ID: 945373586

View in Genome Browser
Species Human (GRCh38)
Location 2:209051993-209052015
Sequence CCTGGAGGGCACTTTTCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945373586_945373592 -4 Left 945373586 2:209051993-209052015 CCAAAGGAAAAGTGCCCTCCAGG No data
Right 945373592 2:209052012-209052034 CAGGTTCAGGCTTAAATAAAAGG No data
945373586_945373593 22 Left 945373586 2:209051993-209052015 CCAAAGGAAAAGTGCCCTCCAGG No data
Right 945373593 2:209052038-209052060 AGTCACAAACGCTCTCTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945373586 Original CRISPR CCTGGAGGGCACTTTTCCTT TGG (reversed) Intergenic
No off target data available for this crispr