ID: 945404893

View in Genome Browser
Species Human (GRCh38)
Location 2:209433447-209433469
Sequence GACACTTAAGTCAGAACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945404887_945404893 19 Left 945404887 2:209433405-209433427 CCAATGGTACTGGAGTCCAACAG 0: 1
1: 0
2: 2
3: 5
4: 73
Right 945404893 2:209433447-209433469 GACACTTAAGTCAGAACAGAAGG 0: 1
1: 0
2: 0
3: 12
4: 161
945404890_945404893 3 Left 945404890 2:209433421-209433443 CCAACAGACACGGTAGAGGATAC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 945404893 2:209433447-209433469 GACACTTAAGTCAGAACAGAAGG 0: 1
1: 0
2: 0
3: 12
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945404893 Original CRISPR GACACTTAAGTCAGAACAGA AGG Intronic
900033822 1:390583-390605 GCCAGTTAAGTCAGAACTGCTGG - Intergenic
900054657 1:620473-620495 GCCAGTTAAGTCAGAACTGCTGG - Intergenic
905232625 1:36523943-36523965 GCCAATTTAGTCAGAACAAAGGG + Intergenic
905968035 1:42115937-42115959 GACAATGTAGTCAGAGCAGAGGG + Intergenic
911315798 1:96355246-96355268 GAAAACTAAGTCAGAGCAGAAGG - Intergenic
911626400 1:100129897-100129919 TACACTAAAGTCAGAGAAGAAGG - Intronic
911757142 1:101571660-101571682 TATACTTAACTCAGATCAGATGG + Intergenic
913045631 1:115071428-115071450 GACACTGAAGACAGCAGAGAGGG + Intronic
913576256 1:120178145-120178167 CACACTTAAGTGAGAACATACGG + Intergenic
915660907 1:157404123-157404145 GAAACTTAAATCATATCAGAAGG + Intergenic
916537270 1:165715106-165715128 GACACTAAATTGAGAAAAGAGGG - Intergenic
916827258 1:168454146-168454168 TGCCCTTAAGTCAGAACAGCTGG + Intergenic
917075947 1:171205110-171205132 GAGAATTAAGTCAGAAAATAAGG + Intronic
918447496 1:184629898-184629920 GACAGTGAAGACAGAGCAGAGGG - Intergenic
920422324 1:205843515-205843537 GACACTAGAGGAAGAACAGAAGG - Intronic
920555646 1:206902355-206902377 GCAACTGAAGTCAGAAGAGAGGG + Intronic
921104101 1:211959098-211959120 GACACTTGAGTTGGCACAGAGGG + Intronic
922256178 1:223894739-223894761 GCCAGTTAAGTCAGAACTGCTGG - Intergenic
924337384 1:242997605-242997627 GCCAGTTAAGTCAGAACTGCTGG - Intergenic
1064117603 10:12592126-12592148 GTCACTTAAGACAGGAGAGAAGG + Intronic
1064249155 10:13693633-13693655 GACACTTAAGTGTGACCAGCAGG + Intronic
1067990254 10:51204061-51204083 GGTACTAAAGTCAAAACAGATGG - Intronic
1068419834 10:56777068-56777090 GAAATATGAGTCAGAACAGAAGG + Intergenic
1070868796 10:79729486-79729508 GATACTTAAGTCAAAATAGTTGG - Intergenic
1072447076 10:95508490-95508512 ACCACTTATGTCAGAACAAAAGG + Intronic
1073127561 10:101161183-101161205 GTCACTGAAGTCAGGAAAGAGGG - Intergenic
1074702153 10:116101993-116102015 GACACTGAAATCATAACAGTAGG - Intronic
1075447371 10:122522710-122522732 GCTACTGAAGTCAGAGCAGAGGG + Intergenic
1075531601 10:123234809-123234831 GACACTTAACACAGACCTGAGGG - Intergenic
1078450419 11:11436776-11436798 GACACTGAACTCAGGACAGAGGG + Intronic
1081109337 11:39114561-39114583 TACACTTAAGTGATTACAGATGG + Intergenic
1084150434 11:67285640-67285662 GCCCCTGAAGTCAGGACAGAGGG - Exonic
1084276373 11:68053154-68053176 GACACTCCAGGCAGAGCAGAGGG + Exonic
1088980342 11:114857503-114857525 AACAGTTAAGTAAGAAAAGAAGG - Intergenic
1089143538 11:116307497-116307519 GAACCCTCAGTCAGAACAGAGGG + Intergenic
1090642038 11:128738147-128738169 GGCACTTAAGTCAGGAGAGCAGG - Intronic
1090942339 11:131397932-131397954 GACAATTATGTCAGTACAAAGGG + Intronic
1095709659 12:45274865-45274887 GACATTCAAGTGAGAACTGAAGG - Intronic
1096414722 12:51403250-51403272 GCCACTCAAGCCTGAACAGAAGG + Intronic
1096748623 12:53744731-53744753 GACTCTTAAGTGAGACCAGAAGG - Intergenic
1098238916 12:68446046-68446068 CACACTTAAGTAAGAACACGTGG - Intergenic
1099499640 12:83397717-83397739 AACAATTAGATCAGAACAGAAGG + Intergenic
1101414788 12:104499636-104499658 GACACTTAAGTCTGGACAGCAGG + Intronic
1101891984 12:108725344-108725366 GACATTTAAGAGAGAAGAGAGGG + Intronic
1101938792 12:109083479-109083501 GATACATAATTCAGTACAGAAGG - Intronic
1102786870 12:115612120-115612142 GACACTTAAGGAAGCCCAGAAGG - Intergenic
1104096782 12:125565451-125565473 AACACTTAAGCCATCACAGATGG - Intronic
1104098692 12:125585568-125585590 GGCTCTTAGGTCAGAACAAAAGG - Intronic
1104099801 12:125596423-125596445 GAAAATGTAGTCAGAACAGAAGG - Intronic
1104630666 12:130399317-130399339 GAGACTAAAGTCCTAACAGAGGG + Intronic
1106665857 13:31849629-31849651 CACTCTTACGTCAGAATAGAAGG + Intergenic
1106909273 13:34445874-34445896 TACATTTATGTCTGAACAGAGGG - Intergenic
1107256816 13:38437284-38437306 AACACTTAACTCTGAAGAGAGGG + Intergenic
1111619476 13:90705292-90705314 GGCATTTAAGTCAGAATGGAAGG - Intergenic
1115103071 14:29726527-29726549 GACACTTATGTCAATACAGGTGG + Intronic
1115264708 14:31489029-31489051 GACACTGAGGTCAGCACAGAAGG - Intergenic
1115430855 14:33317013-33317035 GACACTGAAGTCAAATCTGAAGG - Intronic
1119172181 14:72544028-72544050 CACACTTAAGAGAGAGCAGAGGG - Intronic
1120484770 14:85099268-85099290 GAAACTTAAGGAAGAAGAGAAGG + Intergenic
1121210533 14:92205229-92205251 GACAATGAAGTCTAAACAGAAGG - Intergenic
1127445417 15:59057486-59057508 GACAATTAAATCTGAAAAGAAGG - Intronic
1127888538 15:63226395-63226417 GATACTGAAGTCAGAAAAGTGGG - Intronic
1128646072 15:69379840-69379862 GACACTGAGGTGAGACCAGAGGG - Intronic
1130333061 15:82936095-82936117 GAGACTGAAGTCAGACCAGCAGG - Intronic
1135239856 16:20794831-20794853 AACTCTGAAGTCAGAACAGCTGG - Intronic
1136245912 16:28975595-28975617 CCCACTTGAGACAGAACAGAAGG - Intronic
1141194721 16:81851902-81851924 GACAATTAAGTTAGAGGAGAGGG - Intronic
1141213578 16:82003564-82003586 CACACTGAAGTGAGAACAGGAGG - Intronic
1142923859 17:3215524-3215546 ATCACTTAAGTCAGAAGTGATGG + Intergenic
1150514378 17:65792789-65792811 TACTGTTAAGTCAGAACATATGG + Intronic
1153576288 18:6524942-6524964 GACAGTTAAGACAGAATGGAAGG + Intronic
925499952 2:4491351-4491373 AAATTTTAAGTCAGAACAGAAGG + Intergenic
928550752 2:32368135-32368157 GCCACTTAAGTCAGAATACTGGG - Intronic
929858924 2:45658740-45658762 GAATCTTAAATCAGAACATATGG + Intronic
930324809 2:49901969-49901991 CTGGCTTAAGTCAGAACAGATGG - Intergenic
933373775 2:81451833-81451855 GACACTGAAATCAGCAGAGAAGG - Intergenic
934050667 2:88207868-88207890 AACACTTAAGTCACACCAGAGGG + Intergenic
934669700 2:96203276-96203298 GAGACTTAAGAGAGGACAGAAGG + Intronic
938267691 2:129940492-129940514 CTCACTTAAGTAAGAACATATGG + Intergenic
938627767 2:133129827-133129849 GATGCTTCAGTCAGAACAGAAGG + Intronic
938950742 2:136252208-136252230 CAGATTAAAGTCAGAACAGAAGG - Intergenic
940923125 2:159331846-159331868 GACACATAAGACAGAATAGGAGG + Intronic
945404893 2:209433447-209433469 GACACTTAAGTCAGAACAGAAGG + Intronic
945447792 2:209958769-209958791 GTCACTTAAGACAGAGCACATGG + Intronic
946526180 2:220523255-220523277 GACACTTAAAAGAGATCAGATGG + Intergenic
947425221 2:229977300-229977322 GAAACCCAACTCAGAACAGATGG - Intronic
1170826545 20:19801143-19801165 TACACTTAAGTCAGAAAGGGAGG - Intergenic
1175222670 20:57426298-57426320 GACACTGAGGTCTGCACAGATGG + Intergenic
1177972344 21:27806113-27806135 GACATTTAAGTCAAAAAATAAGG - Intergenic
1180641877 22:17305381-17305403 GAAACTTAAGTCAGAGAAAAGGG - Intergenic
1181799567 22:25335687-25335709 GGCAATGAAGTCAGAACCGAAGG + Intergenic
949211591 3:1509629-1509651 GACACAGAAGTCATAACAAATGG + Intergenic
951115573 3:18857660-18857682 AACATTTAAGTCATAACACATGG + Intergenic
951969448 3:28427758-28427780 CACACTTAAGTCATAAAAGTGGG - Intronic
952428411 3:33198898-33198920 GACACTGAAGTCAGCAGACATGG + Intronic
956696431 3:71922796-71922818 AACACTTAAGCCAAAACAAAGGG + Intergenic
957140566 3:76349705-76349727 GACTCTTAAGTCAGAAACAAAGG + Intronic
962677967 3:137770340-137770362 GAGCCTGAAGTCAGAAAAGATGG + Intergenic
964842529 3:161009656-161009678 TACTCTTAAGTCAGAAAAGGTGG + Intronic
964849940 3:161084836-161084858 GACTCTGAAGGCAGAAAAGAAGG - Exonic
970778103 4:19702028-19702050 GACACTTAACTCAGTACAAGAGG + Intergenic
972698467 4:41470726-41470748 AACCATTAAGTCAGAAAAGATGG - Intronic
973785667 4:54330472-54330494 GACATTTAAGCCATAACAGTTGG + Intergenic
974876026 4:67703770-67703792 GAAACTTAAATCATAGCAGAAGG + Intergenic
977418859 4:96770678-96770700 GACATTTAAGGAAGAACAGTAGG - Intergenic
979239749 4:118437703-118437725 GCCAGTTAAGTCAGAACTGCTGG + Intergenic
983376119 4:166930641-166930663 GACACTTAAATTACCACAGAAGG + Intronic
986253748 5:6084335-6084357 GAGATTTTAGTTAGAACAGATGG + Intergenic
986888228 5:12266640-12266662 GACACTTTAGTCACAAAAGCTGG - Intergenic
992687144 5:79209995-79210017 GACACTTCAGCTAGAACAGAAGG - Intronic
994709271 5:103246522-103246544 GACACATACGTCAGAAAACAAGG - Intergenic
995076006 5:107983693-107983715 AACACCTAAGCCAGGACAGAAGG + Intronic
997153631 5:131527256-131527278 GCCACTTAGGTCACAACAGCAGG + Intronic
997551522 5:134757653-134757675 GCCAATTAAATCAGAACATAGGG + Intergenic
999311163 5:150553166-150553188 CACTCTTAAGTCAGTACACAAGG + Intronic
1002739998 5:181428285-181428307 GCCAGTTAAGTCAGAACTGCTGG + Intergenic
1009247408 6:61256273-61256295 CCCACTTAAGTCAGAACATGTGG + Intergenic
1010808994 6:80277043-80277065 TACCCTAAAGTGAGAACAGATGG - Intronic
1012752599 6:103183128-103183150 GACTCTTAAATGAGAAAAGAAGG - Intergenic
1013849139 6:114492987-114493009 GACACTTAAGCCATAAGTGAAGG + Intergenic
1014766676 6:125415161-125415183 CACACTTTAGTCAGAAGATATGG - Intergenic
1016269836 6:142275924-142275946 GAGCCTAAAGTCAGAAAAGATGG - Intergenic
1018485660 6:164238701-164238723 GATACTTAAGTGAGATCATAAGG + Intergenic
1019245110 6:170703885-170703907 GCCAGTTAAGTCAGAACTGCTGG + Intergenic
1020913923 7:14168695-14168717 TACAATTAAGTCAGAAGAGCTGG + Intronic
1021974401 7:25997698-25997720 GAAACTTAAATCACAGCAGAAGG + Intergenic
1022125496 7:27352395-27352417 GCCACATAAGTCAGCACAGTGGG - Intergenic
1022339033 7:29451153-29451175 GCCACACAAGTAAGAACAGATGG + Intronic
1024296276 7:47845229-47845251 GACACCTAAGTTAGAAATGAGGG + Intronic
1024544830 7:50508452-50508474 GGCACTTACGTGAGCACAGAGGG - Intronic
1030920865 7:115384525-115384547 GACAGTTAAATCCAAACAGATGG + Intergenic
1033155559 7:138954315-138954337 GATACTAAAGAAAGAACAGAAGG + Intronic
1033262562 7:139856392-139856414 GACACAGAACTCAGAACTGAGGG + Intronic
1035503012 8:104317-104339 GCCAGTTAAGTCAGAACTGCTGG - Intergenic
1037355374 8:18013669-18013691 GACACTTAATGCAGACAAGAAGG - Intronic
1038085547 8:24192625-24192647 GTCACTTTAGCTAGAACAGATGG - Intergenic
1038523820 8:28256485-28256507 TACACTTAAATCAGTACACAGGG - Intergenic
1038705269 8:29887570-29887592 GACAGGAAAGTCAGACCAGATGG - Intergenic
1038991113 8:32869345-32869367 GACACTTCACTCAGAAGAAAGGG + Intergenic
1039006838 8:33048203-33048225 GACACATAAAGCAGAACTGATGG + Intergenic
1043631142 8:82335867-82335889 GACACTTAAGTTGTAACAAAAGG + Intergenic
1044852985 8:96447191-96447213 GACAAATAAGTCAGACCAGTTGG + Intergenic
1045546797 8:103136768-103136790 GACAATCAGGACAGAACAGAAGG - Intronic
1046097887 8:109581907-109581929 GACACTTTATACGGAACAGATGG + Intronic
1046219498 8:111194599-111194621 TACACCAAAGTCAGAAAAGAAGG + Intergenic
1046421755 8:113994283-113994305 GACATTTAAGTCAGTACACTAGG + Intergenic
1046448653 8:114358822-114358844 GAGACTTAAGTCTGAACAGCAGG + Intergenic
1047562242 8:126000056-126000078 GACTCTTATGTCAGAAGAGGAGG + Intergenic
1047770549 8:128027081-128027103 GATTCTTATGTAAGAACAGAGGG - Intergenic
1048382761 8:133882499-133882521 GACACTGAACTCAGAGCACATGG + Intergenic
1050130271 9:2405173-2405195 GACACTTAAATCATAAAAGTGGG + Intergenic
1051248468 9:15135789-15135811 GACCCTTAATTCAGAACCAACGG + Intergenic
1051470124 9:17429723-17429745 GACTCTATAGTCAGAACACAAGG - Intronic
1051963277 9:22794303-22794325 GATACTCAAGTCAGAATAGTAGG + Intergenic
1052655958 9:31360911-31360933 GACACTTAATTCAGAAGATAAGG + Intergenic
1055589862 9:77800987-77801009 TACACAGAGGTCAGAACAGAGGG + Intronic
1058295339 9:103299572-103299594 GGCACTGAAGACACAACAGAGGG + Intergenic
1058700516 9:107596381-107596403 GACACTGAAATCAGACCAGGAGG - Intergenic
1059163444 9:112056920-112056942 GACATTTAATTCATAACAGAGGG - Intronic
1203605305 Un_KI270748v1:53093-53115 GCCAGTTAAGTCAGAACTGCTGG + Intergenic
1186380678 X:9055369-9055391 AACACACAAGGCAGAACAGAGGG + Intronic
1187592959 X:20739167-20739189 GATACTTAAGCCAGGACAAAAGG - Intergenic
1188580102 X:31701458-31701480 GACACCTAAATCTGAAGAGAAGG - Intronic
1192059601 X:67810534-67810556 CAGACTTAAGTCCTAACAGATGG + Intergenic
1193257069 X:79361743-79361765 CTCACTTAAGTGAGAACATACGG + Intronic
1196629063 X:117914629-117914651 GACACTTTGGTAAGAACAAAGGG + Intronic
1196762843 X:119215343-119215365 CACACATAAGTCAGAACATGTGG - Intergenic
1199909803 X:152272898-152272920 GAAACTTAAATCAAAGCAGAAGG - Intronic
1200382215 X:155849901-155849923 GAAATTGAAGTCAGAAGAGATGG + Intergenic
1201494349 Y:14576743-14576765 GAAAGTTAACTCAGAACAGAAGG + Intronic
1202301428 Y:23419802-23419824 AAAACTTAAGTCAGATCGGATGG - Intergenic
1202387490 Y:24339533-24339555 GCCAGTTAAGTCAGAACTGCTGG + Intergenic
1202483296 Y:25330595-25330617 GCCAGTTAAGTCAGAACTGCTGG - Intergenic
1202569383 Y:26250796-26250818 AAAACTTAAGTCAGATCGGATGG + Intergenic