ID: 945369945

View in Genome Browser
Species Human (GRCh38)
Location 2:209004259-209004281
Sequence TAGGGCTTCAACTCAAAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945369945_945369951 8 Left 945369945 2:209004259-209004281 CCAAGCTTTGAGTTGAAGCCCTA No data
Right 945369951 2:209004290-209004312 AACTGGATTGAGGGATCCAGAGG No data
945369945_945369953 30 Left 945369945 2:209004259-209004281 CCAAGCTTTGAGTTGAAGCCCTA No data
Right 945369953 2:209004312-209004334 GCAGACAACAACAGAAGTCAAGG No data
945369945_945369949 -2 Left 945369945 2:209004259-209004281 CCAAGCTTTGAGTTGAAGCCCTA No data
Right 945369949 2:209004280-209004302 TAGTAAGAAAAACTGGATTGAGG No data
945369945_945369946 -9 Left 945369945 2:209004259-209004281 CCAAGCTTTGAGTTGAAGCCCTA No data
Right 945369946 2:209004273-209004295 GAAGCCCTAGTAAGAAAAACTGG No data
945369945_945369950 -1 Left 945369945 2:209004259-209004281 CCAAGCTTTGAGTTGAAGCCCTA No data
Right 945369950 2:209004281-209004303 AGTAAGAAAAACTGGATTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945369945 Original CRISPR TAGGGCTTCAACTCAAAGCT TGG (reversed) Intergenic
No off target data available for this crispr