ID: 945408155

View in Genome Browser
Species Human (GRCh38)
Location 2:209476166-209476188
Sequence CCTTCTCGAGACCATGATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 55}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945408155 Original CRISPR CCTTCTCGAGACCATGATTG TGG Intronic
909595899 1:77405816-77405838 CCTTCTGGAGACCATGTTGCCGG + Intronic
911327429 1:96484630-96484652 CCTTCTGGTGACAAAGATTGAGG - Intergenic
912075824 1:105873778-105873800 CCTTCTCTTGACGGTGATTGTGG + Intergenic
913091334 1:115478703-115478725 CCATCTTGAGAGCCTGATTGAGG - Intergenic
917301304 1:173577201-173577223 CCTGCTGGAGACCATCACTGAGG + Intronic
917605082 1:176619427-176619449 CCTTCTCAATACCATGCTTCAGG - Intronic
918575533 1:186054763-186054785 CCATCTTGAGACCATGAAGGAGG - Intronic
918861511 1:189832179-189832201 CCTCCTCAAGAAGATGATTGTGG - Intergenic
919895813 1:202009260-202009282 CCTTCTTGAGACCCTGAATGGGG - Exonic
920030293 1:203033663-203033685 CCTTCTTGAGAGCAAGATGGGGG - Intronic
1064789654 10:18942306-18942328 CCTTCTCCTGACCATTTTTGAGG + Intergenic
1092624624 12:10313082-10313104 CCTTCACAATACCATGATTTTGG + Intergenic
1106580168 13:31010864-31010886 CCTTCTCCAGACTCTGCTTGAGG - Intergenic
1113086941 13:106578177-106578199 CCCTCTCGGCACCTTGATTGAGG + Intergenic
1113452045 13:110417555-110417577 CCTTCTCCATAGCATGATTCTGG - Intronic
1115401960 14:32971768-32971790 CCGTTTGGAGACCATGATTATGG - Intronic
1124065911 15:26343529-26343551 CCTACTCCAGCTCATGATTGAGG - Intergenic
1124214420 15:27794695-27794717 CCTTCTCTACACCATCATTTGGG - Intronic
1124900844 15:33821005-33821027 CCTTTTGGATACCATAATTGTGG - Intronic
1126220878 15:46211340-46211362 CCATCTGGAGACCATCATTCTGG + Intergenic
1128802205 15:70504071-70504093 CCTGCTGGAGACCTTGCTTGGGG + Intergenic
1131278064 15:90998986-90999008 CCTTATGGAGGCCATGAGTGAGG - Exonic
1142383285 16:89746202-89746224 CCGTCACGAGAGCATGACTGTGG - Intronic
1144729483 17:17518303-17518325 CTTTCTCGAGACCAGCCTTGTGG + Intronic
1147796952 17:43050844-43050866 CCTTCTCAAGAGCATGAAGGTGG - Intronic
1153170628 18:2312017-2312039 CCTTCTTGACTCCATGACTGTGG - Intergenic
1159402276 18:67954011-67954033 CCTCCTCAAGGCCCTGATTGTGG - Intergenic
1167512111 19:49900881-49900903 CCTCATCGAAACCATCATTGTGG - Intronic
932661391 2:73656107-73656129 ACTTCTGGAGACCAAGACTGGGG - Intergenic
945408155 2:209476166-209476188 CCTTCTCGAGACCATGATTGTGG + Intronic
948359770 2:237412041-237412063 GCTTCTCTCGACCATGAGTGAGG + Intronic
1178406331 21:32326256-32326278 CTATCTCGAGAACATCATTGTGG - Intronic
1180787865 22:18557053-18557075 CCTTCTGGAGGCCATGACTCTGG + Intergenic
1181233871 22:21438253-21438275 CCTTCTGGAGGCCATGACTCTGG - Intronic
1181244776 22:21496578-21496600 CCTTCTGGAGGCCATGACTCTGG + Intergenic
961925384 3:130473956-130473978 ACTGCTTGAGACCATCATTGTGG - Intronic
962461368 3:135616452-135616474 CTTTCTCCAGACCAGGAATGAGG + Intergenic
963028760 3:140945547-140945569 CCTTCTTGAGACCCTTGTTGTGG + Intronic
969655717 4:8497138-8497160 CCTTCTCCAGAGCAAGGTTGAGG + Intergenic
971093365 4:23370976-23370998 CCCTCTCAGGACCATGAGTGGGG - Intergenic
983472150 4:168170509-168170531 TCTTCTCCAAACCATGATTCAGG + Intronic
983775805 4:171605773-171605795 CCTTCTTTAGACTATTATTGAGG + Intergenic
983944129 4:173567364-173567386 CCTGCTCTAGACCATGCTTTGGG + Intergenic
999028901 5:148268016-148268038 CCTGCTCCAGACCTTGGTTGTGG - Intergenic
1008135827 6:47775648-47775670 CCCTCTGGAGACCTGGATTGGGG + Intergenic
1012168769 6:95991602-95991624 CCTTCCTGAGCCCATGAATGTGG - Intergenic
1017017921 6:150116468-150116490 CCTTATTGACACCATGAATGGGG - Intergenic
1022522736 7:31018476-31018498 CCTTCTCAAGATCATGGATGAGG + Intergenic
1034860474 7:154590898-154590920 CCTTGTCGAGGCCATCATTATGG - Intronic
1036665892 8:10738110-10738132 CCTTCTCCAGACAATGATCAGGG - Intronic
1037819454 8:22128714-22128736 CCTTCTGGAGACCAAGATCCTGG - Exonic
1039525334 8:38209658-38209680 CCTTTTCAAGACCTTGCTTGAGG + Intronic
1045008110 8:97933535-97933557 CCTATTCGACACCAGGATTGCGG - Intronic
1046698796 8:117376399-117376421 CCTTCGCTACACAATGATTGTGG - Intergenic
1046994013 8:120495370-120495392 CCTTCTAGAGACAATGATTCTGG - Intronic
1197755730 X:129993042-129993064 CCTGCTGAAGACCAAGATTGAGG + Intronic
1198136876 X:133761811-133761833 CCTTCTGGACACCATAATTTGGG + Intronic
1199936456 X:152578966-152578988 ACTTCTGGAGAGCAGGATTGGGG - Intergenic