ID: 945369085

View in Genome Browser
Species Human (GRCh38)
Location 2:208994368-208994390
Sequence GGTGAAAAACAACAACTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945369085_945369088 -7 Left 945369085 2:208994368-208994390 CCAGCTAGTTGTTGTTTTTCACC No data
Right 945369088 2:208994384-208994406 TTTCACCATGTTGGTCAGGCTGG 0: 18554
1: 129811
2: 169790
3: 147924
4: 143504

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945369085 Original CRISPR GGTGAAAAACAACAACTAGC TGG (reversed) Intergenic
No off target data available for this crispr