ID: 945377192

View in Genome Browser
Species Human (GRCh38)
Location 2:209092868-209092890
Sequence TCTTAGACATTCTGCCATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945377190_945377192 8 Left 945377190 2:209092837-209092859 CCTGAATAGAGCAGAAATTTGGT No data
Right 945377192 2:209092868-209092890 TCTTAGACATTCTGCCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945377192 Original CRISPR TCTTAGACATTCTGCCATCC TGG Intergenic
No off target data available for this crispr