ID: 945372743

View in Genome Browser
Species Human (GRCh38)
Location 2:209040119-209040141
Sequence AACCTTTGAATACTACTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945372743_945372748 30 Left 945372743 2:209040119-209040141 CCCATGAGTAGTATTCAAAGGTT No data
Right 945372748 2:209040172-209040194 TTCTTTTAAAAAATGAAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945372743 Original CRISPR AACCTTTGAATACTACTCAT GGG (reversed) Intergenic
No off target data available for this crispr