ID: 945405154

View in Genome Browser
Species Human (GRCh38)
Location 2:209437839-209437861
Sequence CTCAAATACAAGTCCTGATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 121}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945405154 Original CRISPR CTCAAATACAAGTCCTGATA AGG (reversed) Intronic
904389262 1:30170742-30170764 CTCACATACAAGTCTTTATGTGG - Intergenic
907968383 1:59356171-59356193 CTCAAATTCAAGTGCTCAGAGGG - Intronic
908073290 1:60487533-60487555 GCCAAAAACAAGTACTGATATGG + Intergenic
911319374 1:96394393-96394415 ATCAAAAACAATTCCTGAGATGG + Intergenic
911889723 1:103352911-103352933 CTCAAATACCTGTCATGATGTGG + Intergenic
913105646 1:115611863-115611885 TTCAAAAACAAGTCCTTTTATGG + Intergenic
916998807 1:170332259-170332281 CCCAATTACAAGTCCTGAAAAGG - Intergenic
918682832 1:187376732-187376754 TTAAAATACAATTCCTGATATGG + Intergenic
919242910 1:194937577-194937599 CTCATATAAAACTCCTGACAGGG - Intergenic
919546331 1:198924196-198924218 CTCTGATAAAAGTCCTGCTAAGG - Intergenic
920804679 1:209221679-209221701 CTCAAATTCAAGACTTGGTAAGG - Intergenic
1063097091 10:2917798-2917820 CTCCAATCCAACTTCTGATATGG - Intergenic
1065241041 10:23704767-23704789 CTAAAATACAAGTCTTTTTATGG + Intronic
1068954553 10:62810854-62810876 CTCAAATTCTAGTGCTGGTAAGG + Intergenic
1069974606 10:72202635-72202657 CTCAAATAACTGTTCTGATAAGG - Intronic
1070109503 10:73470199-73470221 CTCAAATACAAATCTTCATGGGG + Intronic
1071103667 10:82068959-82068981 CTCAAATACAATTCTTGTTTTGG - Intronic
1071716840 10:88105353-88105375 CTCAAATACTAGTCATCATCAGG + Intergenic
1072052359 10:91718292-91718314 TTCATATACAAGTCTTGGTATGG - Intergenic
1072434688 10:95404269-95404291 CTCAGAGCCAAGTCCTGATAAGG + Intronic
1074886698 10:117699653-117699675 CCCTAATCCAAGTCCTTATAAGG + Intergenic
1076802857 10:132839559-132839581 ATTCAATACAAGTGCTGATAGGG + Intronic
1079007002 11:16798638-16798660 ATCAATTACAAGTGCTGACAAGG + Intronic
1079315804 11:19406953-19406975 CCCAAACACAATTCCTGAAAGGG - Intronic
1079930531 11:26554389-26554411 TTCATCTACAAGTCCTTATATGG + Intronic
1085946188 11:81276616-81276638 GTCAAAAACAAATCATGATAGGG - Intergenic
1088017546 11:105079052-105079074 GTCAAAAACAAGTCATGATCTGG - Intronic
1089025533 11:115265823-115265845 CTCAAAGAAAAGACCTGAGAGGG - Intronic
1089857382 11:121558515-121558537 CTCAAATACTACTCCAGAAAAGG - Intronic
1095208201 12:39462417-39462439 AGCAAATCCAAGTCCTGGTAAGG - Intergenic
1099138857 12:78943791-78943813 CTCAACTACAATTCATCATATGG + Intronic
1100609187 12:96177110-96177132 CTCCAAGCCAAGTCCTGACAGGG - Intergenic
1108420059 13:50239774-50239796 CTCAAAAAAAAGTGCTGACAGGG - Intronic
1113221293 13:108106237-108106259 CTTAAATATAAGACCTGAAATGG + Intergenic
1113262287 13:108577907-108577929 CTCAAATACAACTCCTCAAGTGG - Intergenic
1113912167 13:113847737-113847759 ATCAATTACACGTCCTGACAAGG + Intronic
1123120476 14:105914034-105914056 CTCCAATACCAGTCCGGATGGGG - Intergenic
1127111776 15:55681171-55681193 CTCAATTAAAAGTAATGATACGG - Intronic
1128873305 15:71180980-71181002 ATCAAATACCAGTACTGAAATGG + Intronic
1133533214 16:6674815-6674837 CTGAAATCAAAGTCCTAATAGGG - Intronic
1138557236 16:57778923-57778945 ATGAAAAACAAGTGCTGATAAGG + Intronic
1150549155 17:66192676-66192698 CTCAAAGACAAATCATGCTAAGG + Intergenic
1151781595 17:76250238-76250260 CTCAAATACATATCCTGACTTGG - Intergenic
1154064597 18:11095224-11095246 TTCAAGTCCAAGTGCTGATAAGG - Intronic
1154137941 18:11796953-11796975 CTCAAAAATAAGTTCTGATAGGG - Intronic
1158340404 18:56459921-56459943 CTCAAAGACAATTCCCCATAAGG + Intergenic
925178817 2:1803551-1803573 TCCAAATAAAAGTCTTGATACGG + Intronic
925467561 2:4121737-4121759 TTCAAATACAACTTTTGATAAGG - Intergenic
929195529 2:39180643-39180665 CTCAAATCCTAGTACTGTTAGGG + Intronic
930666146 2:54100681-54100703 CTTAAATACTATTCCTGACATGG - Intronic
932143292 2:69297943-69297965 TTCAAATACAAGACCTGACCAGG + Intergenic
933418233 2:82014610-82014632 CAGAAATACAAGTACTGGTAAGG - Intergenic
934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG + Intergenic
935004151 2:99054381-99054403 CTTAAATATAAGACCTGAAACGG + Intronic
937487046 2:122326154-122326176 CCAAAATATAAGTCCTAATAAGG - Intergenic
937616958 2:123935772-123935794 CACAAGCACCAGTCCTGATAGGG + Intergenic
939899961 2:147840019-147840041 CTATAATACAAGTCCACATAAGG - Intergenic
941027393 2:160472686-160472708 CTTAAATAAAAGTCCAAATAAGG + Intronic
941422054 2:165294894-165294916 CTCAAGTCCAAATTCTGATATGG + Intronic
942155472 2:173123030-173123052 CTCAACTACATCTCCTGAAAAGG - Intronic
942198402 2:173545948-173545970 CTCAAATAAAAATACAGATATGG - Intergenic
943404737 2:187466220-187466242 GTTAAATACAACTCATGATAAGG - Exonic
944353621 2:198759104-198759126 CTAAAATGCAAGTCCTGATTTGG + Intergenic
945338489 2:208620468-208620490 CTCAAATACAAGTTTTAAAATGG + Intronic
945405154 2:209437839-209437861 CTCAAATACAAGTCCTGATAAGG - Intronic
946912070 2:224473619-224473641 CTCAAGTACACATCCTGATTTGG - Exonic
948286205 2:236787402-236787424 TTCAAATATAAGCCCTGATATGG + Intergenic
1168928656 20:1603804-1603826 CTCAAATACTGCTCCTGGTAAGG - Intronic
1169689058 20:8309783-8309805 CAAAAATACAAGTCCTGGTTTGG - Intronic
1172735529 20:37124408-37124430 ATAAAATACAGGTTCTGATATGG - Intronic
1173392235 20:42645528-42645550 CTCAAAAACAGATCCTGATTTGG - Intronic
951500140 3:23376852-23376874 CTCACATATGAGTTCTGATAAGG + Intronic
952274068 3:31860145-31860167 TTCAAATACAAGGCCTTTTAGGG - Intronic
953308033 3:41848503-41848525 CTCAAATACAAAACCTGAAAGGG + Intronic
953384440 3:42498589-42498611 CTCAAGGACAAGTTCTGAAATGG - Intronic
953656767 3:44860670-44860692 CTCAAATAAAAGCACGGATAAGG - Intronic
957570322 3:81939144-81939166 CTCAAAAAAAAGTCCTGGTAGGG - Intergenic
958729946 3:97950840-97950862 ATCAAATACAAGCCCCGAGATGG + Exonic
959861429 3:111219954-111219976 GTCAAATACAATTCCTCAGAAGG + Intronic
963587542 3:147211594-147211616 TGCAAATACAAGTGCTGAAAGGG - Intergenic
964450397 3:156807072-156807094 CTCAACCAAAAGTACTGATAAGG - Intergenic
966091974 3:176149839-176149861 CTCAAATAATAATGCTGATATGG - Intergenic
969719301 4:8884502-8884524 CTCACATACCTGTCCTGACAGGG + Intergenic
969946192 4:10785586-10785608 CACAAATATATGTACTGATATGG - Intergenic
972116408 4:35640305-35640327 TTTAAATACAAGTCATGAAAAGG + Intergenic
972719343 4:41680280-41680302 CACAAATACAGTTCGTGATAAGG + Intronic
978841084 4:113213474-113213496 CTCAAATATAAGTCTTGAGAAGG + Intronic
980807962 4:137837888-137837910 TTTACATACAAGTCCAGATAAGG - Intergenic
983773611 4:171579082-171579104 CTGAAAAACAAATCATGATAAGG + Intergenic
987810098 5:22823578-22823600 TACTAATACAAATCCTGATATGG + Intronic
992606977 5:78467531-78467553 CTCGAATAAAAGTATTGATATGG + Intronic
993527536 5:88984857-88984879 ATCAAATTGAAGTGCTGATATGG + Intergenic
994864426 5:105247583-105247605 TTCAAAGACAAGTCCTGTTAAGG + Intergenic
995313744 5:110741902-110741924 CTCAAAGTCAAATTCTGATAGGG - Intronic
995378568 5:111506523-111506545 TTCAAATACAAATCCTTTTATGG - Intronic
996281900 5:121739996-121740018 CTCAAAAACTAATCCTCATAAGG + Intergenic
998467222 5:142356088-142356110 CTTGAATACAAGCCTTGATAAGG - Intergenic
1007957859 6:45933567-45933589 CTAAAATACTTGTCCTAATAAGG - Intronic
1013413664 6:109905304-109905326 ATCAAATACAGAGCCTGATACGG + Intergenic
1013924874 6:115459808-115459830 CTAAAATACAAGTGCTGATTGGG + Intergenic
1015342918 6:132122657-132122679 CTCACATACAATTCATGATTGGG + Intergenic
1016668630 6:146674132-146674154 CTCAATTACAATTTGTGATATGG + Intronic
1021128752 7:16885320-16885342 CACAAATACCTGTCCTAATATGG - Intergenic
1023933471 7:44722285-44722307 CTCAGACAGAAGTCCAGATAAGG + Intergenic
1024899340 7:54299982-54300004 CTCAGATACAATTCCTCATGTGG - Intergenic
1026298553 7:69077614-69077636 CTCAAAAACAAGTCCTTGGATGG + Intergenic
1026456444 7:70576436-70576458 CCAAAATGCAAGTGCTGATATGG - Intronic
1028890846 7:95986982-95987004 CTCATATAGAAGCACTGATATGG - Intronic
1029038475 7:97548417-97548439 CTGAAATATGAGTCCTGAAAAGG + Intergenic
1030655070 7:112158489-112158511 ATCAAATACAAGAACTGATAAGG + Intronic
1031460395 7:122041796-122041818 CTCAAATTTAACTCCTGAGATGG - Intronic
1032564193 7:132924481-132924503 CTCAATTTCAAGTCGTGGTAGGG - Intronic
1035616288 8:1004438-1004460 TTCAAATACACGTCCAGATTTGG + Intergenic
1038323840 8:26555210-26555232 GTTAAATACAAGTGCTGAGAAGG - Intronic
1042037953 8:64557646-64557668 CTCAAACACAAGGCCAGAAAAGG + Intergenic
1043914060 8:85899670-85899692 ACCAAATACAGGTCCTGATAAGG + Intergenic
1046094994 8:109547147-109547169 TTCAAATACAAGTCTTTATATGG + Intronic
1047019588 8:120760691-120760713 CTCAAAGACAGGTCGTGTTAAGG - Intronic
1048278447 8:133085900-133085922 GTCACATACAAGTTCTTATAGGG - Intronic
1048558080 8:135501352-135501374 ATAAAATACCAGTCATGATATGG + Intronic
1049514995 8:143049596-143049618 CCCAACTCCAAGTCCAGATAGGG + Intronic
1052138031 9:24939952-24939974 CCCAAACCCAAGTCCTGACATGG + Intergenic
1054850434 9:69841970-69841992 AGCAATGACAAGTCCTGATATGG - Intronic
1055792743 9:79940567-79940589 ATCACATCCAATTCCTGATAGGG - Intergenic
1056150096 9:83777428-83777450 ATCAAATAAAACTCCTGAAAAGG + Intronic
1056490966 9:87106760-87106782 CTCAAATTCCAGTTCTGTTATGG + Intergenic
1057572826 9:96217458-96217480 CTGAAAGATAAGTGCTGATAAGG + Intergenic
1057894558 9:98898000-98898022 TTCACATACAAGTCTTCATAAGG - Intergenic
1060626394 9:125116351-125116373 CTCAAATACAAGCCCTGTGAGGG - Intronic
1186064890 X:5752719-5752741 ATCAAATACAAGACCTTAGAGGG - Intergenic
1186158205 X:6748048-6748070 CAAATAAACAAGTCCTGATATGG - Intergenic
1187768233 X:22666739-22666761 CTAAAATGCAAATTCTGATATGG - Intergenic
1191005729 X:55709749-55709771 CTCAGATAGAAGTGCAGATAAGG + Intergenic
1196083231 X:111655775-111655797 CAAAAATACAAGTTCTGATTTGG + Intergenic
1198249564 X:134867087-134867109 CTCTAATTCAAGTCCTTTTATGG - Intergenic
1198504017 X:137282937-137282959 CTCAAATACCTGTCCAGATTTGG + Intergenic
1199525104 X:148783464-148783486 CTAAAATACAAGTCAGGAAAAGG - Intronic