ID: 945401382

View in Genome Browser
Species Human (GRCh38)
Location 2:209387476-209387498
Sequence GCCAGCCGGCCGGCAAGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945401371_945401382 29 Left 945401371 2:209387424-209387446 CCAGCGCGAGTTCCGGGTGGGCG 0: 119
1: 275
2: 784
3: 689
4: 391
Right 945401382 2:209387476-209387498 GCCAGCCGGCCGGCAAGCCCCGG No data
945401375_945401382 17 Left 945401375 2:209387436-209387458 CCGGGTGGGCGTGGGCTCGGCGG 0: 79
1: 581
2: 637
3: 391
4: 425
Right 945401382 2:209387476-209387498 GCCAGCCGGCCGGCAAGCCCCGG No data
945401379_945401382 -9 Left 945401379 2:209387462-209387484 CCGCACTCTGAGCGGCCAGCCGG No data
Right 945401382 2:209387476-209387498 GCCAGCCGGCCGGCAAGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945401382 Original CRISPR GCCAGCCGGCCGGCAAGCCC CGG Intergenic
No off target data available for this crispr