ID: 945394351

View in Genome Browser
Species Human (GRCh38)
Location 2:209301715-209301737
Sequence GCGCCCTAGACCATCATGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945394344_945394351 26 Left 945394344 2:209301666-209301688 CCTTCTTGGCTTACCGGCTGAAG 0: 13
1: 24
2: 57
3: 49
4: 174
Right 945394351 2:209301715-209301737 GCGCCCTAGACCATCATGGACGG No data
945394345_945394351 13 Left 945394345 2:209301679-209301701 CCGGCTGAAGACTGACACTGCCC No data
Right 945394351 2:209301715-209301737 GCGCCCTAGACCATCATGGACGG No data
945394348_945394351 -8 Left 945394348 2:209301700-209301722 CCGATCACCTCGGAAGCGCCCTA No data
Right 945394351 2:209301715-209301737 GCGCCCTAGACCATCATGGACGG No data
945394347_945394351 -7 Left 945394347 2:209301699-209301721 CCCGATCACCTCGGAAGCGCCCT No data
Right 945394351 2:209301715-209301737 GCGCCCTAGACCATCATGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945394351 Original CRISPR GCGCCCTAGACCATCATGGA CGG Intergenic
No off target data available for this crispr