ID: 945408212

View in Genome Browser
Species Human (GRCh38)
Location 2:209476944-209476966
Sequence AAAACCTTCATCACAAAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 305}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945408209_945408212 14 Left 945408209 2:209476907-209476929 CCTTTTTCCTGTCCTAATTGAAT 0: 1
1: 0
2: 1
3: 36
4: 325
Right 945408212 2:209476944-209476966 AAAACCTTCATCACAAAGATTGG 0: 1
1: 0
2: 2
3: 45
4: 305
945408210_945408212 7 Left 945408210 2:209476914-209476936 CCTGTCCTAATTGAATTCAGTTA 0: 1
1: 0
2: 0
3: 9
4: 121
Right 945408212 2:209476944-209476966 AAAACCTTCATCACAAAGATTGG 0: 1
1: 0
2: 2
3: 45
4: 305
945408211_945408212 2 Left 945408211 2:209476919-209476941 CCTAATTGAATTCAGTTAAGCAT 0: 1
1: 0
2: 0
3: 10
4: 188
Right 945408212 2:209476944-209476966 AAAACCTTCATCACAAAGATTGG 0: 1
1: 0
2: 2
3: 45
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945408212 Original CRISPR AAAACCTTCATCACAAAGAT TGG Intronic
900342004 1:2193961-2193983 AACCCCTTCATCGCTAAGATGGG + Intronic
902686870 1:18083323-18083345 AATACCTTCATCTGATAGATGGG + Intergenic
905860711 1:41349366-41349388 AGATCCTTCATCATAAAAATGGG - Intergenic
908572937 1:65427976-65427998 AAAACCTTTATTACAAAAACAGG - Intronic
909082718 1:71133148-71133170 AAAATCTTCAACACAATAATAGG + Intergenic
909122292 1:71618456-71618478 AAACCCTGCTTCACAAAGACAGG - Intronic
910886449 1:91968410-91968432 CAAACCTTGATCACAAGGATGGG + Intronic
911357985 1:96844859-96844881 TAAACCTTCATGAGAAAGTTAGG + Intergenic
911519880 1:98916616-98916638 ATAACTTTCTTTACAAAGATAGG + Intronic
911524801 1:98971844-98971866 AAAATATTCATCACAATGAAGGG - Intronic
911565653 1:99460818-99460840 AAAACCCAAATCACAATGATAGG - Intergenic
911792356 1:102033614-102033636 AAACCCTGCTTCACAAAGATAGG - Intergenic
912237531 1:107867911-107867933 AAAGAATTCATCACAAAGTTAGG + Intronic
913650302 1:120907202-120907224 AAAACCTCCTCCACAAATATTGG + Intergenic
914170816 1:145221872-145221894 AAAACCTCCTCCACAAATATTGG - Intergenic
914329896 1:146657930-146657952 CAAAACTTCATTACAAAGAAAGG - Intergenic
914525931 1:148465831-148465853 AAAACCTCCTCCACAAATATTGG - Intergenic
915173977 1:153999435-153999457 AAAACATTTATCAATAAGATTGG + Intronic
915639322 1:157210402-157210424 AAAACCTTTAATACAAAGAATGG - Intergenic
915658959 1:157385337-157385359 AAAACCTTTAATACAAAGAATGG - Intergenic
915752545 1:158225285-158225307 ACAGTCTTCATCACAGAGATTGG + Intergenic
916608880 1:166370740-166370762 AAAAATTTGAACACAAAGATAGG + Intergenic
918017006 1:180644998-180645020 AAAACCTGCTTCACAAAGATAGG + Intronic
918223616 1:182458301-182458323 AAAACCTGCAAAACAAAGCTAGG - Exonic
918589558 1:186225032-186225054 AAAACCTTCTTTACATAGCTAGG - Intergenic
918750947 1:188268590-188268612 AAACCCTGCTTCACAAAAATAGG + Intergenic
918806338 1:189050995-189051017 AACACCTTCATCAAGAAGTTAGG - Intergenic
919091322 1:192981557-192981579 AAACCCTGCTTCACAAAGATAGG - Intergenic
920605107 1:207374685-207374707 AAAAACTTTAAAACAAAGATTGG + Intergenic
920924872 1:210331342-210331364 AGACCCTGCTTCACAAAGATAGG + Intronic
921029170 1:211322303-211322325 AAAACCTGTATCACAATGAGAGG + Intergenic
921144449 1:212339799-212339821 AAGATCTTCATCAGAAATATAGG - Intronic
922023070 1:221723635-221723657 AAAACTATCATCATAAAGATAGG - Intronic
922671797 1:227514180-227514202 AAACCCTGCTTCACAAAGACAGG + Intergenic
924903054 1:248422451-248422473 ATAACCTTCATGACAAAGTTTGG + Intergenic
924924804 1:248669348-248669370 ATAACCTTCATGACAAAGTTTGG - Intergenic
1063005885 10:1970249-1970271 AAATCCTGCTTCACAAAGACAGG - Intergenic
1063594393 10:7420640-7420662 AAACCCTGCTTCCCAAAGATAGG - Intergenic
1064269792 10:13854397-13854419 AAAGCCTTCATCAAAATGAGAGG - Intronic
1065406906 10:25378379-25378401 AAAAACTACATAACAATGATAGG + Intronic
1067132676 10:43579241-43579263 AAAACATTCTTCACAGAAATAGG - Intergenic
1067533301 10:47090222-47090244 AAAACTTTATTGACAAAGATAGG - Intergenic
1068163331 10:53296745-53296767 AGACCCTGCTTCACAAAGATAGG + Intergenic
1068516292 10:58029518-58029540 GAAATCTTCATGACAAAGTTGGG + Intergenic
1068661716 10:59629498-59629520 ATAACCTTCATAACATAGAAAGG + Intergenic
1069235417 10:66065466-66065488 AAAACCTTATTTAAAAAGATAGG - Intronic
1069403242 10:68071838-68071860 AAGACCTTAACCACAAAGAAAGG + Intronic
1069452833 10:68530929-68530951 ACAACTTTGGTCACAAAGATTGG - Intergenic
1070509654 10:77148781-77148803 AAAACTTTCCTTACAAAAATAGG + Intronic
1070615233 10:77964555-77964577 AAACCCTGCTTCACAAGGATAGG - Intergenic
1071769602 10:88711773-88711795 AAAAACATCATCAAAAAAATAGG - Intergenic
1071963141 10:90825364-90825386 AAAACCTTCCTAAGAAGGATGGG + Intronic
1072851921 10:98905081-98905103 AAAACATTCATCACATATATGGG + Intronic
1075173520 10:120137983-120138005 AAAACTTTATTCACAAACATGGG + Intergenic
1075625071 10:123958130-123958152 AAAATCTTCTCCACAAATATTGG - Intergenic
1075808582 10:125208102-125208124 AAAAGCTTCATCATAAAGTGGGG - Intergenic
1078826109 11:14931718-14931740 AAATCCTGCTTCACAAAGATAGG + Intronic
1079570121 11:21932646-21932668 AAACCCTGCTTCACAAAGATAGG - Intergenic
1081146745 11:39570186-39570208 AAATCCTACATGACAAAGAATGG + Intergenic
1081714763 11:45241891-45241913 GAAACCTTCATCACTGAGGTTGG - Exonic
1083083813 11:60121921-60121943 AAACCCTGCTTCATAAAGATAGG - Intergenic
1084439168 11:69161369-69161391 AAGACCATCATTACAAAGAATGG - Intergenic
1084858245 11:72002384-72002406 AAAACATACAGCACGAAGATAGG - Exonic
1086075556 11:82847579-82847601 AAAACCTGGATCAAAATGATAGG - Intronic
1086144930 11:83541199-83541221 AAAACCTTCATCTCAAATTCAGG - Intronic
1086593647 11:88544997-88545019 AAAAACTTCCTCAAAGAGATGGG + Intronic
1086956213 11:92936849-92936871 AAATCCATCATCACAGTGATTGG + Intergenic
1087405886 11:97730012-97730034 AAAACCCTCTTCATAAAGAGAGG - Intergenic
1087676142 11:101164049-101164071 AATCCCTTAATCACAAAGAAAGG - Intergenic
1087943099 11:104125005-104125027 AAAAGCTTAATTATAAAGATGGG - Intronic
1088001407 11:104886293-104886315 GAAAGCCTCATCACAAAGAGAGG + Intergenic
1088298940 11:108334189-108334211 TAGACCTTCATAAGAAAGATGGG - Intronic
1088484890 11:110330991-110331013 AAACGCATTATCACAAAGATAGG + Intergenic
1089267446 11:117275286-117275308 AATGCCTTCATCAAAAAGACAGG + Intronic
1090340082 11:126010059-126010081 AAAGCATTCATCTCAAAGACAGG + Intronic
1090709372 11:129372322-129372344 AAAACCTACTTCACAAGGATGGG - Intergenic
1090753509 11:129767975-129767997 AAGGGATTCATCACAAAGATTGG - Intergenic
1091844820 12:3647739-3647761 AAAACCTTCATAACATAACTAGG + Intronic
1093373442 12:18392608-18392630 AAAGGCTTCATCACATAGAGTGG - Intronic
1094045947 12:26167334-26167356 AAAACCTTATGGACAAAGATTGG + Intronic
1094061399 12:26318285-26318307 AAACCCCTGATGACAAAGATTGG - Intergenic
1094812782 12:34156141-34156163 AAAGCCTGCTTCACAAAGACAGG - Intergenic
1095511544 12:42956206-42956228 AAATCCTTAATCTCAAGGATTGG - Intergenic
1097614348 12:61865464-61865486 AAAATCTTCATCCAAAATATTGG + Intronic
1099161233 12:79244206-79244228 AATACCTTCATCACTATCATTGG + Intronic
1100160457 12:91854094-91854116 AAAACCTTTATCACACACATAGG - Intergenic
1101047902 12:100829375-100829397 ATAACCATCAGCACAAAGAATGG + Intronic
1101130314 12:101683508-101683530 AAAATCTTCAACAGATAGATGGG - Intronic
1101432635 12:104639449-104639471 AAATCCATCATCACAGTGATTGG - Intronic
1102226415 12:111231596-111231618 AAAACTTTATTTACAAAGATAGG - Intronic
1104394168 12:128417464-128417486 GAAATTTTCATCACAAAGATAGG + Intronic
1105698864 13:22918942-22918964 AACACCTTCCTCTCAAAGACAGG - Intergenic
1105850613 13:24331802-24331824 AACACCTTCCTCTCAAAGACAGG - Intergenic
1106352336 13:28944504-28944526 AAAGGATTCATCACAAAGAATGG - Intronic
1106602053 13:31196628-31196650 AAAACTTTCATCACTCAGAGAGG - Intergenic
1108170196 13:47733627-47733649 AAAACCTTAATTACAAAAATAGG + Intergenic
1108331824 13:49393651-49393673 AAAACCTACATAATTAAGATAGG + Intronic
1108631552 13:52288760-52288782 AAAGCCTTCCTGAGAAAGATAGG - Intergenic
1109945548 13:69426853-69426875 AAAACCAGCATGACAAACATAGG + Intergenic
1110551763 13:76818654-76818676 AAAAACTTCAGCTCACAGATGGG + Intergenic
1112120428 13:96404501-96404523 TAATCCTTCATCACAATGACAGG - Intronic
1112490780 13:99861385-99861407 ATAACTGTCATCACAAAGAATGG + Intronic
1112710315 13:102120159-102120181 AAGACATTCATCAAAAAGAGAGG + Intronic
1113401436 13:109997657-109997679 AAACCCTGCTTCAGAAAGATAGG - Intergenic
1114158200 14:20131386-20131408 AACACAGTCATCACAGAGATAGG + Intergenic
1114848756 14:26357074-26357096 ATTATCTTCATCTCAAAGATGGG - Intergenic
1116140382 14:40985936-40985958 AAACCCTGCTTCACAAAAATGGG + Intergenic
1116451639 14:45073128-45073150 GAAACCTTTCTCTCAAAGATTGG - Intronic
1116770263 14:49119315-49119337 AAAACCATCAAAACAAAGCTAGG + Intergenic
1118526620 14:66651729-66651751 AAACCCTGCTTCACAAAGACAGG - Intronic
1119098129 14:71853312-71853334 AAAACCTTTATCACAATCAGTGG - Intergenic
1120149826 14:81020889-81020911 AAACCCTGCTTCACAAAGATAGG - Intronic
1121592649 14:95128918-95128940 AAAACCTTCATAACTTAGGTTGG - Intronic
1124244470 15:28057792-28057814 AACAACGTCATCACAAAGACGGG + Intronic
1124847142 15:33302131-33302153 AAACACTTCAACACAAAGACAGG - Intergenic
1126251114 15:46569192-46569214 ATAACCTTCATTTCAGAGATGGG - Intergenic
1126457249 15:48877140-48877162 AAATCCTGCCTCACAAAGATAGG - Intronic
1126502800 15:49365590-49365612 ACACCATTCATCACAAAGAATGG - Intronic
1128408797 15:67371777-67371799 AAAAACTAAATCACAGAGATTGG + Intronic
1128834344 15:70797012-70797034 GAAACCTCAGTCACAAAGATCGG - Intergenic
1129928097 15:79384111-79384133 AAAAGCTTCTTCTCAAACATTGG + Intronic
1130172110 15:81525518-81525540 CAACCCATCATCACAATGATTGG + Intergenic
1130261631 15:82358945-82358967 AAAACATTCCTGACAAAGCTAGG + Intergenic
1130279604 15:82510067-82510089 AAAACATTCCTGACAAAGCTAGG - Intergenic
1130470983 15:84226250-84226272 AAAACATTCCTGACAAAGCTAGG - Intergenic
1130478477 15:84340820-84340842 AAAACATTCCTGACAAAGCTAGG - Intergenic
1130493293 15:84447311-84447333 AAAACATTCCTGACAAAGCTAGG + Intergenic
1130593273 15:85230889-85230911 AAAACATTCCTGACAAAGCTAGG - Intergenic
1130613738 15:85384219-85384241 AAAACATTCCTGACAAAGCTAGG + Intronic
1131001749 15:88944196-88944218 AAAAACTTTATCAGAAAAATAGG + Intergenic
1131220139 15:90576880-90576902 AACTCCTTCATCACAAAGCTTGG + Intronic
1131239138 15:90723150-90723172 AAAAGCATTATCACAAAAATTGG - Intronic
1131604310 15:93884820-93884842 AATTCCTTCATTTCAAAGATAGG - Intergenic
1131631752 15:94184559-94184581 AAACCCTGCTTCACAAAGACAGG + Intergenic
1132024911 15:98397306-98397328 GAAATCTTCATCACACTGATGGG - Intergenic
1132281889 15:100625057-100625079 AATACCTTCATGAGAAAGATGGG + Intronic
1135168584 16:20163386-20163408 AAAATCATTATCACACAGATTGG - Intergenic
1135410670 16:22232017-22232039 AAAAGCTTCATCACCAGGATGGG + Intronic
1138042504 16:53688326-53688348 AAAACCCTTATCACAAACACTGG - Intronic
1138425540 16:56929768-56929790 AAACCCTGCTTCACAGAGATGGG + Intergenic
1139677946 16:68538413-68538435 GAAATTTTCAACACAAAGATAGG - Intronic
1140003659 16:71052984-71053006 CAAAACTTCATTACAAAGAAAGG + Intronic
1140325484 16:73997509-73997531 AAAACTTTATTCACAAAAATAGG + Intergenic
1140581985 16:76241360-76241382 AAATCCTCCTTCACAAAGATAGG - Intergenic
1140610314 16:76591033-76591055 AAAACCTTGAAAAAAAAGATTGG - Intronic
1143117456 17:4588920-4588942 CAACCCATCATCACACAGATGGG - Intronic
1145835972 17:27954555-27954577 ATATCCTTCATCTCTAAGATGGG + Intergenic
1146065311 17:29630412-29630434 CAAACCATCATCACAAAGGCAGG + Exonic
1146474852 17:33154495-33154517 AATACCTGCTTCACCAAGATTGG - Intronic
1149135105 17:53354766-53354788 AAAATATTCGTCAGAAAGATTGG - Intergenic
1149281934 17:55114957-55114979 AAAAACTTGCTCACAAAGAAAGG - Intronic
1149440340 17:56668629-56668651 AAACCCTGCTTTACAAAGATAGG - Intergenic
1150712137 17:67540424-67540446 AGAAAGTTCATCACAAATATGGG + Intronic
1153694622 18:7627472-7627494 AAGACCTTTACCCCAAAGATGGG - Intronic
1156832344 18:41507277-41507299 AAAACCTTATTCACTAAAATGGG - Intergenic
1159792535 18:72800381-72800403 AAACCCTGCTTCACAAAGATAGG - Intronic
1160876232 19:1297432-1297454 ATAACATTCATCACAGAGGTAGG - Intronic
1162216467 19:9138227-9138249 AGAACTATCATCAAAAAGATAGG + Intergenic
1164124357 19:22298031-22298053 AAAACATTGAGCACAAAGATAGG + Intronic
1164198600 19:22996528-22996550 AAAAAGTTGAGCACAAAGATCGG - Intronic
925254485 2:2471301-2471323 AAAAGCTATATCCCAAAGATAGG + Intergenic
926604142 2:14879570-14879592 AAATCCTTAATCACAAATCTTGG - Intergenic
927328108 2:21830000-21830022 AACACCTACATCAAAAAGACTGG + Intergenic
928040359 2:27869835-27869857 AAACTCTGCTTCACAAAGATAGG + Intronic
929174662 2:38964156-38964178 AAACCCTGCTTCACAAAGATGGG + Intronic
932499176 2:72167008-72167030 AAAAACTTCAACACAAAGTGAGG + Intergenic
933097573 2:78206138-78206160 AATGCCTACATCAAAAAGATAGG + Intergenic
933480484 2:82851186-82851208 AAACCCTGCTTCACAAAGACAGG + Intergenic
933903931 2:86870529-86870551 AAAGCCTTCATCACAAGGTTAGG - Intergenic
934900554 2:98156430-98156452 ACAACCATCCTCACAGAGATAGG + Intronic
935530950 2:104231910-104231932 AAAACCTTAATTTCAAAAATAGG + Intergenic
935776578 2:106478444-106478466 AAAGCCTTCATCACAAGGTTAGG + Intergenic
936368305 2:111881606-111881628 AAAGCCTTCATCACAAGGTTAGG + Intronic
936689924 2:114874410-114874432 AAACCCTGCTTCACCAAGATAGG - Intronic
937018048 2:118624286-118624308 AAACCCTATTTCACAAAGATAGG - Intergenic
939306519 2:140418567-140418589 AAATCCTGCTTCACAAATATGGG - Intronic
940026707 2:149215953-149215975 AAAAACTTATTCACAAAAATGGG - Intergenic
942423166 2:175829680-175829702 AAAAACTTAATAATAAAGATGGG + Intergenic
943215258 2:185025433-185025455 AAAATCATCATCTCAATGATTGG + Intergenic
943381118 2:187149775-187149797 ATAACCTTAATCACAAATAAAGG + Intergenic
943483582 2:188453541-188453563 TAAACATTTATCACAAATATCGG + Intronic
943818692 2:192290459-192290481 AAACCCTGCTTCACAAAGATAGG + Intergenic
943962098 2:194278355-194278377 AAAACATTAAGCAAAAAGATAGG - Intergenic
944412226 2:199456719-199456741 ATAACCTCCATCACAAAGGCGGG + Intronic
944587293 2:201183811-201183833 AAAACCTCCATAACAAACAGTGG - Intronic
945408212 2:209476944-209476966 AAAACCTTCATCACAAAGATTGG + Intronic
946116530 2:217467372-217467394 AAAACCTTAATGACAGAGAAAGG + Intronic
946985775 2:225271197-225271219 AAAACCCTGATCACAGAGAAGGG - Intergenic
947034820 2:225840195-225840217 GAAACCTTCTTAACAAAGACTGG + Intergenic
1169293664 20:4374371-4374393 AACACCCCTATCACAAAGATGGG - Intergenic
1169888805 20:10431965-10431987 ACAGCATTCATCACAAAGGTAGG - Intronic
1171154682 20:22861080-22861102 AGACCCTTCATTCCAAAGATAGG - Intergenic
1173565674 20:44036642-44036664 AAAACCTTATTTACAAAAATGGG - Intronic
1173710207 20:45148882-45148904 AACACCCTCATCATGAAGATGGG - Intergenic
1174750815 20:53109802-53109824 AAAAGCATCATCACAGAGCTTGG - Intronic
1175694980 20:61095740-61095762 GAAAACTGCTTCACAAAGATAGG + Intergenic
1176229193 20:64022999-64023021 AAATCCTTCATCACAACCAGAGG - Intronic
1177771457 21:25520241-25520263 AAAGCCTTCCTAAGAAAGATGGG + Intergenic
1177985387 21:27968378-27968400 AAAACCTCCATCACACATACTGG + Intergenic
1179188098 21:39100355-39100377 AAACCCTGCTTCACAAAGATAGG - Intergenic
950270301 3:11609589-11609611 ATGACCTTCAACACAGAGATGGG + Intronic
950758430 3:15197996-15198018 AAACCCTGCTTCATAAAGATAGG + Intergenic
951029139 3:17862457-17862479 AAAGCCTTCCTAACAAGGATGGG - Intronic
951630598 3:24716198-24716220 AAAGCATTCATGAAAAAGATTGG + Intergenic
951658715 3:25038188-25038210 AATTCCTTCATCACAAAAATGGG - Intergenic
952287103 3:31980319-31980341 AAAACTTCCATTACAAACATCGG + Intronic
952608215 3:35174787-35174809 ATGACCTTCTTCACAAATATAGG - Intergenic
954724211 3:52593542-52593564 AACACCCACATCAAAAAGATAGG - Intronic
955351963 3:58200251-58200273 AACACCCTGATCACAATGATTGG + Intronic
956291510 3:67665399-67665421 AAAACTTTATTTACAAAGATAGG - Intergenic
956337128 3:68176516-68176538 AAAAGCTTCATCAAAATTATAGG - Intronic
956493301 3:69797231-69797253 AACTCCTTGAGCACAAAGATTGG - Intronic
956504948 3:69928088-69928110 AAAACCTTATTGACAAAAATGGG + Intronic
957626545 3:82659818-82659840 AAAAACCTCATCAAAAAGTTGGG - Intergenic
957894641 3:86405554-86405576 AAAACTTTATTCACAAAAATGGG - Intergenic
962559837 3:136593907-136593929 TGAAACTTCATGACAAAGATGGG - Intronic
963356308 3:144212581-144212603 AAACCCTGCTTCACAAAGATAGG + Intergenic
964612923 3:158632946-158632968 AAATGCTACTTCACAAAGATAGG + Intergenic
964805402 3:160604256-160604278 AAAACTTTCAGCACAAAACTTGG + Intergenic
965823985 3:172712183-172712205 AAGACCTTCATCAATAAGTTTGG - Intergenic
966202418 3:177370811-177370833 AACACCTTCCTCTCAAAGACAGG - Intergenic
966317128 3:178660335-178660357 AAAAGCCTTATCACACAGATAGG - Intronic
966627088 3:182029203-182029225 AAAACCTTCAAGACAAATAGGGG + Intergenic
966853745 3:184180216-184180238 AAAACCTTCATCACGCAGCAGGG + Exonic
967558018 3:190882191-190882213 AAAATCTTCATCACATCGTTTGG - Intronic
967771154 3:193334723-193334745 ATACCCTTCATCACATAGAAGGG + Intronic
968719550 4:2190843-2190865 ACGACTTTCATCAAAAAGATAGG + Intronic
970050128 4:11905067-11905089 AAAAGCTTCACCTCAAAGAGAGG - Intergenic
970114004 4:12672336-12672358 AAAGCGTTCATCTCACAGATAGG - Intergenic
970153752 4:13119653-13119675 AAAACATTCATGACAAGTATTGG + Intergenic
970179588 4:13376618-13376640 AAGACCTACATAACAAAAATGGG + Exonic
971063468 4:22999729-22999751 TTAACCTGAATCACAAAGATTGG - Intergenic
971914389 4:32849979-32850001 AAAACCTTCCTGAGAAAGACGGG - Intergenic
972904593 4:43728994-43729016 AAAGCCTTCATGAGAAGGATGGG + Intergenic
974345433 4:60674876-60674898 TTAACATTCATGACAAAGATTGG - Intergenic
975417449 4:74121401-74121423 AAACCCTACTTCACAAAGATAGG - Intronic
975611029 4:76203423-76203445 AAAACCTTAAACACCAATATTGG - Intronic
975625355 4:76340567-76340589 AAACACTGCTTCACAAAGATAGG - Intronic
976122718 4:81800583-81800605 AAACCCTGCTTCACAAAGATAGG + Intronic
976180400 4:82393539-82393561 AAACCCTGCTTCACAAAGATAGG - Intergenic
977076650 4:92460682-92460704 AATGCCTTCATCAAAAATATAGG - Intronic
978222463 4:106293262-106293284 AAACCCTGCTTCACAAAGATAGG - Intronic
978306649 4:107335715-107335737 AATGCCTACATCAAAAAGATAGG - Intergenic
978344520 4:107753246-107753268 AAAAACTTCAGCAGAAAGACAGG + Intergenic
979087892 4:116437493-116437515 ATAACTTTCATCACAAAGTAGGG - Intergenic
979300364 4:119080003-119080025 AAATCCTTCTCCACAAATATTGG - Intergenic
979829230 4:125280146-125280168 AAACCCTTCTTCACAAAGATAGG - Intergenic
981005396 4:139869692-139869714 GAAACCTTTATCTGAAAGATGGG + Intronic
981565975 4:146102265-146102287 AAAACCTTAAAGACAAAGATAGG - Intergenic
982039799 4:151385513-151385535 AAACCCTGCTTCACAAAGATAGG + Intergenic
982141087 4:152318867-152318889 AAAATCTTCATAACAGATATAGG - Intergenic
983282257 4:165695551-165695573 AAAACCCTCAGCACATTGATAGG - Intergenic
986018049 5:3775135-3775157 ACAACCGTCATCACCAGGATGGG + Intergenic
986085025 5:4436521-4436543 AAAACCTTCCAAAGAAAGATAGG - Intergenic
986350178 5:6870326-6870348 CAACCCTGCTTCACAAAGATAGG + Intergenic
987919204 5:24256670-24256692 ACAGCCTTCATGACAAATATTGG - Intergenic
987993180 5:25241930-25241952 AAACCCTGCTTCACAAAGATAGG + Intergenic
988136110 5:27173872-27173894 AAACCCTGCTTCACAAAGATTGG - Intergenic
989088153 5:37698297-37698319 TAAATCTTTATCACATAGATAGG + Intronic
989981405 5:50649745-50649767 AAAACCTCCTCCACAAATATTGG + Intergenic
990373657 5:55147863-55147885 AAACCCTTCATTTCACAGATGGG + Intronic
992832530 5:80608281-80608303 AAAAACATCATCACAAGGCTGGG + Intergenic
993056227 5:82983012-82983034 ATGGCCTTCATCACAAAGACGGG + Intergenic
993779022 5:92042259-92042281 ATAACCTTCATAAGAAAAATAGG - Intergenic
994370942 5:98966869-98966891 AAAACCTTCATGACATTGATCGG + Intergenic
995463903 5:112431097-112431119 AAACCCTGCTTCACAAAGATAGG + Intergenic
995861355 5:116644222-116644244 AAACCCTGCTTCACAAAGATAGG + Intergenic
996039161 5:118791277-118791299 AAAACTTTCTTCACAAAAATAGG - Intergenic
996075756 5:119191807-119191829 AACACCTACACCACAGAGATTGG + Intronic
996404331 5:123090757-123090779 AAAACTTTTGTCACAGAGATCGG - Intronic
997622091 5:135305587-135305609 AACACCTTCATCTCAAATAATGG - Intronic
997900374 5:137758015-137758037 AAACCCTGCTTCACAAATATAGG + Intergenic
999066322 5:148690004-148690026 AATGCCTACATCAAAAAGATAGG + Intergenic
999130926 5:149282569-149282591 AAAACTTTCTTTACAAAGACAGG - Intronic
999916131 5:156263428-156263450 AAAAACTTCATAAAAAAAATGGG - Intronic
1001756388 5:174173648-174173670 CAAACCCTCAACACAAAGAAGGG - Intronic
1001894462 5:175366505-175366527 AAACCCTGCTTCGCAAAGATAGG - Intergenic
1002468343 5:179419602-179419624 AAAACCTTCATCGAAAAGGAGGG + Intergenic
1004212164 6:13659662-13659684 AAAACCTTGATAACAATAATGGG - Intronic
1004599281 6:17132154-17132176 AAACCCTGCTGCACAAAGATGGG - Intergenic
1005363737 6:25056728-25056750 AAAACCTTTAGCACAAAGTCTGG - Intergenic
1006730782 6:36234782-36234804 AAAACCTCCAGCAAACAGATGGG + Intergenic
1008342802 6:50388231-50388253 AAACCCTTTATAGCAAAGATCGG - Intergenic
1008371457 6:50736154-50736176 AAAACCTTTCTCCCAAAGGTGGG - Intronic
1008744183 6:54648643-54648665 AAACCCTTCATCAAGAAGGTAGG + Intergenic
1010251343 6:73710553-73710575 AAAACATTTATCACAATGCTTGG + Intronic
1010310867 6:74384252-74384274 AAAACCTTAAGCAGAAATATTGG + Intergenic
1010400894 6:75444451-75444473 AAAAAATTTATAACAAAGATGGG - Intronic
1011673887 6:89712326-89712348 AAAACCTCTTTCACAAATATTGG + Intronic
1012179315 6:96131539-96131561 AAAACTTTCTTCTCAGAGATAGG - Intronic
1013036079 6:106384590-106384612 AAACCCTGCTTCACAAAGATAGG + Intergenic
1013964085 6:115934953-115934975 AAAACTTTCATAACCAAGTTTGG + Exonic
1014119665 6:117709521-117709543 AACACCTTCCTCTCAAAGACAGG - Exonic
1016195392 6:141330613-141330635 AATACCTTCATTAAAAAGAAAGG - Intergenic
1017097329 6:150816199-150816221 AAACCCTGCTTCACAAAGATAGG + Intronic
1018102419 6:160452946-160452968 AAAACATTCATCTCAGAGTTAGG + Intergenic
1018596551 6:165487254-165487276 AAACCCTGCTTCACAAAGACAGG - Intronic
1018664527 6:166122927-166122949 AAACCCTGCTTCACAAAGACAGG + Intergenic
1019969209 7:4526577-4526599 AAAATCATCATCAGAAAAATAGG + Intergenic
1020946382 7:14613608-14613630 AAAACCTCCTCCACAAAGAAAGG + Intronic
1024811525 7:53217939-53217961 TAAACCTTTGTAACAAAGATTGG - Intergenic
1025947743 7:66117398-66117420 AGAACCATCAGCACATAGATGGG - Intronic
1027795691 7:82691048-82691070 AAATCCTGCATCAAAAAGACAGG - Intergenic
1028656871 7:93218730-93218752 AAAATCTTCATGACAAAAATAGG + Intronic
1028992776 7:97067300-97067322 AAAACCTTCATTTCAAGGCTAGG + Intergenic
1029556522 7:101273826-101273848 AAAACCTTGATGACGAAGAAGGG + Intergenic
1030708001 7:112715119-112715141 ACAACCTTCAGCAAAAAGTTTGG - Intergenic
1034568743 7:151937339-151937361 AAAACCAACATCACATACATAGG + Intergenic
1036382638 8:8247412-8247434 AAATCCTGCTTCACAAAGACAGG - Intergenic
1039223566 8:35362881-35362903 AAAACCTTAATTATAAAAATAGG + Intronic
1039654608 8:39388649-39388671 AAAACCATTATAACAAAGAGTGG - Intergenic
1042003358 8:64152317-64152339 AAAACCTTCCTTATTAAGATAGG - Intergenic
1042889950 8:73598101-73598123 AAAAGATTCATGACAAAGTTAGG + Intronic
1043050992 8:75385339-75385361 AAACCCTGCTTCACAAGGATAGG - Intergenic
1045995054 8:108352528-108352550 AAAACCTTCTCAAGAAAGATGGG + Intronic
1046238127 8:111454068-111454090 GAAGCCTGCTTCACAAAGATAGG - Intergenic
1046830458 8:118740114-118740136 AACCACTTCATCAGAAAGATGGG + Intergenic
1047139149 8:122116889-122116911 AATGCCTACATCAAAAAGATAGG + Intergenic
1047625996 8:126656691-126656713 AAAAACTTGATCACAAGGCTTGG - Intergenic
1049483937 8:142841645-142841667 AAAACCTACCACACACAGATGGG + Intronic
1050057080 9:1667005-1667027 AAACCCTGCTTCACAAAGATAGG - Intergenic
1050676093 9:8054149-8054171 AAAACCTTCAGCACAGATACTGG - Intergenic
1050754855 9:8990071-8990093 AATACCTTCTTCACAAATAATGG - Intronic
1052195542 9:25708893-25708915 AAAACCTGCATCACAACTCTGGG - Intergenic
1052372040 9:27676039-27676061 AATAATTTCATAACAAAGATGGG + Intergenic
1052895009 9:33738997-33739019 AAGGGATTCATCACAAAGATTGG - Intergenic
1053389929 9:37727396-37727418 AAAACCTTAATTACAAAAACAGG + Intronic
1053559223 9:39172288-39172310 GAAACTTTCTTAACAAAGATTGG - Intronic
1053823340 9:41992529-41992551 GAAACTTTCTTAACAAAGATTGG - Intronic
1054137888 9:61446658-61446680 GAAACTTTCTTAACAAAGATTGG + Intergenic
1057318862 9:93993429-93993451 AAAGCCTTCTTTACAAAAATAGG + Intergenic
1057377594 9:94539549-94539571 AAAAGCCTCAACATAAAGATGGG - Intergenic
1057712812 9:97462583-97462605 AGAACCCTCATCTCAAATATGGG + Intronic
1058123040 9:101159834-101159856 AAAACTGTCAACACAAAGCTTGG - Intronic
1058229481 9:102408214-102408236 AAACTCTGCTTCACAAAGATCGG - Intergenic
1061253261 9:129438525-129438547 CAAACCATCATCACAATGACCGG - Intergenic
1186763950 X:12751559-12751581 AAAATCTTCATAGCAAAAATTGG + Intergenic
1188065688 X:25656668-25656690 AAACCCTGCTTCACAATGATAGG + Intergenic
1188469896 X:30526519-30526541 AAAAACTTCAAGACAAAAATGGG - Intergenic
1189211748 X:39289686-39289708 ATAACCTACTTCACAAAGTTAGG + Intergenic
1189646995 X:43143953-43143975 AAAACTTTCTTTACAAAAATAGG + Intergenic
1189907054 X:45771992-45772014 AAAAACTTCACTACCAAGATGGG + Intergenic
1190099445 X:47510071-47510093 AACACCTTCCTCTCAAAGACAGG + Intergenic
1192536069 X:71928773-71928795 AAACCCTTCATAGCATAGATAGG + Intergenic
1192785960 X:74335698-74335720 AAAATCTTCCCCACAAATATTGG - Intergenic
1193529612 X:82641400-82641422 AAAACCTTTTTAACAAGGATGGG - Intergenic
1194066955 X:89272530-89272552 AATACGTTCATCAGAAATATTGG + Intergenic
1196374237 X:115014539-115014561 AGAATCTACATTACAAAGATGGG - Exonic
1197360140 X:125491511-125491533 AAAGCTTTCATCATAAAGTTTGG + Intergenic
1197403163 X:126018665-126018687 AAAACCTTCCTAAGAAGGATGGG - Intergenic
1199144115 X:144346086-144346108 AAAGCCTTCTTAAAAAAGATGGG - Intergenic
1199442922 X:147889203-147889225 AAAGCCTTCCTAAGAAAGATTGG - Intergenic
1200020464 X:153200558-153200580 ACAACCTTCAGGACAATGATAGG - Intergenic