ID: 945374227

View in Genome Browser
Species Human (GRCh38)
Location 2:209060662-209060684
Sequence CTTTGTCCCAACCAGGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945374227_945374229 5 Left 945374227 2:209060662-209060684 CCTGACTCCTGGTTGGGACAAAG No data
Right 945374229 2:209060690-209060712 CTTAGAATCCGCAGTCTCCAAGG No data
945374227_945374231 15 Left 945374227 2:209060662-209060684 CCTGACTCCTGGTTGGGACAAAG No data
Right 945374231 2:209060700-209060722 GCAGTCTCCAAGGTAAACAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945374227 Original CRISPR CTTTGTCCCAACCAGGAGTC AGG (reversed) Intergenic
No off target data available for this crispr