15:23064553-23064575 CAGCAGCTGCAGCAGCACAGTGG - Intergenic
1123798098 15:23794015-23794037 CTGAAGAAGCAGTTTCAGAGGGG + Intergenic
1123877894 15:24642504-24642526 CTGCAGCTGCAATGGCAGAAGGG - Intergenic
1124179028 15:27456086-27456108 CTGCAGGACCAGAAGCAGTGCGG - Intronic
1124769470 15:32519076-32519098 CTGCAGCAGGAGAACGAGAGAGG + Intergenic
1125472335 15:40016405-40016427 CTGCAGGAGCAGGAGCACATGGG - Intronic
1125933958 15:43618681-43618703 CAGCAGCAGCAGCAGCAGCAGGG + Exonic
1125947055 15:43718143-43718165 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1126225212 15:46262116-46262138 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1126233410 15:46354176-46354198 CTGCAGCTGCAATGGCAGAGGGG - Intergenic
1126233472 15:46354454-46354476 CTGCCATAGCAATAGCAGAGGGG - Intergenic
1127098350 15:55535748-55535770 CAGCAGCAGTAGTGGCATAGTGG - Intergenic
1128134193 15:65250631-65250653 CTGCAGCAGTAGGAGAAGGGAGG - Intronic
1128203953 15:65833988-65834010 CTGCAGCAACAGCACCAGGGTGG - Intronic
1128374181 15:67064269-67064291 CTGCAGCAGCAGCTGCGGATTGG + Intronic
1128581636 15:68814519-68814541 GTGCAGCAGCAGCAGGAAAGAGG + Intronic
1128655144 15:69455265-69455287 CTGGAGCAGCAGCAGTGGAGGGG - Exonic
1128719751 15:69939760-69939782 TTGGGGCAGCAGCAGCAGAGAGG + Intergenic
1128767561 15:70260489-70260511 CTGCAGCAGCAGAATGAGTGTGG - Intergenic
1128809274 15:70558535-70558557 GTGGAGCAGCAGTAGGAGGGAGG - Intergenic
1129372488 15:75106245-75106267 CTGCAGCAGCAAGAGCAGAATGG + Intronic
1130040946 15:80404693-80404715 CCGCAGCATCAGCACCAGAGCGG + Intronic
1130881753 15:88061526-88061548 GAGCAGGAGCAGGAGCAGAGTGG + Intronic
1131032725 15:89199958-89199980 CCGAGGCAGCAGCAGCAGAGGGG - Exonic
1131192005 15:90324389-90324411 CTGCAGGAGCAGTTACAGAGCGG - Intergenic
1131509257 15:93040424-93040446 CTAGAGCAGCAGCAGCAAAGGGG - Intronic
1132032858 15:98452524-98452546 CTGCTGCAGCAGAGCCAGAGAGG + Intronic
1132087576 15:98920990-98921012 GCGCGGCAGCAGCAGCAGAGAGG - Intronic
1132445318 15:101912426-101912448 CTGTAGAGGCAGTGGCAGAGGGG + Intergenic
1202962388 15_KI270727v1_random:135427-135449 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1132610414 16:813327-813349 GTCCCGCAGCAATAGCAGAGGGG - Exonic
1132681309 16:1143190-1143212 TAGCAGCAGCAGTGGCAGTGAGG - Intergenic
1132712744 16:1276712-1276734 CAGCAGCAGCAGCAGCTGCGGGG + Intergenic
1133033843 16:3023913-3023935 CTGCAGCAGCCCTTGCAGCGAGG - Exonic
1133288418 16:4702102-4702124 CAGCAGCAGCAGCAGCAGTCGGG - Exonic
1133303317 16:4795951-4795973 CAGCAGCAGCAGGAGCAGCACGG - Exonic
1134143590 16:11742685-11742707 CGGCGGCAGCAGCAGCAGCGAGG - Exonic
1134852737 16:17494695-17494717 CTGGAGAAGCACTAACAGAGGGG + Intergenic
1136033867 16:27523812-27523834 TTCCAGCCGCAGCAGCAGAGAGG + Intronic
1136622153 16:31436398-31436420 CCGCAGCTGCAGCAGCAGAAGGG + Exonic
1137655305 16:50153771-50153793 CAGCAGCAGCAGCAGCAGCACGG + Exonic
1138004838 16:53323480-53323502 CTGCAGTAGCACTTGCAGATTGG - Intronic
1138895010 16:61193322-61193344 CTGAAATAACAGTAGCAGAGAGG - Intergenic
1139061893 16:63263238-63263260 CTGCAGTGGCAGTGGCAGAGGGG + Intergenic
1139347963 16:66316642-66316664 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1139392822 16:66615982-66616004 CAGGAGAAGCAGCAGCAGAGAGG + Exonic
1139459410 16:67109967-67109989 CTGCAGCAGCCGCGGCAGCGGGG - Exonic
1139512531 16:67435748-67435770 CTGCAGCAGCCTTAGGCGAGGGG - Exonic
1139734138 16:68972884-68972906 GAGCAGCAGCAGATGCAGAGGGG + Intronic
1139877285 16:70156502-70156524 CTCCTGCAGCAGAAGCAGAATGG + Exonic
1139968277 16:70757655-70757677 CTGCTGAAGCAGAAGCAGGGAGG + Intronic
1140392867 16:74603114-74603136 CAGCAGCAGCAGCAGCAGCCAGG + Intronic
1140820795 16:78661243-78661265 CTCCAGCAGCAGCAACAGAGAGG + Intronic
1141071138 16:80955324-80955346 CAGCAGCAGCAGCAGCGTAGTGG - Intergenic
1141128311 16:81416953-81416975 CGGCAGCAGCAGCAGCAGCTAGG + Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141894208 16:86948170-86948192 GAGCAGGAGCAGGAGCAGAGTGG - Intergenic
1141989612 16:87602573-87602595 CGGCAGCAGCAGCAGCAATGCGG - Intronic
1142226024 16:88877995-88878017 CTGCTGCTGCAGTGGCAGTGAGG - Intronic
1142592241 17:1011389-1011411 CTGAACCAGCAGGAGCAGGGAGG + Intronic
1143548503 17:7614568-7614590 CTGCAGCAGCAGTCTGAGTGCGG + Exonic
1144308596 17:13992067-13992089 CTGCAGTAGGAACAGCAGAGGGG + Intergenic
1144531654 17:16044861-16044883 CTGGAGCAGCAGCAGTGGAGTGG - Intronic
1144872866 17:18381397-18381419 CTGCAGCACCAGCAGGAGACGGG + Exonic
1145192097 17:20851890-20851912 CTGCTGCGGAAGGAGCAGAGGGG - Intronic
1145402318 17:22551923-22551945 CTGCTGCGGAAGGAGCAGAGGGG - Intergenic
1146588868 17:34110438-34110460 CTGAGGCAGCGGCAGCAGAGAGG - Intronic
1146751897 17:35389475-35389497 CTGCAGAGGCAGTGGCAGAGGGG + Intergenic
1146751947 17:35389754-35389776 CTGCTGTGGCAGTGGCAGAGGGG + Intergenic
1147262786 17:39218268-39218290 CAGCAGCAGCAGCAGCAGCGTGG + Intronic
1147403618 17:40195350-40195372 GTGCATCAGCAGTAGCAGGGAGG - Exonic
1148491217 17:48025083-48025105 CTGGCGCAGCACTAGCAGGGTGG + Intergenic
1148821946 17:50364945-50364967 CAGCAGCAGCAGCAGCAGGATGG - Intergenic
1149092542 17:52801464-52801486 CAGCAGTAGCAGTAGCAGATTGG - Intergenic
1149455736 17:56786586-56786608 TTGCTGGAGCAGTAGCTGAGAGG - Intergenic
1149634695 17:58157222-58157244 CGGCAGCAGCAGTAGCCGCAGGG - Intergenic
1150163994 17:62924117-62924139 CCACAGGAGCAGAAGCAGAGGGG - Intergenic
1150470915 17:65436920-65436942 CTGCAGCTGTAGTTGGAGAGAGG - Intergenic
1151139487 17:71977795-71977817 CTGCAGCAGCTGTACCAGACTGG + Intergenic
1151165811 17:72202839-72202861 CAGCAGCAGCAGCAGGAGTGAGG - Intergenic
1151474083 17:74335660-74335682 CTGGAGCTGCAGCAGCAGATGGG + Intronic
1151748382 17:76023602-76023624 CTGCAGCACCAGCAGGAGACGGG - Exonic
1152064443 17:78102708-78102730 CTCCAGCAGCGGCAGCAGATGGG + Intronic
1152092120 17:78252814-78252836 CTTCAGGAGCAGAAGCAGACTGG - Intergenic
1152248056 17:79196176-79196198 CTGGAGAAACAGCAGCAGAGTGG + Intronic
1153411966 18:4803277-4803299 CTGCAGCAGCAGGGCAAGAGTGG + Intergenic
1153763642 18:8354792-8354814 ATCCAGCAGCAGTAGAACAGTGG + Intronic
1154019271 18:10648242-10648264 CAGCAGCAGCAGCAGCATAGTGG - Intergenic
1154027324 18:10720831-10720853 GTGGAGCAGCAGTAGTAAAGAGG - Intronic
1154181363 18:12142487-12142509 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1154181651 18:12144151-12144173 CTGTAGAGGCAGTGGCAGAGAGG + Intergenic
1154182253 18:12147433-12147455 CTGTAGAGGCAGTGGCAGAGAGG - Intergenic
1154182541 18:12149097-12149119 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1154184947 18:12174982-12175004 CAGCAGTAGCAGCAGCATAGTGG + Intergenic
1154196565 18:12271540-12271562 TTACAGCAGCAGTAGGAGATGGG + Intronic
1154454711 18:14510323-14510345 CTGCAGAGGCAGTGGCAGAGAGG + Intronic
1155038374 18:22044322-22044344 CCCCAGCAGCAGTAGCAAATTGG - Intergenic
1155317978 18:24591192-24591214 CTCCAACAGCAGTAGTAGAGTGG + Intergenic
1155433369 18:25785615-25785637 CGGCATCAGCAGAGGCAGAGGGG - Intergenic
1155577016 18:27259270-27259292 CTGCAGAGGCAGTGGCAGAAAGG + Intergenic
1155708603 18:28847529-28847551 CTGCAGCAGCAGTGGCAGAGGGG - Intergenic
1155779388 18:29811786-29811808 CAGCAGCAGCAGTAGCACAGTGG - Intergenic
1155944225 18:31829514-31829536 CATAAGCAGCAGTTGCAGAGAGG + Exonic
1156294067 18:35774106-35774128 CAGAAGCTGCAGCAGCAGAGGGG - Intergenic
1156482530 18:37445229-37445251 CTGCAGAAGCGGGAGCAGAGGGG + Intronic
1156855064 18:41772293-41772315 ATGCAGCAGCAGTAGCAGCTGGG + Intergenic
1157357222 18:46946962-46946984 CCGCAGCAACAGTAGGAGAGGGG - Intronic
1157530583 18:48417241-48417263 CTGCAGCGTCAGGAGCAGATGGG - Intergenic
1158894601 18:61901173-61901195 CTGGAGCAGCAGGAGGGGAGGGG - Intergenic
1159120533 18:64163997-64164019 CTACATCAGCAGTAGCAGGAAGG + Intergenic
1159921072 18:74227822-74227844 CAGCAGCAGCAGCAGCAGAAAGG + Intergenic
1160047380 18:75399719-75399741 CAGCAGCAGCAGCAGCAAAAGGG - Intergenic
1160365257 18:78319225-78319247 CTGCAGAAGCAGGAGAAGAGAGG - Intergenic
1160377369 18:78423185-78423207 CAGCAGCAGCAATAGCAGGGGGG - Intergenic
1160570776 18:79816289-79816311 CTGCAGCAGCTGTAGTGGTGTGG + Intergenic
1160639991 19:121281-121303 CTGTAGAGGCAGTGGCAGAGGGG - Intergenic
1160866178 19:1257143-1257165 CAGCGACAGCAGTAGCAGCGGGG + Exonic
1161009973 19:1955294-1955316 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1161025253 19:2033831-2033853 CTGCAGCTGCAGTGGGAGGGAGG - Intronic
1161042747 19:2118692-2118714 CTGCAGCAGAAGGAGCAGGCCGG - Exonic
1161953838 19:7482212-7482234 CTGCAGGACCAGGAGCAGAGGGG + Intronic
1162333488 19:10045457-10045479 CTGCAGCAGTGGTAGCTGATGGG - Intergenic
1162461560 19:10816924-10816946 CTGGAGCAGCAGTGGGAGAAGGG + Intronic
1162481105 19:10927682-10927704 CAGCAGCAGCAGCAGCAGCCGGG - Exonic
1163442956 19:17330745-17330767 CTGCAGGAGCAAAGGCAGAGAGG - Intronic
1163612769 19:18309704-18309726 CAGCAGCAGAAGCAGCAGAAAGG - Exonic
1164495291 19:28754820-28754842 GTGCACCAGCAGTGGCAGGGTGG - Intergenic
1164976064 19:32573629-32573651 GCACAGCAGCAGCAGCAGAGGGG - Intergenic
1165452258 19:35890416-35890438 CAGCAGCAGCTGAACCAGAGTGG + Exonic
1165861628 19:38912117-38912139 CCGCAGCAGCAGCAGCTCAGAGG + Exonic
1166364856 19:42273133-42273155 CGGCAGCCGCAGCAGCAGCGTGG + Intronic
1166748339 19:45152509-45152531 CTGCAGCAGCAGCAGCAGCAGGG - Exonic
1166911695 19:46163617-46163639 CTGCAGAGGCAGTGGCAGAGGGG + Intergenic
1166944739 19:46390028-46390050 CTGCAGGGACAGGAGCAGAGTGG - Intronic
1167285900 19:48598901-48598923 CTGCAGTAGCAGAGGCAGTGAGG + Intronic
1167341992 19:48921854-48921876 CAGCAGCAGCAGCAGCAGCAAGG + Exonic
1167365106 19:49050665-49050687 CTGCAGCAGGAAGACCAGAGGGG + Intergenic
1167367356 19:49061809-49061831 CTCCAGCAGGAAGAGCAGAGGGG + Exonic
1167435362 19:49475692-49475714 CAGCAGCAGCAGGAGGAGATAGG - Exonic
1167436226 19:49480367-49480389 CAGCAGTAGGAGGAGCAGAGGGG - Exonic
1167443681 19:49525045-49525067 CAGCAGCAGCAGCAGCAGGATGG - Intronic
1167617215 19:50541932-50541954 TAGCAGCAACAGCAGCAGAGTGG + Intronic
1167771889 19:51525863-51525885 CTGCAGCAGCAATGGCAGAGGGG - Intronic
1168269163 19:55240292-55240314 CTGCAGCAGCTGCGGGAGAGCGG + Exonic
925339523 2:3126515-3126537 CTCAACCAGCAGCAGCAGAGGGG + Intergenic
925390000 2:3488124-3488146 CTGCTGCTGCAGTAGCTGTGTGG - Intergenic
925592727 2:5526355-5526377 GTACAGCAGCAGTAGCAGACCGG - Intergenic
925646830 2:6044666-6044688 CTGCAGCTGCAGTGGTGGAGGGG - Intergenic
925646945 2:6045223-6045245 CTGCAGAGGCAGTGGCAGAGGGG - Intergenic
926115762 2:10212260-10212282 CAGCAGCAGCAGCAGCAGAAGGG - Intergenic
926201481 2:10802765-10802787 CTGCAGCAGGAAGGGCAGAGGGG - Intronic
926801495 2:16664614-16664636 CTGGGGCAGCAGGAGGAGAGTGG - Intronic
927181001 2:20446850-20446872 CCGCAGCGGCAGCAGCAGCGCGG + Intergenic
927217735 2:20677968-20677990 CAGCAGCAGCAGCAGCAGCTGGG + Intergenic
927275959 2:21262695-21262717 CCGCAGCAGCAGGACAAGAGGGG + Intergenic
927400342 2:22703697-22703719 CAGCAGCAGCAGTGGCAGTGGGG - Intergenic
927744644 2:25606384-25606406 CTGCTACAGCACTAGCACAGGGG + Intronic
927875111 2:26650099-26650121 CTGCAGAATGAGCAGCAGAGAGG + Intergenic
928097269 2:28412379-28412401 CCGCAGAAGCAGTAGCAGCGGGG + Exonic
928391470 2:30914054-30914076 CAGCAGCAGCAGCAGCAGCCTGG - Intronic
928398181 2:30959097-30959119 CAGCGGCAGCAGCAGGAGAGAGG - Intronic
928647542 2:33370480-33370502 CAGCAGCAGCAGCAGCAGCTTGG - Intronic
928865616 2:35914307-35914329 CAGCAGCAGCAGTAGCAAGAGGG - Intergenic
929590562 2:43143061-43143083 CAGCAGCAGCAGCAGGAGGGAGG - Intergenic
929604195 2:43224599-43224621 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
929604360 2:43225373-43225395 CTGCAGCAGCAGCAGAAGGGGGG - Exonic
929607053 2:43241695-43241717 CAGCAGCTGCTGGAGCAGAGCGG + Intronic
929998480 2:46845186-46845208 ATGGAGCAGCAGTTGAAGAGAGG + Intronic
930096428 2:47570252-47570274 CAGCAGCAGCAGCAGCAGGAGGG + Exonic
930229447 2:48828048-48828070 CTGCAGAGGCAGTGGTAGAGAGG - Intergenic
930304824 2:49665231-49665253 CCGCAGAAGCAGTGGCAGAGGGG + Intergenic
930839147 2:55826134-55826156 CTGCAGTGGCAGTGGCAGAGGGG - Intergenic
931543390 2:63354035-63354057 CTGTAGAGGCAGTGGCAGAGAGG - Intronic
931889971 2:66661351-66661373 CAGCAGCTGCAGTGGCAGTGAGG + Intergenic
931909895 2:66887820-66887842 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
932083751 2:68739092-68739114 CTTCTGCAGCAGCAGCAGAGTGG + Intronic
932558524 2:72846832-72846854 CTGGTGTAGCAGGAGCAGAGAGG + Intergenic
932586913 2:73036241-73036263 CTGCAGACACAGGAGCAGAGGGG - Intronic
932819556 2:74887795-74887817 GTGCATCAGCAGTGGCAGACAGG - Intronic
933080256 2:77976842-77976864 CTGAAGCTGCAATGGCAGAGGGG - Intergenic
933336322 2:80964198-80964220 CAGCAGCAGCAGCAGCATGGTGG + Intergenic
933484193 2:82897144-82897166 CTTCAGTGGCAGTGGCAGAGGGG - Intergenic
933707452 2:85302629-85302651 CTGCAGCAGCACTGCCTGAGTGG - Intronic
933764487 2:85697483-85697505 CTGCAGCAGCAGCACCACAGTGG - Intronic
934033422 2:88067685-88067707 CTCCAGGAAAAGTAGCAGAGGGG + Intergenic
934623213 2:95829035-95829057 CTGCAGAAGCAGTGGCAGAGAGG + Intergenic
934681215 2:96285234-96285256 CTGCAGCAGCATTCGCAGGATGG + Exonic
934770425 2:96904199-96904221 CAGCAGCAGCAACAGCACAGTGG + Intronic
934810553 2:97273058-97273080 CTGCAGAAGCAGTGGCAGAGAGG - Intergenic
934827139 2:97434881-97434903 CTGCAGAAGCAGTGGCAGAGAGG + Intergenic
935823215 2:106915137-106915159 TTGAAGCATCAGTAGCAGATAGG + Intergenic
935834671 2:107037365-107037387 CAGCAGATGCAGTAGCAGAGAGG - Intergenic
935848116 2:107188213-107188235 CAGCAGCAGCAGTAACAGCACGG - Intergenic
935852816 2:107241726-107241748 GAGCAGCAGCAGCAGCAGACAGG + Intergenic
936572472 2:113627955-113627977 GTGCAGAAGCAGTAGCTGTGTGG + Intronic
937024073 2:118682873-118682895 CAGCAGCAGCAGCAGCACAGAGG - Intergenic
937379637 2:121365112-121365134 CTCCAGCAGCAGGAGCAGAATGG + Exonic
937397192 2:121547260-121547282 CCGCAGCGGCAGTGGCAGAGAGG - Intronic
937521007 2:122712255-122712277 CTGCAGAGGCAGTGACAGAGAGG - Intergenic
938194123 2:129311088-129311110 ATGCTGCAGTAGTAGTAGAGGGG + Intergenic
938282181 2:130072241-130072263 CTGCAGAGGCAGTGGCAGAAAGG + Intergenic
938332808 2:130460813-130460835 CTGCAGAGGCAGTGGCAGAAAGG + Exonic
938357000 2:130659858-130659880 CTGCAGAGGCAGTGGCAGAAAGG - Intergenic
938433436 2:131266664-131266686 CTGCAGAGGCAGTGGCAGAAAGG - Intronic
938477477 2:131629247-131629269 CTGCAGAGGCAGTGGCAGAAAGG - Intergenic
939215702 2:139235760-139235782 CTGCAGCAGTAATAACAGAAAGG - Intergenic
939244934 2:139610726-139610748 CCCCAGCAGCAGCAGCAGTGTGG - Intergenic
939666625 2:144960703-144960725 CTGCAGCAGTTGAAGCATAGAGG + Intergenic
940446697 2:153785566-153785588 CTGCAGTGGCAGTGGCAGAGGGG + Intergenic
940446918 2:153786757-153786779 CTGCAGTGGCAGTGGCAGAGGGG - Intergenic
940531708 2:154886335-154886357 CAGCAGCTGCAGTAGCACAGTGG + Intergenic
940859846 2:158760342-158760364 CAACAGAGGCAGTAGCAGAGGGG + Intergenic
941253665 2:163200067-163200089 CTACTGCACCAGTTGCAGAGAGG - Intergenic
941264140 2:163338524-163338546 CAGCAGCAGCAGCAGCAGTACGG + Intergenic
941527892 2:166628799-166628821 CTGCTGTGGCAGTGGCAGAGGGG + Intergenic
941933238 2:170963422-170963444 CAGCAGCAGCAGTAGCAGCGGGG - Intronic
942241035 2:173964439-173964461 CTGCAGCAGCAGCAACAGCACGG - Exonic
942465227 2:176200988-176201010 CTGGAGCAGCAGCAGTGGAGGGG + Intergenic
943611893 2:190044516-190044538 CTGCAGAGGCAGTAGCAAAGAGG + Intronic
943718915 2:191182437-191182459 CTGCAGCTGCAGTAGATAAGAGG + Intergenic
944471221 2:200055449-200055471 CTGCAGCTGCAATGGCAGAGGGG - Intergenic
944471301 2:200055930-200055952 CTGCAGCAGCAGTGGCAGAGGGG - Intergenic
945016295 2:205520420-205520442 CTGCAGAGGCAGTGGCAGAGAGG + Intronic
945019572 2:205557440-205557462 CTGCAGGAGCAGAAGTTGAGGGG - Intronic
945357425 2:208856762-208856784 CTGCAGCAGCAGTAGCAGAGGGG + Intergenic
946306089 2:218857850-218857872 CTGCAATAACAGTAGCAGGGTGG + Intergenic
946644707 2:221820559-221820581 CCACAGCAGCAGTAGCTCAGGGG - Intergenic
946939763 2:224758534-224758556 TTGTAGCAGCAGTAGCAGGTGGG + Intergenic
946977060 2:225164719-225164741 CAGCAGCAGCAGCAGCAGCAAGG - Intergenic
947118379 2:226795330-226795352 CGGTAGCAGCAGCAGCAGCGAGG - Exonic
947905722 2:233760426-233760448 ATCCAGCAGCTGCAGCAGAGGGG + Exonic
947914697 2:233823637-233823659 CTGCCGCATCAGCAGCACAGCGG + Exonic
948450819 2:238070096-238070118 CTGCAGCAGCAGTGGCCTTGTGG + Intronic
948674153 2:239587369-239587391 CTGCGGGGGCAATAGCAGAGAGG + Intergenic
948992760 2:241563151-241563173 CGGGAGCAGCAGGAGCAGGGAGG - Intronic
949070318 2:242020560-242020582 CTGCAGCTGCAGACCCAGAGAGG + Intergenic
1170086256 20:12535573-12535595 CTGCAGCTGCTGTGGCAGATGGG - Intergenic
1170629729 20:18056791-18056813 CGGCAGCGGCAGCAGCAGCGCGG - Exonic
1170792966 20:19522726-19522748 CAGCAACACCAGTTGCAGAGAGG - Intronic
1170853224 20:20022963-20022985 CGGCAGCAGAAACAGCAGAGGGG + Intronic
1171265529 20:23769052-23769074 CTGCAGCATCATGAACAGAGAGG + Intergenic
1172167636 20:32908611-32908633 CAGCAGCAGCAGCTGCAGAGAGG - Intronic
1172399775 20:34639939-34639961 CTGCAGCAGTGGTAGCAGGAAGG + Intronic
1173179746 20:40796825-40796847 GGGCAGGAGCAGCAGCAGAGTGG - Intergenic
1173282889 20:41645056-41645078 CAGCAGCAGCAGTAGCTATGGGG + Intergenic
1173366575 20:42391285-42391307 CTTCAGCAGCAAGAGAAGAGGGG + Intronic
1173855997 20:46251220-46251242 CAGCAGCAGCAGCAGTAGCGCGG + Exonic
1173856000 20:46251223-46251245 CAGCAGCAGCAGTAGCGCGGGGG + Exonic
1174882166 20:54291869-54291891 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1174929203 20:54794503-54794525 CTGCAGCTGCAATGGCAGAGGGG + Intergenic
1175116132 20:56683811-56683833 CTGGAGCAGAAGCAGCAGAGAGG + Intergenic
1175166058 20:57045480-57045502 CTGCAGCATCAGCAGCATCGGGG + Intergenic
1175582665 20:60112616-60112638 CAGCATCAGCAGCAGCACAGTGG + Intergenic
1175715950 20:61253920-61253942 CTGAAGGAGCAGGAGCACAGCGG - Intronic
1176008986 20:62881693-62881715 CTGAAGCAGCTGCAGCCGAGCGG - Exonic
1176409699 21:6441950-6441972 GTCCAGCAGCAGTAGGACAGAGG - Intergenic
1176709462 21:10136839-10136861 CTCCAGCAGCAGTAGCGGCAGGG - Intergenic
1176819453 21:13642985-13643007 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1177237569 21:18412722-18412744 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1178854605 21:36239881-36239903 CTGCAGCAGCAGCAGGAGCACGG - Exonic
1179085106 21:38209182-38209204 CTGGAGCAGCAGGAGCAAAGGGG + Intronic
1179439056 21:41380544-41380566 CTGCAGCAGCATTTCCAAAGGGG - Intronic
1179685192 21:43050272-43050294 GTCCAGCAGCAGTAGGACAGAGG - Intergenic
1180032836 21:45224030-45224052 CTGCACCTGCAGAAGGAGAGGGG + Exonic
1180151056 21:45948122-45948144 CTGCAGCAGCCTCAGGAGAGGGG - Intergenic
1180863896 22:19104881-19104903 AAGCAGCAGCAGCAGCAGAGGGG + Intronic
1180962701 22:19769349-19769371 CAGCAGCAACAGCAGCAGTGTGG - Intronic
1181145117 22:20840301-20840323 CTGCTGCTGCAGCAGCACAGTGG + Intronic
1181493945 22:23277510-23277532 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1181569940 22:23763116-23763138 CTGAAGCAGCAGAACCACAGAGG + Exonic
1182123130 22:27799612-27799634 CAGCAGCAGCAGCAGCAGCATGG - Exonic
1182393607 22:30019698-30019720 TTGCAGCCGGAGTAGCTGAGGGG + Exonic
1182445116 22:30385496-30385518 CAGCAGCAGCAGTGGCAACGGGG + Intronic
1182460747 22:30481882-30481904 CAGCAGCAGCAGGAGCAGGAGGG + Intergenic
1182467467 22:30526161-30526183 CTGCAGGGGCAGTAAGAGAGGGG - Intronic
1182556989 22:31134485-31134507 CTGGAGGAGCAGCAGGAGAGAGG - Exonic
1182752334 22:32651717-32651739 TTGCAGCATCAGTAGCAGTTTGG - Intronic
1183161249 22:36114794-36114816 CTGCAGCAGGTGCAGCAGAAGGG - Intergenic
1183271453 22:36865081-36865103 CTGCAGCAGCAGGACGGGAGTGG - Intronic
1183327606 22:37202943-37202965 CAGCATCAGCATTATCAGAGGGG - Intergenic
1183544861 22:38450020-38450042 CTGCAGCGTCACAAGCAGAGGGG + Intronic
1183599618 22:38832364-38832386 CTGCCCCAGCAGGAGCTGAGTGG - Intronic
1184301546 22:43563659-43563681 CACCAGCAGCAGCAGCAGCGCGG - Intronic
1184322844 22:43756306-43756328 GTGCTGCAGCTGCAGCAGAGAGG - Intronic
1184925290 22:47632204-47632226 CAGCAGCAGCAGCAGCAGCCCGG + Intergenic
1184933727 22:47702252-47702274 CAGCAGCAGCAGCAGCGGGGTGG - Intergenic
1184933728 22:47702255-47702277 CAGCAGCAGCAGCAGCAGCGGGG - Intergenic
1185236462 22:49716420-49716442 TTGCAGCACCAGCAGCAGCGAGG - Intergenic
1185251535 22:49804237-49804259 CTGCAGCCGCCGCAGCAGGGGGG + Exonic
1185305492 22:50113112-50113134 CTGTAGCATCAGTAGAAGAAGGG + Intronic
1185313974 22:50170843-50170865 CTTCAGCTGCAGAAGCAGCGCGG - Exonic
1185427715 22:50782924-50782946 GTGCAGAAGCAGTAGCTGTGTGG - Exonic
949376867 3:3400565-3400587 TGGCAGCAGCAGTGGCAGTGGGG + Intergenic
949436806 3:4038455-4038477 CTACAGAGGCAGTAGCAGAGTGG + Intronic
949847120 3:8383039-8383061 CTGTAGCAGGAGTGGCAGAGAGG + Intergenic
950601005 3:14035470-14035492 CTGCAGAAGCAGTGGCAGAAAGG + Intronic
950915246 3:16637885-16637907 CTTTGGCAGAAGTAGCAGAGAGG + Intronic
951197064 3:19836196-19836218 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
951268910 3:20602110-20602132 TTGCAGCAGCAATAACAAAGGGG + Intergenic
951283412 3:20780011-20780033 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
952644648 3:35640087-35640109 CAGCAGCAGCAGGGGCAGCGGGG + Intronic
952841811 3:37652938-37652960 CAGCAGCAGCATTTGGAGAGGGG - Intronic
954486766 3:50860288-50860310 TTGCAGAAGCAGTGCCAGAGAGG + Intronic
954498663 3:50988933-50988955 CTGCAGAAACAGTGCCAGAGAGG - Intronic
954809346 3:53238554-53238576 CTGCAGCAGAAGTGCCATAGTGG - Intronic
955778805 3:62462242-62462264 CTTCAGCAGCAGTAGCAGCCTGG - Intronic
955864944 3:63372395-63372417 CTGCAGTGGCAGTGGCAGAGGGG - Intronic
956193467 3:66629571-66629593 TTGCTGCAGCAGCAGCAGCGGGG + Intergenic
956193468 3:66629574-66629596 CTGCAGCAGCAGCAGCGGGGAGG + Intergenic
956609145 3:71104395-71104417 CAGCAGCAACAGCAGCAGAAGGG - Intronic
958460099 3:94383647-94383669 GTGCAGCAGCAGTGGGACAGTGG - Intergenic
958678599 3:97296618-97296640 CAGCAGCAGCAGTGGCAGTGAGG + Intronic
959094462 3:101938584-101938606 CTACAGCAGCAGGGTCAGAGGGG - Intergenic
959291086 3:104475133-104475155 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
959520202 3:107316601-107316623 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
959950400 3:112174741-112174763 CTGCAACTGTAGTAGCAGAGGGG + Intronic
960688145 3:120314231-120314253 CAGCAGCAGCAGCAGCATGGTGG - Intergenic
960688146 3:120314234-120314256 CTGCAGCAGCAGCAGCAGCATGG - Intergenic
960841572 3:121963896-121963918 CTGCAGAAGCAGTGACAGAGAGG - Intergenic
961410776 3:126718799-126718821 CTGCACCAACAGAACCAGAGGGG - Intronic
962230575 3:133661994-133662016 CGGCAGCTGCAGCAGAAGAGCGG + Intergenic
963053027 3:141158502-141158524 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
963082276 3:141404924-141404946 CTTCTCCAGCAGTTGCAGAGTGG + Intronic
963286661 3:143440300-143440322 CTCAAGCAGCATTAGCACAGTGG - Intronic
963809991 3:149766862-149766884 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
964848710 3:161070765-161070787 CTACAGCAGCAGGAGGGGAGAGG - Exonic
965113065 3:164451698-164451720 CTACAGGAACAGTGGCAGAGGGG + Intergenic
965317809 3:167212400-167212422 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
965811025 3:172592039-172592061 CTACAGAGGCAGTGGCAGAGAGG + Intergenic
966152355 3:176878133-176878155 CTGCACAGGCAGTGGCAGAGGGG - Intergenic
966361820 3:179137803-179137825 CTTCAGCTGCAGTGGCAGAGTGG - Intergenic
966448178 3:180027116-180027138 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
966470343 3:180282084-180282106 CAGCAGAAGTAGTAGCTGAGGGG + Intergenic
966875977 3:184321895-184321917 CCGTAGCTGGAGTAGCAGAGGGG - Exonic
967170578 3:186820203-186820225 AGGCAGCAGCAGTAGCATGGTGG + Intergenic
967570893 3:191027160-191027182 CTGAAGTGGCAGTAGCAGACAGG - Intergenic
967659603 3:192090707-192090729 CAGCAGCTGCAGCAGCACAGTGG - Intergenic
968811527 4:2801569-2801591 CTGCTGCAGCCCCAGCAGAGGGG + Intronic
968946247 4:3665951-3665973 CTGGAGCTGCAGGAGCACAGAGG + Intergenic
968961953 4:3750171-3750193 CTGCAGCAGCAGGGACAGAAGGG + Intergenic
969222162 4:5768074-5768096 TTGCAGCAGCAGCAGCAGTGAGG + Intronic
969481915 4:7451282-7451304 CAGCAGCAGCAGCGGCAGTGGGG + Intronic
969569189 4:7998614-7998636 CTGCAGCCACACTAGCAGATGGG - Intronic
970180274 4:13384367-13384389 CAGCAGCAGCAGCAGCACGGTGG - Intronic
970180275 4:13384370-13384392 CAGCAGCAGCAGCAGCAGCACGG - Intronic
970539152 4:17060019-17060041 CTGGAGCAGCAGTGGCATACAGG + Intergenic
971106013 4:23524807-23524829 CTGCAGAGGCAGTGGCAAAGAGG - Intergenic
971195421 4:24468888-24468910 CTGCAACATCAGTAGCAGGCAGG - Intergenic
971605311 4:28651224-28651246 CTGCAGAGGCAGTGACAGAGGGG + Intergenic
972083432 4:35182708-35182730 CAGCAGCAGCAGTAGCAGTGTGG - Intergenic
972125529 4:35760621-35760643 CTGCAGCAGCACTGGCAGAGGGG - Intergenic
972828355 4:42786965-42786987 CTGCAGCAGCAATGGCAGAAGGG + Intergenic
973306689 4:48659986-48660008 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
973916078 4:55636112-55636134 CAGCAGCAGCAGCAGGAGCGGGG + Exonic
974184602 4:58430231-58430253 CTGCAGAGGCAGTGACAGAGAGG + Intergenic
974985940 4:69026272-69026294 CTGCAGATGCAGTGGCTGAGAGG + Intronic
975059418 4:69978798-69978820 CTGCAGCGGCATTGGCAGAGAGG + Intergenic
975106174 4:70571531-70571553 TTGCAGAGGCAGTGGCAGAGAGG + Intergenic
975389814 4:73802897-73802919 CTGTAGCAGCAGTGGAAAAGGGG - Intergenic
975404127 4:73969366-73969388 CTGCAGTGGCAGTGGTAGAGGGG - Intergenic
975511117 4:75194415-75194437 CAGCGGCAGCAGTGGCAGTGTGG - Intergenic
975844813 4:78513993-78514015 CTCCAGAAGCAGGAGCTGAGAGG + Intronic
976122922 4:81802592-81802614 TTGCAGCTGCAGTAGCAGCAGGG + Intronic
976481897 4:85555991-85556013 CTGCAATGGCAGTGGCAGAGGGG + Intronic
976954662 4:90880556-90880578 CTGCAGAGGCAGTGGCAGAGAGG + Intronic
977006268 4:91571997-91572019 CAGCAGAGGCAGTGGCAGAGAGG + Intronic
977819853 4:101458734-101458756 CTGCAGAGGCACTGGCAGAGAGG - Intronic
977971440 4:103218283-103218305 CTGCAACTGCAGTGGCAGAGGGG - Intergenic
978208243 4:106105063-106105085 CTGCAGAGACAGTGGCAGAGAGG - Intronic
978271274 4:106893461-106893483 CTGCAGCTGCAATGGCAGAGGGG - Intergenic
978318981 4:107472292-107472314 CTGAAGCATCAATAACAGAGAGG + Intergenic
978608103 4:110504400-110504422 TTGCAGCAGCCATGGCAGAGGGG + Intronic
978683730 4:111414802-111414824 ATGCAGAGGCAGTGGCAGAGAGG + Intergenic
979013098 4:115396199-115396221 CTGCAGAGGAAGTGGCAGAGAGG + Intergenic
979400107 4:120238724-120238746 CTTCAGTAGCAGTAGTACAGAGG + Intergenic
979671717 4:123366607-123366629 CTAGAGCAGCAGCAGCAGAGAGG + Intergenic
979975472 4:127190732-127190754 CTGCAGTAGCAGCAGCAGCTGGG + Intergenic
980027119 4:127781014-127781036 CTACAGCAGCAGCAGCAGCAAGG - Intergenic
980237822 4:130131641-130131663 CTGCAGCTGCTATAGCGGAGAGG - Intergenic
980792028 4:137632454-137632476 CAGCAGCAGCAGCAGCATGGGGG - Intergenic
980888899 4:138793224-138793246 CTGCAGCAGGAGGAAGAGAGAGG - Intergenic
980970074 4:139559304-139559326 CAGCAGCAGCAGAAGTAGTGTGG + Intronic
981337229 4:143581298-143581320 CTGCAGCTGCAATGGCAGAGAGG - Intronic
981337279 4:143581569-143581591 CTGCAGTGGCAGTGGCAGAGGGG - Intronic
981511962 4:145567021-145567043 CAGCAGCAGCAGCAGCATGGCGG - Intergenic
981511963 4:145567024-145567046 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
981600360 4:146481400-146481422 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
981915349 4:150026987-150027009 CTGCATCAGCAGTGGCAAAAGGG + Intergenic
982265321 4:153533369-153533391 CTGCAGCAGCAGTGGCGGAGGGG + Intronic
982601583 4:157457942-157457964 CTTCAGCAGAACTGGCAGAGAGG - Intergenic
982646211 4:158027422-158027444 CTGCAGAGACAGTGGCAGAGAGG - Intergenic
983075862 4:163325898-163325920 CTGCAGCACCAAGAGGAGAGTGG + Exonic
983628446 4:169826353-169826375 CTGCAGTGGTAGTGGCAGAGGGG - Intergenic
984465953 4:180100776-180100798 TTGCAGTAGCGGTGGCAGAGTGG + Intergenic
984592755 4:181635141-181635163 CTGCATCAGCAGCAGAAGGGAGG + Intergenic
985561905 5:592242-592264 CTGCAGCTGCTGTAGGAGATGGG + Intergenic
985607910 5:868535-868557 CTCCAACAACAGGAGCAGAGTGG + Intronic
985741926 5:1622864-1622886 TTGCAGCTGCAGTTCCAGAGAGG - Intergenic
986284099 5:6347349-6347371 CTGGAGCTGCCGCAGCAGAGAGG - Intergenic
986290665 5:6396725-6396747 CTCCAGCAGCGGGAGCAGGGAGG + Intergenic
986392666 5:7300591-7300613 CTGAAGCAGAAGAAGCAGATGGG - Intergenic
987518489 5:18947144-18947166 CTGCAGTGGCAGTAGCAGATTGG - Intergenic
987644329 5:20648929-20648951 CTGCAGAGGCAGTGGCAGAGGGG - Intergenic
987674824 5:21061902-21061924 CTGCAGAGACAGTAGCAAAGAGG + Intergenic
988652362 5:33166740-33166762 CTTCAGCTGCAGTAGTATAGGGG + Intergenic
988936014 5:36083490-36083512 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
989068921 5:37490294-37490316 TTGCAGCAGCAGTAGTAGGCAGG + Intronic
989370325 5:40700368-40700390 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
989461818 5:41708498-41708520 CTGCAGCAACAGTGGCAGAGAGG - Intergenic
989461831 5:41708552-41708574 CTTCAGTGGCAGTGGCAGAGGGG + Intergenic
990876687 5:60494308-60494330 CTGTAGCTGCACCAGCAGAGGGG - Intronic
991654257 5:68887278-68887300 CAGCAGCAGCAGTAGCTGCAAGG + Intergenic
992146723 5:73858055-73858077 CAGCAGCAGCAGTAGGAAAGTGG - Intronic
993013308 5:82508504-82508526 GAGCAGCAGCAGTAGAAGACAGG - Intergenic
993018681 5:82564631-82564653 CTGCAGATACAGTGGCAGAGAGG - Intergenic
993138722 5:84003019-84003041 CTACAACAGCAGTGGCAGAGGGG - Intronic
993351261 5:86853238-86853260 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
993429490 5:87814240-87814262 GTGCACCAGCAGTAGCTGGGTGG - Intergenic
993450847 5:88070517-88070539 CTGCAGAAGTAGTGGCAGAGAGG - Intergenic
993634346 5:90326090-90326112 CTGCAGTGGCAATGGCAGAGGGG + Intergenic
993794532 5:92249845-92249867 CTGCTGTGGGAGTAGCAGAGGGG - Intergenic
994145083 5:96385712-96385734 ATGGAGCAGAAGGAGCAGAGTGG + Intergenic
994473414 5:100238433-100238455 CTGCAGAAGCAGTAGCAGAGAGG + Intergenic
994644407 5:102450937-102450959 CTACAGCAGCAAGGGCAGAGGGG + Intronic
994793827 5:104267555-104267577 CAGCAGCAGCTCTAGCTGAGGGG + Intergenic
994897306 5:105722151-105722173 CTGCAGAGGCAGTGGTAGAGAGG - Intergenic
995068440 5:107889755-107889777 CTTAAGCAGCAGCAGCAGCGAGG + Intronic
995187829 5:109290258-109290280 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
995253410 5:110019148-110019170 CTGCAGTGGCAGTGGCAGAGGGG - Intergenic
995428671 5:112050582-112050604 CTGCAGAGGGTGTAGCAGAGAGG - Intergenic
995744932 5:115393464-115393486 CAGCACAACCAGTAGCAGAGAGG - Intergenic
996167011 5:120236611-120236633 TTCCAGCAGCAGCAGCAGCGTGG + Intergenic
996552308 5:124743863-124743885 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
996708780 5:126523547-126523569 CTCCAGCCTGAGTAGCAGAGCGG - Intergenic
996720762 5:126628094-126628116 CTGAAGCAGCAGCAGTGGAGGGG + Intergenic
997659513 5:135578740-135578762 CAGCAGCAGCAGGAGCAGCGCGG + Exonic
997980707 5:138465944-138465966 CAGCAGCAGCAGCAGCAGCGGGG + Exonic
998043758 5:138970135-138970157 TTGCAGAAGCAGAGGCAGAGAGG + Intronic
998141530 5:139702274-139702296 CTGGAGCAGAAGGAGCAGGGAGG - Intergenic
999052172 5:148534544-148534566 CTGCAGAAGCAGTGGCAGAGAGG - Intronic
999394452 5:151218298-151218320 CTGCAGCAGGACTGGCAGTGGGG - Intronic
999448420 5:151659850-151659872 CTGCAGCAGGAGTGGGAGGGAGG + Intergenic
999542070 5:152584788-152584810 CTGCAGCTGCAGTGGCAGAGGGG + Intergenic
999811890 5:155135431-155135453 CTGAAGCATCTGTATCAGAGAGG + Intergenic
1000003274 5:157160301-157160323 CTGCAGCAGCAGTACCTTGGAGG - Intronic
1000031683 5:157407129-157407151 CTGCAGAGGCAGTGACAGAGAGG - Intronic
1000698796 5:164422215-164422237 CTGCAGCAGCAGGGGCACAGGGG + Intergenic
1001135282 5:169097699-169097721 GCGCAGCAGCAGTAGCAGGAGGG + Intronic
1001234413 5:170017452-170017474 ATGCATCAGAAGTAGCAGATAGG - Intronic
1002021192 5:176365477-176365499 CGGCCGCAGCAGTCGCAGCGGGG + Exonic
1002455906 5:179345266-179345288 CAGCAGCAGCAGCAGCAGCGCGG + Exonic
1002660460 5:180788026-180788048 ATGCAGCAGCAGCAGCAGCCAGG + Intergenic
1002747341 6:69688-69710 CTGTAGAGGCAGTGGCAGAGGGG - Intergenic
1002783171 6:382489-382511 CTTAAGCAGCCGTTGCAGAGAGG - Intergenic
1003097785 6:3156305-3156327 CTGCAGCAGCCGCTGCTGAGGGG + Intronic
1003592890 6:7450474-7450496 CAGCAGCAGCAGCAGGAGAAAGG + Intergenic
1004330583 6:14717024-14717046 CTGCAGCAGCTGAAGCAGCCAGG + Intergenic
1004496764 6:16171610-16171632 CTGTAGCAGCAGTAAAATAGAGG + Intergenic
1005948313 6:30611664-30611686 GAGCAGCAGCAGAAGCAGGGAGG + Intronic
1005950046 6:30625255-30625277 CTGCATCTGCCCTAGCAGAGGGG - Intronic
1006399388 6:33807734-33807756 ATGCAGCAGCCGAGGCAGAGGGG + Intergenic
1006421256 6:33935540-33935562 CTGCAGGGGCGGGAGCAGAGGGG + Intergenic
1006750212 6:36372305-36372327 CTGGAGCAGCAGGAGCACGGGGG + Intronic
1007268075 6:40612215-40612237 CTGCAGCAGTGCTAGCAGAGAGG + Intergenic
1007339920 6:41184885-41184907 CAGCAGCAGCAGCAGCACAACGG + Intergenic
1007342578 6:41200976-41200998 CAGCAGCAGCAGCAGCAGGAAGG + Exonic
1007534729 6:42576424-42576446 GGGCAGCAGCAGCAGCAGAATGG - Intronic
1007576681 6:42929617-42929639 CAGCAGCAGCAGCAGCAGCAAGG - Exonic
1008173242 6:48234680-48234702 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1008716396 6:54295097-54295119 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1008716397 6:54295100-54295122 CAGCAGCAGCAGCAGCGGGGTGG + Intergenic
1008835567 6:55823410-55823432 ATGCAGCAGGAGTTGCTGAGTGG - Intronic
1008973897 6:57401943-57401965 CTGCAGAGGCAGTGGCAGGGAGG + Intronic
1009162787 6:60303448-60303470 CTGCAGAGGCAGTGGCAGGGAGG + Intergenic
1009308887 6:62125163-62125185 TAGCAGCAGCAGTAGCTGTGTGG + Intronic
1009325779 6:62346221-62346243 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1009596695 6:65745559-65745581 CTGAAGAGGCAGTGGCAGAGAGG - Intergenic
1009621556 6:66084647-66084669 CAGCAGGAGCAGCAGCACAGTGG + Intergenic
1009769553 6:68127247-68127269 CTGCAGAGACAGTGGCAGAGAGG + Intergenic
1010019240 6:71139926-71139948 CTGCAGAGGCAGTGGCAGGGAGG - Intergenic
1010465884 6:76166343-76166365 CTGCAGCTGCAATGGCAGAGGGG - Intergenic
1011063170 6:83294616-83294638 CTGCAGAGGCAGTGGCAGAAGGG - Intronic
1011083437 6:83512936-83512958 CTGCTTAAGCAGTACCAGAGGGG + Intronic
1011290482 6:85772062-85772084 CAGCAGCAGCAGTGGCAGCACGG + Intergenic
1011630104 6:89314988-89315010 TAGCAGCAGCAGTGGCACAGTGG - Intronic
1011941483 6:92848489-92848511 CAGCAGCATCAGTAGCAGTTGGG - Intergenic
1012247165 6:96938632-96938654 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1012252015 6:96990920-96990942 CTGCAGTGGCAGTGGCAGAGGGG + Intronic
1012616424 6:101284132-101284154 CAGCAGAAGCAGTGGCAGAGAGG - Intergenic
1012964402 6:105657689-105657711 CCACAGCAGGAGCAGCAGAGGGG - Intergenic
1013900051 6:115144265-115144287 CTGAAGCAGAAGAATCAGAGAGG + Intergenic
1014124389 6:117759905-117759927 CTGCAGATGCAGTGGCAGAGAGG - Intergenic
1014183292 6:118408056-118408078 CTGAAGAGGCAGTGGCAGAGAGG - Intergenic
1014336703 6:120146830-120146852 CTGCAGGAGCAGGAGCAGGAGGG - Intergenic
1014701936 6:124699621-124699643 CTGGAGCAGCAGCAAGAGAGTGG - Intronic
1014947692 6:127516370-127516392 CTGCAGCAGCAGCAACAGCAGGG - Exonic
1015197289 6:130537358-130537380 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1015804411 6:137093861-137093883 CTGGAGCAGCAGCAAGAGAGAGG + Intergenic
1016272266 6:142302250-142302272 GTGGAGCAGCGGCAGCAGAGCGG + Exonic
1016289043 6:142507266-142507288 CCGCGACTGCAGTAGCAGAGGGG + Intergenic
1017535986 6:155348772-155348794 CTGCAGTGGCAGTGGCAGAGAGG + Intergenic
1018107911 6:160506732-160506754 CTGCAGTGGCAGTGGCAGATGGG + Intergenic
1018107956 6:160507011-160507033 CTGCAGCTGAAATGGCAGAGGGG + Intergenic
1018123501 6:160659626-160659648 CTGCAGCTGAAATGGCAGAGGGG + Intronic
1018146884 6:160900073-160900095 CTGCAGCTGCAATGGCAGAGGGG - Intergenic
1018166079 6:161098317-161098339 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1018327728 6:162691841-162691863 CTGAAGCAGCAGTAGCAGCCTGG + Intronic
1018903299 6:168061823-168061845 CTGCCGCAGCTGTTGCAGAGTGG + Exonic
1019032297 6:169024112-169024134 AATCAGCAGCAGAAGCAGAGGGG + Intergenic
1019279893 7:194243-194265 CTGGAGCAGAATTATCAGAGGGG + Intronic
1019286052 7:223668-223690 CTGCAGCTGCAGTCACAGGGAGG + Intronic
1019400946 7:853515-853537 CTGCAGCTTCTGTAGCAAAGTGG - Exonic
1019484192 7:1281141-1281163 CAGCAGCAGCAGCAGCAGCCAGG + Intergenic
1019816364 7:3204039-3204061 CTGGAGCAGGAGGAGGAGAGAGG + Intergenic
1020049471 7:5072387-5072409 CAGCAGCAGCAGCAACAGCGGGG - Exonic
1020426264 7:8069418-8069440 CTGCAGTGGCAGTGGCAGAGGGG + Intronic
1020513783 7:9090964-9090986 CTACAGCAGCAGTGGCAGAGGGG - Intergenic
1020607761 7:10359981-10360003 CAGAAGCAGCAGTAGCATGGCGG + Intergenic
1020702336 7:11499046-11499068 CTACAGAGGCAGTGGCAGAGAGG - Intronic
1021131140 7:16913976-16913998 CAGTAGCAGCAGCAGCAGTGTGG - Intergenic
1021341540 7:19469225-19469247 CAGTAGGAGCAGTATCAGAGTGG - Intergenic
1021561361 7:21971859-21971881 GAGCAGCAGCTGCAGCAGAGAGG - Intergenic
1022443636 7:30452769-30452791 CTGCAGCCGCTGTAGCAGCATGG + Exonic
1022459864 7:30594962-30594984 CGGCAGCAGCAGCAGCAGAGCGG - Exonic
1022538214 7:31111369-31111391 TGGCAGCAGCAGTAGCAGTAAGG - Exonic
1023886373 7:44360142-44360164 CTACAGAGGCAGTGGCAGAGAGG + Intergenic
1024165437 7:46724787-46724809 CTGCAGAGGCAGTGGCAGAGAGG - Intronic
1024279920 7:47710376-47710398 CTCCTGCAGCACCAGCAGAGGGG + Intronic
1024332581 7:48170928-48170950 GTGCAGGTGCAGTAGCAGAGTGG + Intergenic
1025085925 7:56023221-56023243 CTGCAGCTTCTGTAGCAGTGTGG - Intronic
1026405424 7:70060822-70060844 ATGCAGCAGAGGGAGCAGAGAGG - Intronic
1026764986 7:73154820-73154842 CAGCAGCAGCAGCAGCACCGGGG + Intergenic
1027278863 7:76591060-76591082 CTGCAGCTGCAATGACAGAGGGG - Intergenic
1027627616 7:80564636-80564658 CTGCAGAGGCAGTGGCAGAGAGG + Intronic
1027779454 7:82503980-82504002 CTGCTGCAGCAGAGGAAGAGAGG - Intergenic
1027859832 7:83563489-83563511 CAGCAGCAGCAGCAGCAGCTAGG + Intronic
1028077443 7:86533953-86533975 CTGCAGGGGCAGTGGGAGAGGGG + Intergenic
1028077489 7:86534234-86534256 CTGCTGTGGCAGTGGCAGAGGGG + Intergenic
1028176952 7:87671300-87671322 CTGCAGCGGCAGTCTCAGAGAGG + Intronic
1029032997 7:97488440-97488462 CTGCCCCAGCAGTTGCAGGGAGG + Intergenic
1029052183 7:97700652-97700674 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1029439032 7:100577300-100577322 CGGCGGCAGCAGCAGCAGAGCGG - Exonic
1029506481 7:100966478-100966500 CAGCAGCAGCACCAGCAGCGCGG - Exonic
1029715717 7:102324403-102324425 CTGCAGGCGCAGGAGCAGCGAGG + Intergenic
1029859199 7:103551181-103551203 CTGCTGCTGTGGTAGCAGAGGGG + Exonic
1030809396 7:113956214-113956236 CTGCAGAGACAGTGGCAGAGAGG + Intronic
1031629705 7:124032396-124032418 CAGCAGCAGCAGCAGCGGAGGGG - Exonic
1031702780 7:124945467-124945489 CAGCAGCAACAGTGGCAGTGTGG - Intergenic
1031966642 7:128031972-128031994 CGGCGGCAGCAGCAGCAGCGGGG + Intronic
1032437314 7:131910717-131910739 CTGCAGGAGCAGAAGCGAAGGGG - Intergenic
1032483392 7:132264536-132264558 GTATAGCAGAAGTAGCAGAGGGG - Intronic
1033148025 7:138887864-138887886 CAGCAGCAGCAGCAGCAGTGAGG + Intronic
1033424480 7:141231627-141231649 TTGCAGATGCAGTGGCAGAGAGG - Intronic
1034426346 7:151016201-151016223 CAGCAGCAGCAGGAGCCGTGGGG - Exonic
1034710081 7:153183657-153183679 CTGCAGTGGCATGAGCAGAGAGG + Intergenic
1034800485 7:154052685-154052707 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
1035014066 7:155748769-155748791 CTGCAGCAGCAGCCACAAAGGGG - Intronic
1035297474 7:157875663-157875685 CTGCAGCAGCAGCAGCACCTTGG + Intronic
1036710292 8:11074200-11074222 CTGCTCCAGCAGGAGCAGAAAGG + Intronic
1037150026 8:15626066-15626088 CAGGAGCAGCAGTGGCAGTGGGG + Intronic
1037388373 8:18366303-18366325 CTGCAGTAGCAGTGGCAGAGAGG - Intergenic
1037465181 8:19152754-19152776 GTGCAGCAGAAGCAGCACAGAGG + Intergenic
1037821469 8:22137226-22137248 CAGGTGCAGCAGTGGCAGAGGGG + Intergenic
1038170729 8:25128960-25128982 CTGCTGCAGCAGTGGCAGGGCGG - Intergenic
1038828540 8:31033148-31033170 CTGCGGCGGCTGCAGCAGAGGGG - Exonic
1039536179 8:38315496-38315518 CTGCATCTGCAGTAGCTGAAGGG + Exonic
1040087850 8:43364599-43364621 CTGCAGAGGCAGTGGCATAGAGG - Intergenic
1040404558 8:47087202-47087224 CTTCAGAGGCAGTGGCAGAGAGG + Intergenic
1041012728 8:53559849-53559871 CTGCTGTGGCAGTGGCAGAGGGG - Intergenic
1042444024 8:68862548-68862570 CGGCAGCAGCAGCAGCAGGTGGG - Intergenic
1042619924 8:70693881-70693903 CTGCAGAGGCAGTGGCAAAGAGG + Intronic
1043131810 8:76472188-76472210 CAGCAGCAGCAGTAGCATGCAGG + Intergenic
1043229870 8:77788328-77788350 TTGCAGAGGCAGTAGCAGAGAGG + Intergenic
1043671815 8:82895873-82895895 CTGCAGAATCAGGATCAGAGGGG + Intergenic
1044162463 8:88936151-88936173 CTGCAGATGCAGTGGCAGAGAGG - Intergenic
1044923075 8:97186117-97186139 CTACAGCAGCAGCAGCAACGTGG + Intergenic
1044927899 8:97224691-97224713 CTGCAGAAGCAGCGGCAGAGGGG - Intergenic
1045675850 8:104607487-104607509 CTGCATCAGCTGTGGCAGAAGGG + Intronic
1046056681 8:109086655-109086677 CAGCAGGAGCAGCAGCAGTGAGG - Exonic
1046255740 8:111694351-111694373 CTGCAGCTGCAATGCCAGAGGGG + Intergenic
1046486458 8:114894542-114894564 CTGCTGTGGCAGTGGCAGAGGGG + Intergenic
1047548086 8:125839225-125839247 CTGCAGTGTCAGTGGCAGAGAGG - Intergenic
1047836914 8:128703804-128703826 CTGCAGCAGCAGCAGCAACTTGG - Intergenic
1047961804 8:130016514-130016536 CAGCAGCAGCAGCAGCAGCCCGG + Intronic
1048027824 8:130602784-130602806 CTATAGTAGCGGTAGCAGAGGGG - Intergenic
1048274468 8:133055852-133055874 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1048333786 8:133488848-133488870 CTGCAGCGGCACTGGCAGACAGG + Intronic
1048518626 8:135133629-135133651 GTGCAGCAGCATTTGCAGTGGGG + Intergenic
1048752629 8:137697379-137697401 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1048980906 8:139703132-139703154 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1048980907 8:139703135-139703157 CAGCAGCAGCAGCAGCGGGGAGG + Intergenic
1049055939 8:140237678-140237700 AGGCAGCAGCAAGAGCAGAGCGG + Intronic
1049409027 8:142464242-142464264 CAGCAGCAGCAGTAGCAGCGGGG - Exonic
1049802581 8:144524936-144524958 CAGCAGCAGCGGCAGCAGTGCGG + Exonic
1050878726 9:10674089-10674111 CTGCAGCAACAATGACAGAGGGG + Intergenic
1051973066 9:22914156-22914178 CAGCAGCAGCAGCAGCAGCCTGG + Intergenic
1052311609 9:27074722-27074744 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1052626476 9:30982172-30982194 CTGCAGAGGCAGTAACAGAGAGG - Intergenic
1052703029 9:31960499-31960521 CTGCAGAGGCAGTGGCAAAGAGG - Intergenic
1053129607 9:35607559-35607581 CTGCAGGGGCAGGGGCAGAGTGG - Intronic
1053141924 9:35688003-35688025 CCGCAGCACCAGGAGCAGATAGG - Intronic
1053542847 9:38993161-38993183 CAGCAGCAGCAGTGGCAGCGAGG + Intergenic
1053646434 9:40122375-40122397 CCCCAGCAGCAGTAGCAGCAGGG - Intergenic
1053759279 9:41341176-41341198 CCCCAGCAGCAGTAGCAGCAGGG + Intergenic
1053807293 9:41816678-41816700 CAGCAGCAGCAGTGGCAGCGAGG + Intergenic
1053897461 9:42757193-42757215 CTGCAGCAACAGAAGGAAAGTGG - Intergenic
1054327446 9:63720277-63720299 CCCCAGCAGCAGTAGCAGCAGGG - Intergenic
1054538135 9:66253598-66253620 CCCCAGCAGCAGTAGCAGCAGGG + Intergenic
1054623299 9:67370749-67370771 CAGCAGCAGCAGTGGCAGCGAGG - Intergenic
1055208683 9:73763149-73763171 CTGCAGAGGCAGTGGCAGACAGG - Intergenic
1055373409 9:75624436-75624458 CTGCTGTGGCAGTGGCAGAGGGG + Intergenic
1055391506 9:75826775-75826797 CAGCAGCATCAGTAGCAAGGAGG + Intergenic
1055834152 9:80419221-80419243 CTGCAACTGCAGTGGCAGAAGGG + Intergenic
1055840773 9:80500456-80500478 CAGCAGCAGCAGCAGCAGTACGG - Intergenic
1056127865 9:83554687-83554709 CTGCAGAAGCAGTGGAAGAGAGG + Intergenic
1056234142 9:84574817-84574839 CTGCTGCAGAAGTACTAGAGAGG + Intergenic
1057061529 9:92008146-92008168 CTGCAGTAGCAGTTTCAGAGAGG + Intergenic
1057397271 9:94691291-94691313 CTGCAGAGGCAGGAGCAGGGTGG - Intergenic
1058111360 9:101033762-101033784 CTGAAGCAGCTGAAACAGAGAGG + Intronic
1059779134 9:117508110-117508132 CTGCAGCTGCAATGGGAGAGGGG + Intergenic
1060127936 9:121067787-121067809 TTGAAGCAGCAGGAGGAGAGGGG - Intergenic
1060969538 9:127730361-127730383 CTGCTGCAACAGGAGCACAGAGG + Intronic
1061974470 9:134061403-134061425 CTGGAGGAGCAGTGGCAGGGAGG + Intronic
1062084622 9:134642249-134642271 CAGCAGCAGCAGCAGCAGCGGGG - Exonic
1062403703 9:136383539-136383561 CAGCAGCAGCAGCAGCAGCGAGG - Exonic
1062562870 9:137149554-137149576 CAGCTGCAGCAGTAGCTTAGGGG + Intronic
1202794221 9_KI270719v1_random:105806-105828 CTCCAGCAGCAGTAGCGGCAGGG - Intergenic
1203774027 EBV:62906-62928 CAGCAGCGGCGGTAGCGGAGGGG - Intergenic
1203527905 Un_GL000213v1:106585-106607 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1186470343 X:9816579-9816601 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1188675778 X:32937322-32937344 CTGCAGCAGGAGGAGTACAGTGG - Intronic
1188707882 X:33357715-33357737 CAGCAGCAGCAGTAGCAGTATGG - Intergenic
1188715013 X:33449618-33449640 CTGTAGAGGCAGTGGCAGAGAGG - Intergenic
1188791757 X:34414190-34414212 CAGCAGAGGCAGTGGCAGAGGGG - Intergenic
1188842887 X:35037526-35037548 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1188869694 X:35359045-35359067 CTGCAGAGGCAGTGGTAGAGAGG + Intergenic
1189104316 X:38220748-38220770 CGGCAGCAGCAGCAGCAGCGCGG + Exonic
1190106811 X:47566969-47566991 CGGCAGCTGCAGTTGCAGAGAGG - Exonic
1190237924 X:48631671-48631693 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1190635042 X:52425017-52425039 CTGCAGCAGCAGTAACAGCAAGG + Intergenic
1191122991 X:56925609-56925631 CTGCAGAGGCAGTGGCAGAAGGG + Intergenic
1191128186 X:56980618-56980640 GGGCAGCAGCAGTAGCAGCGTGG + Intronic
1191155248 X:57266509-57266531 CTGCAAAGGCAGTGGCAGAGAGG - Intergenic
1191156857 X:57283519-57283541 CTGCAATGGCAGTGGCAGAGGGG + Intergenic
1191224710 X:58031144-58031166 CTGCTGTGGCAGTGGCAGAGGGG + Intergenic
1191695552 X:63986079-63986101 TAGCAGCAGCAGTGGCAGTGTGG - Intergenic
1191743699 X:64463701-64463723 CTGCAGAGGCAGTAGCAGAGAGG + Intergenic
1191922503 X:66271410-66271432 CTGCAGAGGCAGTGGCAGAAAGG - Intergenic
1192034126 X:67545301-67545323 CTGCTGCAGCAGCAGCAAACTGG - Exonic
1192310879 X:70013196-70013218 CTGCAGCTGCAATGGGAGAGGGG - Intronic
1192310935 X:70013471-70013493 CTGCAGTGGCAGTGGCAGAGGGG - Intronic
1192756318 X:74049837-74049859 CTGCTGTGGCAGTAGCAGAGGGG - Intergenic
1193010456 X:76669692-76669714 TTCCAGTAGCAGTAGCAGTGTGG - Intergenic
1193028746 X:76875031-76875053 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1193295738 X:79829586-79829608 CTGCAGAGGCAGTTGCAGGGAGG + Intergenic
1193317083 X:80076985-80077007 CTGCTGTAGCAGTGGCAGAGGGG + Intergenic
1193317136 X:80077263-80077285 CTGCAGCTGCAATGGCAGGGAGG + Intergenic
1193352211 X:80476756-80476778 CTGTATCTGCAGTAGCAGTGAGG + Intergenic
1193425578 X:81337545-81337567 AAGCAGCTGCAATAGCAGAGTGG + Intergenic
1193440541 X:81535495-81535517 CTGCAGCATCAGTGACAGAGGGG + Intergenic
1193496396 X:82219053-82219075 CTGCAGAGGCAGTGGCAGATGGG + Intergenic
1193569792 X:83128116-83128138 CTGCAGCTGCATTGGTAGAGGGG - Intergenic
1193642538 X:84028868-84028890 CTGCAGTGGCAGTGGCAGTGAGG + Intergenic
1193714909 X:84926817-84926839 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1193736214 X:85159838-85159860 CAGCAGCAGCAGTGGCAGCATGG - Intergenic
1193773827 X:85619810-85619832 CTGCGGCTGCAATGGCAGAGGGG - Intergenic
1193789124 X:85797308-85797330 CTGCAGAGGCAGTAACAGAGAGG + Intergenic
1193805208 X:85985982-85986004 CTGCAGAGGCAGTGGCAGAGAGG - Intronic
1193858942 X:86640262-86640284 CAGCAGAGGCAGTGGCAGAGAGG - Intronic
1193894684 X:87098673-87098695 CAGCAGCAGCAGTGGCAGTATGG + Intergenic
1193913005 X:87328141-87328163 CTGTAGCAGCAGAGGCAGAAGGG - Intergenic
1193924128 X:87464561-87464583 CACCAGCAGCAGTAGTAGAAGGG - Intergenic
1194055596 X:89127824-89127846 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1194076399 X:89399967-89399989 CTCAAGCTGCAGTAGCAGAAGGG + Intergenic
1194195055 X:90882614-90882636 CTGCAGTGGCAGTGGCAGAGTGG + Intergenic
1194195146 X:90883165-90883187 CTGCAGCTACAATGGCAGAGGGG + Intergenic
1194201600 X:90958619-90958641 CTGCTGTGGCAGTGGCAGAGGGG - Intergenic
1194234966 X:91372139-91372161 CTGCTGTTGCAGTGGCAGAGGGG - Intergenic
1194838910 X:98714929-98714951 CTGCAGAGGCAGTGGCAAAGAGG + Intergenic
1194917528 X:99723408-99723430 CTGCAGAGACAGTGGCAGAGAGG - Intergenic
1194948065 X:100091928-100091950 CTGCAGAGGAAGTGGCAGAGAGG - Intergenic
1195148855 X:102044762-102044784 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1195208132 X:102624748-102624770 CTGCAGAGGCAGTGGCAGAGGGG + Intergenic
1195544476 X:106100009-106100031 CTGCAGCAGCATTGGCAGCATGG + Intergenic
1195544491 X:106100104-106100126 CAGCAGCAGCAGTGGCAGTATGG + Intergenic
1195687988 X:107602686-107602708 CTGCAGCAGCAGCAGCCCTGAGG + Exonic
1195856505 X:109338199-109338221 CTGCAGAGACAGTGGCAGAGGGG + Intergenic
1196047370 X:111270388-111270410 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1196227933 X:113188618-113188640 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1196234258 X:113261143-113261165 TTGCAGTGGCAGTGGCAGAGGGG + Intergenic
1196245191 X:113391740-113391762 CTGCAGCTGCAATGGCAGAGGGG + Intergenic
1196528860 X:116759652-116759674 CTGCACAGGCAGTGGCAGAGAGG - Intergenic
1197076952 X:122364211-122364233 CTGCAGAGGCAGTGACAGAGAGG + Intergenic
1197904687 X:131412418-131412440 CTGCTGTGGCAGTGGCAGAGGGG - Intergenic
1197904742 X:131412817-131412839 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1197913883 X:131514135-131514157 CCGCAGCTGCAATGGCAGAGGGG + Intergenic
1199249037 X:145638215-145638237 CTGCAGAGGCAGTGGCAGAGGGG - Intergenic
1199307007 X:146279054-146279076 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1199320587 X:146433535-146433557 CTTCACCAGCAGAGGCAGAGTGG - Intergenic
1199559866 X:149151095-149151117 CTACATTGGCAGTAGCAGAGGGG + Intergenic
1199707096 X:150437205-150437227 TGCCAGCAGCAGTAGCAGAACGG + Intronic
1200110073 X:153736541-153736563 CTGCAGCAGCAGCAGGGGCGGGG - Intronic
1200360736 X:155603944-155603966 CTGCAATGGCAGTGGCAGAGGGG - Intronic
1200547440 Y:4534074-4534096 CTGCTGTGGCAGTGGCAGAGGGG - Intergenic
1201142969 Y:11043706-11043728 CGGCAGCAGCAGTAGCACCTTGG - Intergenic