ID: 945374351

View in Genome Browser
Species Human (GRCh38)
Location 2:209061702-209061724
Sequence GGTGCCAAACAACTATGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945374343_945374351 30 Left 945374343 2:209061649-209061671 CCGGCCAGGGAACTATAATCTTT No data
Right 945374351 2:209061702-209061724 GGTGCCAAACAACTATGAGTAGG No data
945374344_945374351 26 Left 945374344 2:209061653-209061675 CCAGGGAACTATAATCTTTTAAC No data
Right 945374351 2:209061702-209061724 GGTGCCAAACAACTATGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945374351 Original CRISPR GGTGCCAAACAACTATGAGT AGG Intergenic
No off target data available for this crispr