ID: 945357637

View in Genome Browser
Species Human (GRCh38)
Location 2:208857924-208857946
Sequence CACACCCACATGAAGTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945357637_945357642 4 Left 945357637 2:208857924-208857946 CCACAGCACTTCATGTGGGTGTG No data
Right 945357642 2:208857951-208857973 CTCCTGTGTTGGGAAATCACAGG No data
945357637_945357640 -7 Left 945357637 2:208857924-208857946 CCACAGCACTTCATGTGGGTGTG No data
Right 945357640 2:208857940-208857962 GGGTGTGGAGGCTCCTGTGTTGG No data
945357637_945357646 23 Left 945357637 2:208857924-208857946 CCACAGCACTTCATGTGGGTGTG No data
Right 945357646 2:208857970-208857992 CAGGGAATGTCCTGAGCCCAGGG No data
945357637_945357645 22 Left 945357637 2:208857924-208857946 CCACAGCACTTCATGTGGGTGTG No data
Right 945357645 2:208857969-208857991 ACAGGGAATGTCCTGAGCCCAGG No data
945357637_945357643 5 Left 945357637 2:208857924-208857946 CCACAGCACTTCATGTGGGTGTG No data
Right 945357643 2:208857952-208857974 TCCTGTGTTGGGAAATCACAGGG No data
945357637_945357641 -6 Left 945357637 2:208857924-208857946 CCACAGCACTTCATGTGGGTGTG No data
Right 945357641 2:208857941-208857963 GGTGTGGAGGCTCCTGTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945357637 Original CRISPR CACACCCACATGAAGTGCTG TGG (reversed) Intergenic
No off target data available for this crispr