ID: 945396410

View in Genome Browser
Species Human (GRCh38)
Location 2:209324343-209324365
Sequence ATGTCCCAGACCCCTCTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945396406_945396410 11 Left 945396406 2:209324309-209324331 CCAACATTTTTAGACATGCTCAC No data
Right 945396410 2:209324343-209324365 ATGTCCCAGACCCCTCTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945396410 Original CRISPR ATGTCCCAGACCCCTCTGGT AGG Intergenic
No off target data available for this crispr