ID: 945404806

View in Genome Browser
Species Human (GRCh38)
Location 2:209432294-209432316
Sequence CTGTAGGCAGAGAAACAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 485
Summary {0: 1, 1: 0, 2: 7, 3: 48, 4: 429}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945404806_945404809 -6 Left 945404806 2:209432294-209432316 CCTTCCTGTTTCTCTGCCTACAG 0: 1
1: 0
2: 7
3: 48
4: 429
Right 945404809 2:209432311-209432333 CTACAGTGCTCTATCCCTCTTGG 0: 1
1: 0
2: 1
3: 7
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945404806 Original CRISPR CTGTAGGCAGAGAAACAGGA AGG (reversed) Intronic
900499475 1:2994221-2994243 CAGTGGGGAGAGGAACAGGATGG - Intergenic
901002316 1:6154899-6154921 CTGTAGGGGGAGAGGCAGGAGGG + Intronic
901604666 1:10449700-10449722 CTATGGGCAGAGAAACAAGGAGG - Exonic
902054717 1:13590748-13590770 CTGTAGGCAGAAATAGAGAATGG + Intronic
902609779 1:17590174-17590196 CTGGAGGCAGAGAAGCACGGTGG - Intronic
902692420 1:18118170-18118192 CTGTAGAAAGAGAAACAAAAGGG - Intronic
903194621 1:21675985-21676007 CTGTAGGCAGAAATACTGGCTGG - Intergenic
903228065 1:21904920-21904942 CTGTGGGCAGTGACCCAGGAGGG - Intronic
903769248 1:25753674-25753696 CAGTAGGCAGGCAAGCAGGAGGG + Intronic
904909113 1:33920955-33920977 TTTTAGGCAGAAAAACAGCAAGG + Intronic
905358996 1:37405353-37405375 CACTAGGCAGAGAAAAAGGCTGG + Intergenic
905969635 1:42131731-42131753 CTTCAGGCAGGGAAACAGGATGG + Intergenic
906314153 1:44775655-44775677 CAGTAGGCTGTGAAGCAGGATGG - Intronic
906641386 1:47442984-47443006 CTGAAGGCAGAGAAGAAGGGAGG + Intergenic
907046644 1:51303645-51303667 CTGCAGGCAGGGAAACAAGGTGG - Intronic
907158768 1:52356594-52356616 GTGTAGGCAGAGAAACGTGGTGG - Intronic
909302273 1:74028494-74028516 ATGTAGGTAGAGCAACAAGACGG + Intronic
909549718 1:76884188-76884210 CTGTCTGCACAGACACAGGAGGG - Intronic
909943901 1:81641259-81641281 CAGTAGGCAGAAAATCAGTAGGG + Intronic
911165630 1:94722180-94722202 CTGTAGGCAGAGACAAAGGAAGG + Intergenic
912364033 1:109118216-109118238 CAGTAGGCAGAGATGGAGGAAGG + Intronic
913017059 1:114748713-114748735 GTGTAGGTAGAGAAAAAGGTAGG - Intronic
913114095 1:115680860-115680882 CAGTAGCCAGAGCACCAGGATGG - Intronic
913134440 1:115874243-115874265 CTATAGGCAGAGCAGCAGCATGG + Intergenic
913251130 1:116912554-116912576 CAGTAGCCGTAGAAACAGGAAGG - Intronic
915311571 1:155008132-155008154 CTGTGGGCACCGAAAGAGGAAGG - Intronic
915579977 1:156807758-156807780 CTATAGGCAGAGATACTGGCGGG + Intronic
915917695 1:159950868-159950890 CTATAGGCAGGGACACAGGCAGG + Intergenic
916130242 1:161606186-161606208 CTGGCGGCAGAGAAACCGCAGGG + Intronic
916353652 1:163880283-163880305 CTAAAAGCAGAAAAACAGGAGGG - Intergenic
916379215 1:164189651-164189673 TTGTGGCCACAGAAACAGGATGG + Intergenic
916718654 1:167465828-167465850 CTGTAGCCAGAGAAATATGGAGG - Intronic
917014433 1:170513304-170513326 AGGTAGGAAGAGAAAAAGGATGG + Intergenic
918125227 1:181577743-181577765 CTGCAGACAGAGACACAGAAGGG - Intronic
919588229 1:199465551-199465573 ATGAAGGAAGAGAGACAGGAGGG + Intergenic
920198048 1:204242703-204242725 GTGGAGGCAGAGAGACAGCATGG + Intronic
920562227 1:206947027-206947049 CTCTGGGGAGTGAAACAGGAAGG - Intergenic
921243354 1:213209741-213209763 CTGTAGGCAGAGTAGGAGCATGG + Intronic
921303302 1:213771046-213771068 AAGAAGGGAGAGAAACAGGAAGG - Intergenic
923051276 1:230392941-230392963 CTGGAGGGAGAGGCACAGGAAGG + Intronic
923152298 1:231244259-231244281 CTGTAGGAAGAGAATCAGGTTGG + Intronic
923995785 1:239492686-239492708 CTGCAGACAGAGAAAAAAGACGG - Intronic
924510865 1:244728418-244728440 CTATAGGCAGGATAACAGGATGG + Intergenic
924887967 1:248240566-248240588 CTGAAGGCAGAGCAAGATGATGG + Intergenic
1062989779 10:1804570-1804592 CTGTAGCCACAGAAACAACAGGG + Intergenic
1063024227 10:2162284-2162306 CATTAGGGAGAGAAATAGGATGG - Intergenic
1063540276 10:6926581-6926603 CTATAGGCAGAGACAAAGCAGGG + Intergenic
1064569581 10:16678765-16678787 CTCTAGGGAAAGAAACTGGATGG - Intronic
1064604296 10:17022595-17022617 CTGCAGGCGGAGAAACCGGAGGG + Intronic
1065128535 10:22597505-22597527 TTGTAAGCAGAGAAAGTGGATGG - Intronic
1065162530 10:22937851-22937873 ATGGAGACAGAGAAACAGCATGG + Intronic
1065380828 10:25088248-25088270 CTGGAGGCAGGGAAACCAGAAGG + Intergenic
1065598401 10:27341339-27341361 TTGAAGGCAGAGAAAGAGCATGG - Intergenic
1065663250 10:28028553-28028575 CTATAGGAAGAAAAACAGCACGG + Intergenic
1067318461 10:45194340-45194362 TTGAAGGCAGAGAAAGAGCATGG - Intergenic
1070274808 10:74995517-74995539 TTGTACACAAAGAAACAGGAAGG - Intronic
1071491375 10:86138843-86138865 CTGTGGGCTGAGCAGCAGGATGG + Exonic
1071492108 10:86143243-86143265 CTGGAGGCAGAGTAACAGTGAGG + Intronic
1072027696 10:91477515-91477537 CTGTAAGCAGAGGAAGAGAAAGG + Intronic
1072512905 10:96147027-96147049 CTGTAAGCAGAGAATCTGGCAGG + Intronic
1072771237 10:98140437-98140459 CAATAGGCAGAGAGAGAGGAGGG + Intronic
1072781455 10:98254689-98254711 CTGTAGGCAGTGGAGCAGGGAGG + Intronic
1073623046 10:105068476-105068498 CTGAAGGCAGAGAAACAGAGAGG - Intronic
1074306651 10:112285288-112285310 CTGTAGGGATGGAATCAGGAAGG + Intronic
1074831251 10:117250982-117251004 CTGTAGGCAGAAACACTGGGTGG - Intronic
1075439707 10:122470123-122470145 CAGTAGGCAGAAAATCAGGAAGG - Intronic
1075577423 10:123588098-123588120 ATATATGCAGAGAAACAGGCAGG - Intergenic
1075623007 10:123941341-123941363 CTGTAAGCCGAGAAACACCAGGG - Intergenic
1076214245 10:128679969-128679991 CTGGAGGCAGAGAGGAAGGAAGG + Intergenic
1076444116 10:130500262-130500284 CTGCAGGCAGAGAGCAAGGATGG + Intergenic
1076481286 10:130786712-130786734 CTGTAGGGAGAGCCACAGCAGGG - Intergenic
1076647051 10:131960881-131960903 CTGCAGGCAAAGGGACAGGATGG + Intergenic
1076831868 10:132999426-132999448 ATGGAGGTGGAGAAACAGGAGGG - Intergenic
1076831894 10:132999514-132999536 ATGGAGGTGGAGAAACAGGAGGG - Intergenic
1076831920 10:132999602-132999624 ATGGAGGTGGAGAAACAGGAGGG - Intergenic
1077375859 11:2204864-2204886 CTTTAGGCAGCGGGACAGGATGG - Intergenic
1077529619 11:3089091-3089113 GTGTGGGCAGAGAAGCAGGGAGG - Intronic
1077858651 11:6155657-6155679 CAGTATGGAGTGAAACAGGACGG + Intergenic
1080241115 11:30128220-30128242 CTGGAGGCATTGACACAGGAGGG + Intergenic
1082772002 11:57214984-57215006 ATCTAGGCAGAGGAAGAGGAGGG - Intergenic
1082998140 11:59268775-59268797 ATGAAGGCAGAGAAACAGTGGGG + Intergenic
1083270432 11:61569570-61569592 CAGGAGCCAGAGAGACAGGAAGG + Intronic
1083935870 11:65869894-65869916 CTGGTGGCAGCGACACAGGAAGG + Exonic
1085560860 11:77472421-77472443 CTGTAAGAGGAGAGACAGGATGG + Intronic
1085721116 11:78913218-78913240 ATGAAAGCAGAGAAGCAGGAAGG - Intronic
1086772533 11:90785515-90785537 CTGATGGCAGAGACACAAGAAGG - Intergenic
1088799662 11:113293920-113293942 AGGGAGGCAGAGAAAAAGGATGG + Intergenic
1089102325 11:115973952-115973974 CTGGAGTCACAGAAACTGGATGG - Intergenic
1090276281 11:125422051-125422073 GGGTAGGAAGAGAAAAAGGAGGG + Intronic
1090682448 11:129076287-129076309 CCATAGGCAGAGCAACAGCATGG - Intronic
1090750048 11:129738669-129738691 CTGTAGACAAAGAGTCAGGAAGG + Intergenic
1090837501 11:130463998-130464020 CTGTAGGCAGAAACAGAGCAAGG + Intronic
1091157747 11:133389327-133389349 AAGTTTGCAGAGAAACAGGAGGG + Intronic
1091423681 12:366949-366971 CTGTAGGCAGTGTAACACAATGG - Intronic
1091681155 12:2528088-2528110 CTGTTGGGAGAGGAACATGAGGG - Intronic
1092848010 12:12602036-12602058 CAGTAGGCATAGAATCAGCATGG + Intergenic
1092867130 12:12772577-12772599 CAGTAGGCAGAAAATCAGTAGGG + Intronic
1093045740 12:14442150-14442172 ATATAGGAAGAGAAACAAGAAGG - Intronic
1093405798 12:18802425-18802447 ATGGAAGCAGAGAAAAAGGAAGG + Intergenic
1094781290 12:33794989-33795011 AAGTAGGCAGAGAAACAGCATGG + Intergenic
1095779866 12:46047860-46047882 ATGTAGTAAAAGAAACAGGAGGG + Intergenic
1095826582 12:46536245-46536267 CTGTAGGCTGAGAGACAGCCTGG + Intergenic
1095955175 12:47801953-47801975 CTGGGAGCAGTGAAACAGGAAGG - Intronic
1096915961 12:55034168-55034190 GTGGAGGCAGAGAAACAGGAAGG + Intergenic
1097338056 12:58406787-58406809 CTGAATGCAGAGAAGGAGGAGGG + Intergenic
1097942909 12:65331878-65331900 CTGGAAGCAGAGAAACTGCATGG + Intronic
1098040689 12:66351531-66351553 GTATATGCAGGGAAACAGGAAGG + Intronic
1098304693 12:69090788-69090810 CTGTTTGCAGAGAACAAGGATGG + Intergenic
1099728899 12:86472194-86472216 CTGGAGGCAGACACATAGGAAGG - Intronic
1099746537 12:86711233-86711255 ATGTAGGAAGAGAAACAGTATGG + Intronic
1101044435 12:100790078-100790100 CTCCAGGGAGAGAAGCAGGAAGG + Intronic
1101141118 12:101797100-101797122 TTGTAGGCTGAGAAGCAGCAAGG + Intronic
1101866586 12:108524873-108524895 GTGAAGGCACAGAAACACGAGGG - Intronic
1101951943 12:109183864-109183886 CTGAAGGAAGAAAAAGAGGAAGG - Intronic
1103219816 12:119234378-119234400 CTGGAGGCAGAGAAAGAGGCCGG - Intergenic
1103510708 12:121471750-121471772 CTCAGGGCAGAGAAACAGAATGG + Intronic
1103915100 12:124372136-124372158 CTCAAGGCAGAGAAGAAGGAGGG - Exonic
1105224148 13:18413019-18413041 TTGAAGGCAGAGAAAGAGCATGG + Intergenic
1105806538 13:23954756-23954778 ATGGAGGCAGAAAAACAGGGTGG + Intergenic
1106194293 13:27480202-27480224 CAGCAGGCCGAGAAGCAGGAAGG + Intergenic
1107710102 13:43142939-43142961 CTGAAGGCAGAGATGTAGGAAGG + Intergenic
1107791003 13:44002231-44002253 CTGTTGTTAGTGAAACAGGAAGG - Intergenic
1108731592 13:53241006-53241028 AGGAAAGCAGAGAAACAGGAGGG - Intergenic
1110412779 13:75221995-75222017 CAGGAGGAAGAGAGACAGGAGGG + Intergenic
1110965228 13:81686324-81686346 ATGTAGGCACAGAGACAGAAGGG - Intergenic
1112753829 13:102608789-102608811 GAGGAGGCAGAGAAAGAGGAAGG - Intronic
1113174460 13:107546200-107546222 CTGTCTGCAGAGCAGCAGGATGG - Intronic
1113544493 13:111137581-111137603 ATGGAGGCAGAGAGACAGAAAGG + Intronic
1113583093 13:111442498-111442520 GTGAAGGCAGACACACAGGAAGG - Intergenic
1113600267 13:111563421-111563443 GGGGAGGGAGAGAAACAGGAGGG - Intergenic
1113797978 13:113069808-113069830 CTAGAGGGAGAGAAGCAGGAAGG + Intronic
1114008293 14:18337858-18337880 TTGAAGGCAGAGAAAGAGAATGG + Intergenic
1114256131 14:21002755-21002777 TTGTAGGAAGGGGAACAGGATGG - Intergenic
1114465744 14:22921057-22921079 CTGTAAGAAGAAAGACAGGAAGG + Intronic
1115912610 14:38272970-38272992 CTGTAGTCAGAGAGACACCAAGG + Intergenic
1116177498 14:41491377-41491399 CTATAGTAACAGAAACAGGATGG - Intergenic
1116207220 14:41883711-41883733 ATGTAGGCATAGAAATAAGACGG - Intronic
1116321739 14:43475998-43476020 ATGTACACAGAGAGACAGGAAGG - Intergenic
1116900454 14:50357650-50357672 CTGTTGCTAGAGAAAGAGGACGG - Intronic
1117098790 14:52324240-52324262 CAGGAGGCAGAGAGGCAGGAGGG + Intronic
1117245952 14:53886865-53886887 CAGTATGCAGAGAAACATGGAGG + Intergenic
1117354142 14:54907149-54907171 CAGGGGGCAGAGAAACAGCATGG + Intergenic
1118728088 14:68644595-68644617 CTTTAGGCAGAGATTCAGGAAGG - Intronic
1119187458 14:72652811-72652833 CTGAAGGCAGATGAACAAGAGGG + Intronic
1119746034 14:77044798-77044820 CTGTAAACAGAGAAGCAGCAAGG - Intergenic
1120186904 14:81402776-81402798 CTGAAGGCAGGGAGACAGGTAGG - Intronic
1120837067 14:89049576-89049598 CAGTAGGCAGAAAATCAGTAAGG + Intergenic
1120952237 14:90051982-90052004 CTGGAGGCAGGGACACAGAAGGG - Intergenic
1121120440 14:91372613-91372635 CTGTAGCCAGAGACACAAGATGG - Intronic
1121558382 14:94855735-94855757 CTGTAGGCAGAGGGACAGAATGG - Intergenic
1122123708 14:99568086-99568108 CTTTAGGCAGAGAGGCAGGAGGG + Intronic
1122793089 14:104192660-104192682 CTGGAGGCAGGGGAAAAGGAAGG + Intergenic
1122795025 14:104201714-104201736 CTGTCCTCAGAGAAGCAGGAGGG + Intergenic
1123391489 15:19878446-19878468 TTGAAGGCAGAGAAAGAGCATGG + Intergenic
1124898198 15:33797215-33797237 CTGTAGGCAGAGAAGAAGGTTGG - Intronic
1125425235 15:39542101-39542123 CTGTAGGCAGAGATATAAAATGG + Intergenic
1126574411 15:50183012-50183034 CTGTAGGTATAGAAAAAGGTTGG + Intronic
1127012701 15:54647465-54647487 CTGTAGGAAGAGACAAAGAAAGG + Intergenic
1127022539 15:54764785-54764807 CTGTAGGAAGAGACAAAGAAGGG + Intergenic
1127332393 15:57951752-57951774 CTGTAGTCAGAGAAATAGGAGGG - Intergenic
1128500411 15:68223308-68223330 CTGGAGCCAGAGAAAGAGAAGGG + Intronic
1128746322 15:70116938-70116960 CAGTAGGCACAGAAAAATGATGG + Intergenic
1129011251 15:72419678-72419700 CTCTATGCAAAGAAAAAGGAGGG + Intergenic
1129831927 15:78676284-78676306 GTGGAGGAAGAGAAACAGGAGGG + Intronic
1130147244 15:81283238-81283260 CGGGAGGCAGAGAAGCTGGAGGG + Intronic
1130577355 15:85104407-85104429 CTGTAGGCAGAGGAAGACCAAGG + Intronic
1131159333 15:90094346-90094368 CTGTGGGCAGAGGAGCAGGCTGG - Intronic
1132564506 16:615304-615326 CCGTAGGCAGAGAGACCGCATGG + Intronic
1132850830 16:2024186-2024208 CTGGAGGCAGAGAAAGGCGAAGG - Intergenic
1133718196 16:8469515-8469537 CTGGAGGCAGAGAGGCAGGTGGG - Intergenic
1135170465 16:20179077-20179099 ATGTGGGCAGAGGAACAGGAAGG - Intergenic
1135829253 16:25759052-25759074 CTGTAGCCAGGGAAACAGAGGGG + Intronic
1135831667 16:25779766-25779788 AGCCAGGCAGAGAAACAGGAAGG + Intronic
1136076343 16:27819951-27819973 GTGGAGGCAGAGAAAAAGGAAGG + Intronic
1138569848 16:57863059-57863081 TTGTAGGCAGAGGAATGGGAGGG - Intergenic
1138744190 16:59344285-59344307 CTGGGGGCAAAAAAACAGGAAGG - Intergenic
1138951167 16:61915189-61915211 CTGTAGCCATGCAAACAGGAAGG - Intronic
1138981550 16:62274865-62274887 TTGTAGGCAGAGAGAGAGGTGGG + Intergenic
1139280380 16:65765407-65765429 CTCTAGGCAGACAAACAGCATGG - Intergenic
1139377935 16:66512183-66512205 TTGCAGGCAGATAAAAAGGAAGG + Intronic
1140923323 16:79559485-79559507 CGGAAGGCAGAGAAACAGGTAGG - Intergenic
1141165506 16:81658066-81658088 CCCTAGGCAGAGACGCAGGAAGG - Intronic
1141232923 16:82187233-82187255 CAGAAGGAAGAGAGACAGGAGGG - Intergenic
1141342180 16:83213358-83213380 TGGCAGGCAGAGAAACGGGAGGG + Intronic
1141719341 16:85747029-85747051 CAGCAGGAAGCGAAACAGGATGG + Intronic
1142278670 16:89136720-89136742 CTGTAGGCACAGAGGCAGGTGGG - Intronic
1142468197 17:147753-147775 CTGGTGGAAGAGAGACAGGATGG - Intronic
1142577826 17:921194-921216 CTGTAGGTGGAGGAAGAGGAAGG - Intronic
1143582595 17:7835526-7835548 CTGTTGCCAGAGTAACTGGAGGG + Intergenic
1144267637 17:13586450-13586472 CTGGAGGCAGAGTCAGAGGAGGG - Intronic
1144952472 17:19001717-19001739 CTGTAGCCAGAGACTCAGGGAGG + Intronic
1145404118 17:22570834-22570856 ATGGAGGCAGAAAAACAGGGTGG + Intergenic
1146000333 17:29126833-29126855 CAGGAGGCTGAGAAGCAGGAGGG - Intronic
1146192898 17:30785966-30785988 GTGTGTGCAGAAAAACAGGATGG - Exonic
1147598410 17:41731560-41731582 CTGGAGGGAGACAAAGAGGAAGG + Intronic
1148530325 17:48384101-48384123 CTGGAGGCAGAGAACCAGAAAGG + Intronic
1148966954 17:51443639-51443661 CTGAAGGCAGTGAAACAGGATGG + Intergenic
1149183091 17:53963882-53963904 CTGTGGGTAGAGAAACAGGCAGG - Intergenic
1149622629 17:58057495-58057517 CTGTAGGCTCAGGAACAGGAAGG + Intergenic
1149774861 17:59349324-59349346 CTGTGGGCTGAGAAAGGGGAGGG - Intronic
1149939059 17:60843576-60843598 GTGTAGGGAGAGGAACAAGAGGG - Intronic
1150347000 17:64411997-64412019 CTGAAGGAAGAGGAACAGCAGGG + Intronic
1150942476 17:69707640-69707662 CTGTAGCCAGAGCCACAGGCAGG + Intergenic
1151190605 17:72395076-72395098 CAGTAGAGGGAGAAACAGGAAGG + Intergenic
1151550820 17:74821603-74821625 ATATAAGCAGAGAAATAGGAAGG - Intronic
1152072645 17:78141598-78141620 GTGAAGGAAGAGTAACAGGAAGG - Exonic
1152103899 17:78317987-78318009 AGGTAGGGAGAGAAAAAGGAGGG + Intergenic
1152130619 17:78474105-78474127 CTGCAGGCAGAGACCCTGGAGGG - Intronic
1152317018 17:79587090-79587112 CTGTAGCCAGAGTAACTGGTGGG + Intergenic
1152696541 17:81800511-81800533 ATGCAGGAAGGGAAACAGGAGGG - Intergenic
1152804149 17:82347180-82347202 CTGGAGACAGAGAGACAGAAGGG + Intergenic
1153859353 18:9185241-9185263 CTGTAGTCAGTGAGTCAGGAGGG + Intronic
1153979594 18:10297669-10297691 CTGGAGGGGGAGAAGCAGGAAGG - Intergenic
1154269122 18:12904240-12904262 CTGTAGGCAGAGGAGCCTGAGGG - Intronic
1154529158 18:15326093-15326115 TTGAAGGCAGAGAAAGAGCATGG - Intergenic
1155845679 18:30703267-30703289 CAGTAAGCAGATAAAAAGGATGG + Intergenic
1157651619 18:49338523-49338545 CTGTAGTAAGAAAAACAGCATGG + Intronic
1157822602 18:50784644-50784666 CTGTGGCCAGAGATACAGGAGGG + Intergenic
1158614648 18:58975432-58975454 CCGTAAGCACAGAAACAGAAAGG + Intronic
1159782126 18:72672365-72672387 CTGGAAGCAGAGAAAGAGAAGGG + Intergenic
1160242899 18:77135913-77135935 GTGGAGGGAGAGAAAGAGGAAGG + Intergenic
1160620762 18:80169065-80169087 GGGAAGGGAGAGAAACAGGAAGG + Exonic
1161727404 19:5937793-5937815 CTGTGGGGAGAGAGACAGGAGGG + Intronic
1162117775 19:8441988-8442010 CTGTAGGAAGAGCAGCAGGGAGG + Intronic
1162577659 19:11508103-11508125 CTGGGGACAGAGAAACAGAAAGG + Intronic
1162947746 19:14054062-14054084 CTGGAGGCAGAGAAAAGGGGAGG - Exonic
1162947755 19:14054095-14054117 CTGGAGGCAGAGAGAAAGGGAGG - Exonic
1163204909 19:15795219-15795241 AAGTAGGCAGAGAAGAAGGAAGG - Intergenic
1165676211 19:37726228-37726250 CTGTAGAGAGAAAAATAGGAAGG + Intergenic
1166703811 19:44897211-44897233 CTGTGGGTAGAGAAACTGGGGGG + Intronic
1166991514 19:46695641-46695663 ATGGAGACAGAGAACCAGGAAGG + Intronic
1167478300 19:49713350-49713372 CTGGAGGCTGAGAAACAAGAGGG - Intronic
1167538980 19:50073471-50073493 CTGGAGGAAGAGAAGCAGGACGG + Intergenic
1167791954 19:51688754-51688776 CCACAGGCAGAGAAAGAGGATGG + Intergenic
926188367 2:10708984-10709006 CTGAAGGGAGAGAAAAGGGAAGG + Intergenic
926370114 2:12170910-12170932 CAGTTGGCATGGAAACAGGACGG - Intergenic
927010237 2:18896604-18896626 CTGAAGGCTGTGAAACAGGCAGG - Intergenic
927126701 2:20018903-20018925 TTGTAGGAAGAGAAACAGCCTGG + Intergenic
927287462 2:21371536-21371558 CTGGAGAGAGAGAAAGAGGAAGG + Intergenic
927661894 2:25000566-25000588 GAGTAGGCAGAGAAAAAGCAAGG - Intergenic
927920696 2:26970359-26970381 CTGTTGCCAGGGAAAAAGGAAGG + Intergenic
928169725 2:28995448-28995470 AGGAAGGCAGAGAAGCAGGATGG + Intronic
929427507 2:41858222-41858244 GAGTAGGCAGAGGAAGAGGAGGG + Intergenic
929742514 2:44618030-44618052 GTGTATACAAAGAAACAGGAAGG - Intronic
929961675 2:46501480-46501502 ATGTATGCAGAGGAAAAGGATGG + Intronic
931161734 2:59700244-59700266 GAGGAGGCAGAGAAAGAGGAGGG - Intergenic
932219232 2:69987215-69987237 CTGTAGTGAAAGAACCAGGAGGG - Intergenic
932766710 2:74475116-74475138 CTGAAGGCAGAGGTACAGTATGG + Intronic
933693148 2:85195154-85195176 ATGTAGGCAGAGAAAAGGGTAGG - Intronic
934494646 2:94787090-94787112 CTGGAGGCAGGGCAAGAGGAAGG - Intergenic
934729005 2:96644549-96644571 ATGTAGGTGGAGATACAGGACGG + Intergenic
935437477 2:103050857-103050879 CTGTAGGAACAAAAACAGCATGG - Intergenic
936076669 2:109405732-109405754 CTGTAGGCAAAGAGACAGTGGGG - Intronic
936236194 2:110744723-110744745 CTGTAGTCAATGAAATAGGAGGG + Intronic
937128628 2:119490336-119490358 CTGGAAGCAGAGGAACATGAGGG - Intronic
937198544 2:120181389-120181411 GAGTGGGCAGAGAAACAGGCAGG + Intergenic
937295488 2:120807581-120807603 CTCTAGCCTGAGAAACAGCATGG + Intronic
937878850 2:126850151-126850173 CTGTAGTCATGGAAACAGGCTGG + Intergenic
938159484 2:128972815-128972837 TGGCAGGCAGAGAAACAGTAGGG - Intergenic
938394105 2:130929348-130929370 ATGGAGGAAGAGAAACTGGATGG - Intronic
938415282 2:131099070-131099092 CTGAAGGGAGAGAGCCAGGAAGG - Intergenic
938528260 2:132157509-132157531 TTGAAGGCAGAGAAAGAGCATGG - Intronic
939512651 2:143125800-143125822 CTGTTGACACAGTAACAGGAAGG - Intronic
940798621 2:158107612-158107634 TTGGAGGCAGAGGAAAAGGAAGG + Intronic
941359570 2:164535035-164535057 ATGTAGGTAGAAAAATAGGAGGG + Intronic
942961039 2:181829937-181829959 CTGTTGGGAGAGAAGGAGGAGGG - Intergenic
942970270 2:181950059-181950081 ATGTGCACAGAGAAACAGGATGG + Intergenic
943933818 2:193888622-193888644 CTGTAAGCAGAAAAAAAGGAAGG + Intergenic
944304324 2:198162023-198162045 CTTTCGGCAGAGCAACAGGGGGG + Intronic
945400895 2:209381277-209381299 CTGCAAACAGAGAAAAAGGATGG + Intergenic
945404806 2:209432294-209432316 CTGTAGGCAGAGAAACAGGAAGG - Intronic
946276064 2:218632819-218632841 CAGTAGCCAGAGGAGCAGGAAGG + Intronic
947944291 2:234087299-234087321 CAGCAGGCAGAAAATCAGGAAGG + Intergenic
948300530 2:236903440-236903462 CTGTCGGGAGAGTTACAGGAGGG + Intergenic
948461654 2:238132627-238132649 CTGGAGGGAGGGATACAGGAAGG + Exonic
1168743144 20:212126-212148 CTGTAGGTAGAGAAAGAAGGAGG + Intergenic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1168961363 20:1872163-1872185 CTGGAGGCAGCGTAAGAGGAAGG - Intergenic
1170346542 20:15393102-15393124 CTGTTGCCAGAGAATCAGAAAGG - Intronic
1170402717 20:16005104-16005126 CTTTAGACATAGAAACAAGAAGG + Intronic
1170813724 20:19695703-19695725 CTGGAGACTGAAAAACAGGAAGG - Intronic
1171896140 20:30812351-30812373 CGGAAGGGAGAGAAAGAGGAAGG + Intergenic
1172550634 20:35796740-35796762 CTTTGGTCAGAGAAAGAGGAAGG + Intronic
1172919046 20:38466071-38466093 AGAGAGGCAGAGAAACAGGACGG + Intergenic
1173872524 20:46350891-46350913 CTGGGGGCAGAGAAGCAGGAGGG + Intronic
1173948814 20:46974336-46974358 CTGGGGGAAGAGAAACAGGCAGG - Intronic
1173999523 20:47364258-47364280 CTGCAGTCTGGGAAACAGGACGG - Intergenic
1174161675 20:48555459-48555481 CTGAAGGCTGAGCAAAAGGAGGG - Intergenic
1174323753 20:49762664-49762686 CTGTAGGCAGAGCAGCAGCATGG + Intergenic
1175037553 20:56014687-56014709 CTGTAGGGAGAAAAATAGGAAGG - Intergenic
1176768240 21:13042394-13042416 TTGAAGGCAGAGAAAGAGCATGG + Intergenic
1177529688 21:22343184-22343206 CCATAGGCAGAGAAGCAGCATGG + Intergenic
1178304436 21:31479686-31479708 CTGAAGGAAGTGAAAAAGGAAGG + Intronic
1179515626 21:41904409-41904431 CTGTAGGCAGAGAACCCGTACGG - Intronic
1180432798 22:15268675-15268697 TTGAAGGCAGAGAAAGAGAATGG + Intergenic
1180515371 22:16136621-16136643 TTGAAGGCAGAGAAAGAGCATGG + Intergenic
1180702277 22:17788031-17788053 TTGAAGGCAGGGAAGCAGGATGG - Exonic
1180719518 22:17896982-17897004 CTGTCTCCAGAGAAAGAGGAGGG + Intronic
1180784024 22:18536975-18536997 CAGCAGGCAGAGAAAGAGAAGGG + Intergenic
1181127592 22:20711023-20711045 CAGCAGGCAGAGAAAGAGAAGGG + Intronic
1181240924 22:21476327-21476349 CAGCAGGCAGAGAAAGAGAAGGG + Intergenic
1182120925 22:27786187-27786209 CTGAAGGCAGAGAGACAGGAAGG + Intronic
1182364951 22:29772316-29772338 CTGTTGGCAGAGAGACATGGAGG + Intergenic
1182443416 22:30376965-30376987 CTGTCGGGAGGGAAGCAGGAAGG - Intronic
1183266618 22:36830487-36830509 GTGTAGGCAGGGAGAGAGGAGGG - Intergenic
1183526606 22:38326792-38326814 TTGTAGGCAGAGGAACAGCCAGG - Intronic
949146707 3:709703-709725 CTGTGGCAAGAGAAACAGAAGGG - Intergenic
949203278 3:1406778-1406800 CTGAAGGCTAAGAACCAGGAGGG + Intergenic
949225922 3:1695911-1695933 CTATGGGGAGAGAGACAGGAAGG - Intergenic
949681979 3:6524687-6524709 CTGGAGGCAGGGAGACAGGCAGG + Intergenic
950650893 3:14406015-14406037 CTGTGGGTGGAGAAACAGGATGG + Intronic
952155769 3:30641910-30641932 ATGTAGGGAGAGAGAGAGGAAGG - Intronic
952330786 3:32362805-32362827 CTGGAGACAGAGCAACAGGAAGG - Intronic
952942840 3:38456301-38456323 CTGAAGCCAAAGCAACAGGACGG - Intronic
953138432 3:40204689-40204711 GTGAAGGCAGAGAAAGTGGAGGG - Intronic
954293989 3:49664101-49664123 CTTTGGGCAGAGAAGCAGGAAGG + Intronic
954367091 3:50151968-50151990 CTGAAGGGAGAGAGACAGGCTGG - Intergenic
954879904 3:53827270-53827292 CAGTAGGAAGAGAGAGAGGAGGG - Intronic
956262847 3:67364039-67364061 CTGTAGCCAAAGGACCAGGAAGG + Intronic
956289673 3:67648289-67648311 CTGAAGCCAGAGAGAGAGGAAGG + Intronic
956456566 3:69426834-69426856 CACTTGGCTGAGAAACAGGAGGG + Intronic
959589710 3:108064710-108064732 AAGTAAGCAGAGAGACAGGAAGG + Intronic
960043852 3:113177641-113177663 ATGTAAGCTGAGAATCAGGAAGG + Intergenic
960382558 3:116982100-116982122 CTGAAAGCAGATAAACAGCAAGG - Intronic
961768177 3:129228570-129228592 CTGTAGCCAGAGCTACAGGTGGG - Intergenic
962010097 3:131383576-131383598 CTGTACGCATATAAACAGGGAGG - Intronic
962168022 3:133070689-133070711 CTGTACTCAGAGAAACAAAATGG - Intronic
962201325 3:133403327-133403349 CTGCAGGTGGAGAAACAGGAGGG - Intronic
963998271 3:151736953-151736975 ATGGATGCAGAGAAATAGGAAGG - Intronic
964716217 3:159725180-159725202 CTGGTGGCAGAGATACAAGATGG - Intronic
964957065 3:162373674-162373696 CTCCAGGCAGAAAAACATGAAGG + Intergenic
966499960 3:180628000-180628022 CTGTGTGAAGAGACACAGGAAGG + Intronic
967721420 3:192820107-192820129 CTGTGGGGAGAGAAAGGGGAGGG + Intronic
967866148 3:194191670-194191692 CTGTAAGCAGAGCTATAGGATGG + Intergenic
970545401 4:17124736-17124758 CTCTTGGTAGAGAAACTGGATGG + Intergenic
970708961 4:18839398-18839420 CTGAGGGCAGACAAACTGGATGG + Intergenic
970742320 4:19252322-19252344 CTGTTGGCACAGAGTCAGGAGGG - Intergenic
974262951 4:59548144-59548166 CTGAAGGAAGAAAAACATGATGG + Intergenic
974987536 4:69046972-69046994 CTGTAGCTACTGAAACAGGATGG - Intronic
976133842 4:81913628-81913650 CTGTAGGAAGAAGAAAAGGATGG - Intronic
976310034 4:83602208-83602230 CTGTAGTCTCAGACACAGGAAGG + Intronic
976392766 4:84522990-84523012 CTATAGGGAAAGAAGCAGGAAGG + Intergenic
977262207 4:94811318-94811340 CTGAAGGCAAAGAAAGAGCAGGG + Intronic
978403321 4:108353481-108353503 ATGCAGGCAAAGAAACATGAAGG - Intergenic
979217514 4:118183149-118183171 CTACAGGCAGAGATCCAGGAGGG + Intronic
981017596 4:139990007-139990029 CTGTAAGAAAAGAAATAGGATGG + Intronic
981026652 4:140083471-140083493 AAGTAGTCAGAAAAACAGGAAGG + Intronic
981152770 4:141398340-141398362 CTGAATGCAGAGAAACAGAGGGG - Intergenic
981169899 4:141609834-141609856 GTGGAGGCAGAGAAATAGGTAGG - Intergenic
981214357 4:142147026-142147048 ATGTAGGAAGAGAAGCACGAAGG - Intronic
984129271 4:175852768-175852790 CTGCTGTCAGGGAAACAGGAAGG + Intronic
984434287 4:179688761-179688783 CTTTAGCCAGAAAATCAGGAGGG + Intergenic
984890256 4:184485755-184485777 CTGTCTGCAAAGAAACAGGCTGG + Intergenic
985624959 5:980541-980563 CTGTGGCCAGAGAAAGAGGCTGG + Intronic
986165488 5:5268771-5268793 AGGTGGGCAGAGAAAGAGGAAGG - Intronic
988615108 5:32767954-32767976 GTGGAGGCAGGGAAAGAGGAGGG - Intronic
988831355 5:34990403-34990425 CCATAGGCAGAGCAACAGCATGG - Intergenic
989096477 5:37786302-37786324 CTAGAGTCAGAGAATCAGGATGG - Intergenic
989161958 5:38399665-38399687 CTGTAGGCAGGGAAAGCGGTTGG + Intronic
990279298 5:54232384-54232406 AGGTAGGCAGAAAAACAGGAAGG + Intronic
990544580 5:56809946-56809968 CTGTAGGCAGTGTAACACAATGG + Intergenic
990823269 5:59867649-59867671 CTGTAGGTAGTGACAAAGGATGG + Intronic
992168567 5:74078769-74078791 CTCAAGGCAGAGAAACTGGGTGG - Intergenic
992388838 5:76312148-76312170 CTGGACGCAGAGAAACATAAAGG - Intronic
992510514 5:77429000-77429022 CTTTAGAGAGAGAAACAGAAGGG + Exonic
992817467 5:80458329-80458351 CTGTAGGGAGAGTAAGAGGATGG - Intronic
994377625 5:99033038-99033060 CCAGAGTCAGAGAAACAGGATGG - Intergenic
994731358 5:103495340-103495362 CTCTATGCTGAGCAACAGGAAGG + Intergenic
994921245 5:106046801-106046823 CTGTAAGCCAAGAAACAGCAAGG + Intergenic
995653239 5:114395786-114395808 CAGCAGGCAGTGAAGCAGGAAGG - Intronic
997212458 5:132085493-132085515 CTGTGGGGAGAGAAGCAGGAAGG - Intergenic
997529870 5:134575411-134575433 GTCTTGGCAGAGAAACTGGAAGG + Intronic
998029198 5:138849923-138849945 CTGTAAGAAGAGAAACTGAATGG - Intronic
999200321 5:149811839-149811861 TGGTAGGCAGGGCAACAGGATGG - Intronic
1003282961 6:4710282-4710304 CTGCAGAAAGAGAAAGAGGAAGG + Intronic
1003652676 6:7975819-7975841 ATGTAGACAGAGAAGCAGGATGG + Intronic
1004331804 6:14728697-14728719 ATGTGGGCAGAGAAGGAGGAGGG + Intergenic
1005258205 6:24027214-24027236 CAGCAGGAAGAGGAACAGGAGGG - Intergenic
1006288532 6:33116583-33116605 CCTCAGGCAGAGAAACAGTAGGG - Intergenic
1006480002 6:34284707-34284729 CTGTATGTAGAGAAAAGGGAAGG + Exonic
1006795436 6:36729398-36729420 AAGTGGGAAGAGAAACAGGAAGG - Intronic
1006938023 6:37732046-37732068 CTGTAGGCGGAGAAATGGGTGGG - Intergenic
1007651877 6:43427718-43427740 CTGGGGGCGGAGAAACGGGAGGG + Exonic
1010544236 6:77130194-77130216 ATGCTGGCAGAGAAAAAGGAAGG + Intergenic
1011406859 6:87024719-87024741 CTGCAGGCAGAGAATAAGGGTGG - Intergenic
1011491708 6:87899940-87899962 CTGTTGACAGAGCCACAGGATGG - Intergenic
1013108831 6:107048922-107048944 CTGTGGGCTGAGAAGCAGAAAGG - Intronic
1013968355 6:115983734-115983756 CTCTAGGCAGAGAAACAGCAAGG - Intronic
1014015884 6:116529448-116529470 CTGTAGGGTGGGAAGCAGGAGGG - Intronic
1014069429 6:117163992-117164014 CTGTTGGCAGAGAAGGAGGCAGG - Intergenic
1015154276 6:130074566-130074588 CTTCAGGCAGATAATCAGGAAGG - Intronic
1016133780 6:140512065-140512087 CTGCAGGCTGAGAAATATGAGGG - Intergenic
1016556976 6:145349787-145349809 CTGTCTGAAGAGAAGCAGGATGG + Intergenic
1017798955 6:157874519-157874541 CTGCAGGCAGAAAATCAGTAAGG + Intronic
1019018134 6:168895281-168895303 CCGGAGGCAGACAAACAGGAAGG - Intergenic
1019075869 6:169387757-169387779 CTGTAGGCAGAGAGGCAGGTAGG - Intergenic
1019443370 7:1058611-1058633 CTGCTGGAAGAGAAGCAGGAGGG + Exonic
1020239020 7:6378010-6378032 GTGTAAGCAGAGGCACAGGAGGG - Intronic
1021270453 7:18578146-18578168 TTGGAGCCAGAGAAACAAGATGG + Intronic
1021407926 7:20295337-20295359 GTGTAGGCTGAGGAAGAGGAGGG - Intergenic
1022019742 7:26386839-26386861 CTGATGGCAGAGAAAAAGAAGGG + Intergenic
1023551472 7:41374456-41374478 CGGTGGGCACAGACACAGGAGGG + Intergenic
1024378373 7:48665092-48665114 CTGTAGGGAGACAAACAGAAGGG + Intergenic
1024800423 7:53071496-53071518 CTGTAGGAAAAGAAAGAGTAGGG - Intergenic
1025223023 7:57132415-57132437 CTGGACGCAGAGAAACACAAAGG + Intronic
1025746683 7:64249005-64249027 CTGGACGCAGAGAAACACAAAGG - Intronic
1026302024 7:69106440-69106462 CTGTAGGCAGAGCAGCGGCATGG + Intergenic
1026941681 7:74290705-74290727 CTGTGGGCAGAGGAGGAGGAGGG + Intronic
1027176571 7:75907681-75907703 ATGAGAGCAGAGAAACAGGAGGG - Intronic
1028059652 7:86295888-86295910 CTGTAGGTAGACAGACAGGCAGG - Intergenic
1028362749 7:89988618-89988640 CTGCAGGAAGAGGAACAGGTAGG - Intergenic
1029970767 7:104786582-104786604 CTGTAGGCAGAGGAGTAAGATGG + Intronic
1030158725 7:106485077-106485099 CCAGAGGCAGAGAAACAGGTTGG - Intergenic
1032793824 7:135261701-135261723 CTGTGGGCACAGAAGCAGTAGGG + Intergenic
1033225877 7:139561758-139561780 CTGTAGGGTGAGAAAAAGGGGGG - Exonic
1033600634 7:142886018-142886040 CTCTAGGCAGTGAGAAAGGAGGG + Intergenic
1034960944 7:155364007-155364029 CTGCAGGCAGAGAAAGGGGCAGG - Intronic
1035015957 7:155766250-155766272 GTGTAGGCGGAGGAAGAGGAGGG - Intronic
1035232727 7:157476125-157476147 CTGGAGAATGAGAAACAGGATGG + Intergenic
1035303381 7:157913400-157913422 CAGCAGGCAGTGAAGCAGGAAGG - Intronic
1035612912 8:980222-980244 TTGTAGCCAAAGAAACGGGATGG + Intergenic
1036201902 8:6777049-6777071 CTGTGGGCAGAGACACCAGAGGG - Intergenic
1036212303 8:6852326-6852348 CTGTAGGGAGAGAAAGGGGAGGG + Intergenic
1037295370 8:17394523-17394545 GTGTAGGGAGAGAGAAAGGAGGG + Intronic
1039450092 8:37666134-37666156 CTGAAGGCAGAGTAACAGAGAGG + Intergenic
1040064350 8:43133052-43133074 CTCTGGCCAGAGAAACATGAAGG + Intergenic
1041524933 8:58794821-58794843 CTGGAGAAAGAGAAGCAGGAAGG + Intergenic
1041601168 8:59718778-59718800 GAGTAGGCAGAGAAGGAGGAAGG + Intergenic
1041850733 8:62389035-62389057 CTGTGGGTAGAGAAACTGAAGGG + Intronic
1042187617 8:66152633-66152655 CTGTAGAAAGAGACTCAGGAGGG - Intronic
1042378051 8:68078633-68078655 CTGGAGATAGGGAAACAGGATGG - Intronic
1043538243 8:81229847-81229869 GTGTTCGCAGAGAAGCAGGAAGG - Intergenic
1044490555 8:92809242-92809264 CTGAAGGCACAGGCACAGGATGG + Intergenic
1044751057 8:95415827-95415849 CTGTAGGGAAAGAAAAAGGGAGG - Intergenic
1045372255 8:101536031-101536053 ATTTAGACAGAGAAGCAGGAAGG + Intronic
1045823328 8:106367849-106367871 TTTCAGGCAGAGAAACAGAAAGG + Intronic
1049211900 8:141390802-141390824 CAGTGGGCTGAGAGACAGGATGG + Intergenic
1049980300 9:898054-898076 TTGAAGGGAGAGAAACTGGATGG + Intronic
1050448836 9:5758045-5758067 CTGTAGGGAGAGCAACTGGGAGG + Intronic
1051064933 9:13092116-13092138 GTGTGGCCAGTGAAACAGGAGGG + Intergenic
1051182015 9:14421166-14421188 ATGAAGGAAGAAAAACAGGAAGG - Intergenic
1052721210 9:32173205-32173227 CTGGAGGCAGAGAGAAGGGAGGG - Intergenic
1052764531 9:32627216-32627238 TTGAAGGCAGAGAAAGAGAAAGG - Intergenic
1052859390 9:33427520-33427542 CTGTGGGGAGAGAGAAAGGAAGG + Intergenic
1055332237 9:75196666-75196688 CTGGAAGCAGGGAAACAGTAAGG - Intergenic
1056455552 9:86756217-86756239 CTGTAGGCAGAAAATCAAGTTGG + Intergenic
1056609044 9:88113089-88113111 ATGGAGGCAGAAAAACAGGGTGG - Intergenic
1056968782 9:91185779-91185801 CTTTAGGCAAAGAAGCAGGAAGG - Intergenic
1057426267 9:94952404-94952426 CAGACAGCAGAGAAACAGGAAGG - Intronic
1057976033 9:99607337-99607359 CTGTTAGCAAAGAAACAAGAAGG - Intergenic
1058547639 9:106077844-106077866 CTGTAGCCATAGCAACAGGGAGG - Intergenic
1060765092 9:126289472-126289494 ATGAAAGCAGAGAAACAGAAAGG + Intergenic
1061306917 9:129737695-129737717 CTCTCGGGAGAGAAACGGGAAGG - Intergenic
1061372966 9:130208163-130208185 ATGTAGGCAGAGAAGAAAGATGG + Intronic
1061680116 9:132238841-132238863 CTGTGGGCAGGGAACCAGGGAGG - Intronic
1061990412 9:134155679-134155701 CTTCAGGCACTGAAACAGGAGGG - Exonic
1062213035 9:135374798-135374820 CTGTAAGTGGATAAACAGGAAGG - Intergenic
1062455420 9:136634921-136634943 CTGTAGGGAAAGGAAGAGGAGGG + Intergenic
1062571462 9:137187650-137187672 CTATATGCAGAGTAAGAGGAAGG - Exonic
1185727639 X:2435157-2435179 ATGCAGAGAGAGAAACAGGAGGG + Intronic
1186217234 X:7313095-7313117 CTGTAGGCAGAGAAAAAGGGAGG - Intronic
1186371953 X:8955844-8955866 TTATGGGCAGAGAAGCAGGATGG - Intergenic
1186483435 X:9914028-9914050 GTGGAGGCGGAGAAACAGAAAGG - Intronic
1187032058 X:15498211-15498233 CTTTAGCCAGAGCAACTGGAGGG + Intronic
1188053284 X:25512415-25512437 ATGTAGGCTGAGAAACACGCTGG - Intergenic
1190445441 X:50519381-50519403 CTGTAGGCAGAGAAAAGTGCTGG - Intergenic
1190817251 X:53939331-53939353 TTGTGGGTAGAGAAACAGGAAGG - Intronic
1192797089 X:74432934-74432956 CTTTAGGGAGGGAAACAGGGTGG - Intronic
1195065066 X:101232863-101232885 ATGTAGGCAGGGAAACCTGAGGG + Intronic
1195403910 X:104492184-104492206 CTACAGGCAGAGAAAAAGGGAGG - Intergenic
1197882470 X:131181349-131181371 CAGAAGGAAGAGAAACAGGAAGG - Intergenic
1198481702 X:137047189-137047211 CAGTAGGCAGAGGAAGAGGGGGG + Intergenic
1199404928 X:147445525-147445547 CTGTAGACAGAGCAGCAGCATGG - Intergenic
1199427025 X:147714455-147714477 GTGTAAGCAGAGAAACAGAAGGG - Intergenic
1199703114 X:150400038-150400060 CTGTTGTCAGAGAAACAAGACGG + Intronic
1200175419 X:154112047-154112069 CAGCAGGCAGAAAATCAGGAAGG - Intergenic
1200702394 Y:6413265-6413287 CTCTAGGATGAGAAACAGGCAGG - Intergenic
1200910348 Y:8526337-8526359 CTGTAGGGTGAGAAGCAGGTAGG + Intergenic
1200915306 Y:8566155-8566177 CTGTAGGATGAGAAGCAGAAAGG + Intergenic
1200984765 Y:9293195-9293217 CTGTAGGATGAGAAGCAGGCAGG - Intergenic
1201031717 Y:9751433-9751455 CTCTAGGATGAGAAACAGGCAGG + Intergenic
1201587586 Y:15577882-15577904 CTGTAGGCAGAGAAAAAGAGAGG - Intergenic
1201716013 Y:17044572-17044594 CTACACACAGAGAAACAGGATGG + Intergenic
1202125676 Y:21566992-21567014 CTGTAGGATGAGAAGCAGGCAGG + Intergenic
1202153332 Y:21862400-21862422 CTGTAGGATGAGAAGCAGGCAGG - Intergenic