ID: 945418245

View in Genome Browser
Species Human (GRCh38)
Location 2:209601563-209601585
Sequence ATCAATAGGCTATAAAGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 191}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945418245 Original CRISPR ATCAATAGGCTATAAAGGGG TGG Intronic
900132744 1:1095020-1095042 ATCAATGGACTATAGAGGTGGGG + Intronic
911239041 1:95445068-95445090 ATGAATTGGCTATAAATGTGTGG + Intergenic
911465524 1:98248053-98248075 ATCAATTGGCTGTAAATGTGTGG + Intergenic
912948115 1:114101473-114101495 ACCAGTATGCTACAAAGGGGTGG - Intronic
914422158 1:147539236-147539258 GTCAGTAGCCTATTAAGGGGAGG + Intergenic
915703192 1:157817370-157817392 ATCAGTGGGCTATAAATGTGTGG - Intronic
924898141 1:248364789-248364811 ATCAATTGACTATAAATGTGTGG - Intergenic
1066095196 10:32065613-32065635 ATCAGTTGGCTATAAATGTGTGG + Intergenic
1066151633 10:32626848-32626870 ATCAATTGGCTATATAGGCTGGG + Intronic
1067959361 10:50830953-50830975 ATCAATTGGCCATAAATGTGTGG - Intronic
1071039870 10:81294227-81294249 ATCAATAAGCTGTAAATGAGTGG + Intergenic
1071110892 10:82154369-82154391 ATCAATTGACTATAAATGTGTGG + Intronic
1071393083 10:85195030-85195052 TTCAATATGCAATAAAGGTGGGG + Intergenic
1072288806 10:93943237-93943259 ATCAATGGGGTGAAAAGGGGAGG - Intronic
1072314513 10:94188899-94188921 ATCAAAATGCTATACAGGGCTGG - Intronic
1072401191 10:95103038-95103060 ATCAATTGGCTATACATGTGAGG - Intergenic
1073805605 10:107094461-107094483 ACAAATAGGCTATGAAGGTGAGG + Intronic
1074846328 10:117401917-117401939 ATCAATTGGCCATAAATGTGAGG + Intergenic
1076347929 10:129793426-129793448 ATCAATAAGTTAAAATGGGGTGG - Intergenic
1078332270 11:10434285-10434307 ATCAATTGGCTATAAATACGTGG - Intronic
1078516319 11:12025739-12025761 ACTAATAGGCTATAAATGGAGGG + Intergenic
1081411352 11:42762204-42762226 ACCAGAAGGCTATAGAGGGGTGG - Intergenic
1081559357 11:44198687-44198709 TTTAATAGGCTATAAATGGCAGG - Intronic
1084045914 11:66567819-66567841 ACCAAGATGCTATGAAGGGGAGG - Intronic
1084075030 11:66767897-66767919 CTCAGAAGGCTATAAATGGGAGG - Intronic
1086833041 11:91589088-91589110 ATCAGTTGGCTATAAATAGGTGG + Intergenic
1087507979 11:99052489-99052511 AGCAATAGGCTATATAGCGCAGG + Intronic
1088026637 11:105192899-105192921 ATCAATAGACTTTAAAGAGAAGG + Intergenic
1089099587 11:115951204-115951226 ATAAATAGGCTAAAAAGAAGAGG - Intergenic
1089938243 11:122387958-122387980 ACCAATTGGCTATGATGGGGAGG + Intergenic
1090159716 11:124480041-124480063 AACAATAGGGCATAAAGGGAAGG - Intergenic
1090217868 11:124986154-124986176 ATCAATTGACTATAAATGTGAGG + Intronic
1091012404 11:132015189-132015211 ATCAGTTGGCCATAAATGGGTGG + Intronic
1092742355 12:11642013-11642035 ATCAATAGGATATAGATGGATGG - Intergenic
1093509672 12:19911622-19911644 ATCAATTGGCTATAAACATGTGG + Intergenic
1094351568 12:29531460-29531482 TTCAATAGGCTATCAACGTGGGG + Intronic
1094835775 12:34321374-34321396 AGAAAAAGGCTTTAAAGGGGAGG - Intergenic
1095200598 12:39379638-39379660 ATCAGTAGGACATTAAGGGGAGG + Intronic
1095440108 12:42229922-42229944 ATCAATATGATACCAAGGGGTGG + Intronic
1096308812 12:50502689-50502711 AACAATAGGAGAAAAAGGGGGGG + Intergenic
1097483180 12:60157872-60157894 ATCAATGGCATAAAAAGGGGAGG + Intergenic
1097565288 12:61261973-61261995 ATCAAAAAGCTAGAAAGGGCTGG + Intergenic
1098125392 12:67286951-67286973 ATCAATTGACTATAAAAGTGTGG + Intronic
1101571582 12:105958638-105958660 ACCAATTGGCTATAAATTGGAGG + Intergenic
1104619015 12:130296078-130296100 ATCAATAGGCCATAAATATGAGG - Intergenic
1106073643 13:26438358-26438380 ATCAATTGGCTGTAAAAGTGTGG - Intergenic
1107465906 13:40650135-40650157 ATATATAGTCTAAAAAGGGGAGG - Intronic
1111207648 13:85033623-85033645 ATCAATAGGCTATAAGTGTGTGG + Intergenic
1111885499 13:94015796-94015818 ATCAATTGGCCATAAATGTGTGG + Intronic
1113017631 13:105845576-105845598 ATGAATAGGTTTTAAAGAGGAGG - Intergenic
1116897714 14:50333459-50333481 CTAAATAGTCTAAAAAGGGGAGG + Exonic
1118521817 14:66594510-66594532 ATCAATTGGCGATAAATGTGTGG - Intronic
1119078759 14:71672292-71672314 AGCAATAGGGTATTAAGTGGTGG - Intronic
1119633620 14:76256293-76256315 ATCAATAGGCCATATATGTGTGG + Intergenic
1120391958 14:83920244-83920266 ATCAATTGACTATAAATTGGTGG - Intergenic
1120519871 14:85514037-85514059 ACCAATAGGCAATTAAAGGGAGG + Intergenic
1120702885 14:87717194-87717216 ATATATAGGGTATAAAGGGGTGG + Intergenic
1121921375 14:97884971-97884993 ATCAAGAGGCAAAAAAGAGGTGG - Intergenic
1123100484 14:105794816-105794838 ATCAGTAGGCTATAAATATGTGG - Intergenic
1125654784 15:41347219-41347241 ATAAATAGACTATCAAGGGATGG + Intronic
1126187012 15:45840700-45840722 ACCAATTGGCTATAAACTGGGGG + Intergenic
1130626509 15:85521111-85521133 ATGAATGGGTTAAAAAGGGGAGG - Intronic
1130823450 15:87519188-87519210 ACCAACAGGCTATAAATTGGAGG + Intergenic
1135883939 16:26287050-26287072 ATCAATAGGCTGTAAATATGTGG + Intergenic
1136669328 16:31841836-31841858 ATCAATTGACCATAAATGGGTGG - Intergenic
1138041901 16:53680433-53680455 GTCAATGGGCTATAAAAGAGTGG + Intronic
1144121563 17:12159194-12159216 ATGAATTGGCTATAAATGCGTGG + Intergenic
1148961133 17:51393829-51393851 ACCAATAGGCTTTAAAGAGAAGG + Intergenic
1149238928 17:54625810-54625832 ATCAATAAACTATAATGAGGAGG - Intergenic
1149838940 17:59941077-59941099 ATCAATAAGTTATAAAGGCATGG - Intronic
1203174440 17_GL000205v2_random:183759-183781 ATCAAAAAGCTAGAAAGGGCTGG - Intergenic
1153325891 18:3819758-3819780 ATGAATATGCTAGAAGGGGGCGG - Intronic
1153582941 18:6593787-6593809 AACAATAGGCAGAAAAGGGGTGG + Intergenic
1155355821 18:24952996-24953018 ATCAATTCGCTATAAAGGCATGG + Intergenic
1156567788 18:38215455-38215477 ATCAATAGACTATAAACGTAAGG - Intergenic
1156960312 18:43020705-43020727 ATCAATTGGCTATAAATTTGTGG - Intronic
1157217042 18:45792857-45792879 ATCAAAAAACAATAAAGGGGGGG + Intergenic
1158852280 18:61506861-61506883 ATCAGTGATCTATAAAGGGGGGG - Intronic
1159729955 18:72013720-72013742 ATTAATAGGCAATAAACTGGTGG - Intergenic
1162574343 19:11490104-11490126 ACCAATGGGCTCTAAATGGGGGG + Intronic
1165280164 19:34790148-34790170 ATCAATTGGCTCTAAATGTGTGG + Intergenic
1165612940 19:37172725-37172747 ATCAACAGCCTACAAAGGGGAGG - Exonic
1166239886 19:41483014-41483036 ATCAGTTGGCTATAAATGTGTGG - Intergenic
925316409 2:2929563-2929585 ATCAGTAGACTATACAGTGGAGG - Intergenic
925875032 2:8304125-8304147 ATCAATAGTCAAAAAAAGGGGGG + Intergenic
927525022 2:23731687-23731709 ATCAATAAACTATTAAGGGCAGG + Intergenic
928483920 2:31710714-31710736 ACTAATAGGCAATATAGGGGAGG + Intergenic
928792230 2:34971741-34971763 AACAATAGTCTATAAAGGAAAGG - Intergenic
928844379 2:35652070-35652092 GTCAATAGGCCATATAAGGGTGG - Intergenic
929264022 2:39898650-39898672 ATCAACCAGCTATAAATGGGAGG + Intergenic
929446768 2:42008341-42008363 ATCAGGAGGCTCTACAGGGGAGG + Intergenic
931600531 2:63998707-63998729 AACAAAAAGCTATAAAGTGGGGG - Intronic
934878024 2:97944163-97944185 ATCAATTGGCCATAAATGCGAGG - Intronic
938958916 2:136323401-136323423 ATCAGCAGGCTGGAAAGGGGTGG - Intergenic
938999532 2:136718107-136718129 TCCAATAGGCTATAAAGTGTAGG + Intergenic
942652706 2:178185154-178185176 ATCAATTGACTATAAAAGTGTGG - Intergenic
942750879 2:179285780-179285802 ATCAATAGGTTAAAAAAAGGTGG - Intergenic
944540362 2:200748544-200748566 ATCACTAGGCTGTAAGGAGGTGG - Intergenic
945379816 2:209127224-209127246 ATCAATGGGCTATAAATGTGTGG + Intergenic
945418245 2:209601563-209601585 ATCAATAGGCTATAAAGGGGTGG + Intronic
947037207 2:225873186-225873208 ATCCATAGGATATGAAGGGCAGG - Intergenic
947696945 2:232198892-232198914 ATGAATAGGATATACAGGGTAGG - Intronic
1168869388 20:1115549-1115571 ATCAGTGGGCTTTCAAGGGGTGG - Intronic
1170170883 20:13411126-13411148 ATCAGTTGGCTATAAAGGTATGG + Intronic
1170862239 20:20117384-20117406 ATAAATAGGCTATAAATGCATGG + Intronic
1173757473 20:45530336-45530358 ATCAATTGACCATAAATGGGTGG + Intergenic
1175436382 20:58953630-58953652 ATCAATTGGCCATATAGGTGTGG - Intergenic
1176332767 21:5564402-5564424 ATCAAAAAGCTAGAAAGGGCCGG - Intergenic
1176394990 21:6256550-6256572 ATCAAAAAGCTAGAAAGGGCCGG + Intergenic
1176402602 21:6327834-6327856 ATCAAAAAGCTAGAAAGGGCTGG - Intergenic
1176434555 21:6661270-6661292 ATCAAAAAGCTAGAAAGGGCTGG + Intergenic
1176442167 21:6732555-6732577 ATCAAAAAGCTAGAAAGGGCCGG - Intergenic
1176458817 21:6988340-6988362 ATCAAAAAGCTAGAAAGGGCTGG + Intergenic
1176466429 21:7059624-7059646 ATCAAAAAGCTAGAAAGGGCCGG - Intronic
1176489990 21:7441402-7441424 ATCAAAAAGCTAGAAAGGGCCGG - Intergenic
1181270704 22:21657160-21657182 AACAAGTGGCTGTAAAGGGGAGG + Intronic
949228531 3:1722917-1722939 ATCAATGAGCTATTAAGTGGTGG + Intergenic
952459233 3:33506772-33506794 ATCAATTGCCTATAAATGTGAGG + Intronic
957991172 3:87629362-87629384 ATCAATTGGCTATAAATGCATGG - Intergenic
959831489 3:110868432-110868454 ATTAACAGGCAATAAAGTGGAGG - Intergenic
960478166 3:118157197-118157219 ATCAATTGACTATAAATGTGTGG - Intergenic
960766730 3:121138602-121138624 ATCAATTGGCTGTAAATGTGTGG - Intronic
961513191 3:127416389-127416411 ATCAATTGGCCATAAATGTGTGG - Intergenic
963773898 3:149419121-149419143 TTCAATAAGCTATAAAAGGTAGG + Intergenic
965473447 3:169124001-169124023 ACAAATAGGCTATGAAGGGAAGG + Intronic
965937376 3:174130756-174130778 ATGAGTAGAGTATAAAGGGGAGG + Intronic
966382175 3:179355101-179355123 ATATATGGGCTAAAAAGGGGAGG - Intronic
971033365 4:22665996-22666018 ATCAATTGACTATAAATGTGAGG + Intergenic
971277646 4:25213276-25213298 ATCAATAGGGTTAAAAGTGGAGG + Intronic
972894859 4:43607449-43607471 AACAATAGGCAATATAGGAGAGG + Intergenic
972897386 4:43639960-43639982 ATGAATAGGCGATAAGGAGGTGG - Intergenic
975410831 4:74047264-74047286 ATCAATAGGCTGTAAATATGTGG + Intergenic
975570854 4:75816266-75816288 AACAATAGGTTAAAAAGTGGGGG - Intergenic
977417962 4:96759184-96759206 ATCAATTGGCTACAAAAAGGTGG + Intergenic
979594026 4:122513129-122513151 ATCAAAAGGCAATTAAGGGCAGG + Intergenic
979885081 4:126017108-126017130 ATCAACAGGCAATAAAGAAGAGG - Intergenic
981831081 4:149002761-149002783 ATCTATAGGCTTTTAAGGAGAGG + Intergenic
981966774 4:150613537-150613559 AACAAGAGGCTATAGAGGGCAGG + Intronic
982865099 4:160500377-160500399 ATCAATAGGATATTCAGGGATGG + Intergenic
983521761 4:168716586-168716608 AACAATAGGGTATCAAAGGGTGG - Intronic
985140824 4:186839517-186839539 ATAAATAGGATTTAAAGGGGGGG + Intergenic
987702189 5:21415192-21415214 ATGAATAGGCTATAAGTAGGAGG + Intergenic
990340950 5:54822456-54822478 ATATATAGTCTAAAAAGGGGAGG + Intergenic
992060782 5:73044536-73044558 ATCAATAGGCTATCATGGTAGGG + Intronic
993472059 5:88318268-88318290 ATCAATTGGCTGTAAATGTGAGG + Intergenic
994886591 5:105570928-105570950 ATCAATTGGCTATAAATGTATGG - Intergenic
996641977 5:125766082-125766104 ATCAGTTGGCTATAAATAGGTGG + Intergenic
997022408 5:130016861-130016883 CTCAAAAGGCTTTAAAGTGGTGG - Intronic
997041213 5:130256891-130256913 ATGAATTGGCTATAAATGTGTGG + Intergenic
999635089 5:153613594-153613616 CTTAATAGACTATAAAGGAGAGG - Intronic
1000930561 5:167246073-167246095 ACCAATGGGCTGGAAAGGGGTGG + Intergenic
1000961651 5:167607883-167607905 AGCAATGGGCTATGTAGGGGCGG - Intronic
1003558183 6:7159047-7159069 ATAAATCGGCTATAAAAGGAGGG - Intronic
1003903486 6:10677312-10677334 ATCAGTGGGCTATAAATGTGTGG + Intronic
1008566142 6:52770475-52770497 AATAATATTCTATAAAGGGGTGG - Intergenic
1011523231 6:88233969-88233991 ATCAGTTGGCTATAAATGTGTGG - Intergenic
1012953212 6:105540976-105540998 ATAAATAGGTTATAAATGGAGGG + Intergenic
1013245514 6:108283523-108283545 ATTCATAGGAAATAAAGGGGGGG + Intergenic
1016734556 6:147462546-147462568 ATCAATAGACCATAAATGTGAGG - Intergenic
1016734695 6:147464517-147464539 ATCAATAGACCATAAATGTGAGG + Intergenic
1020025026 7:4893779-4893801 CTATATAGTCTATAAAGGGGAGG - Intergenic
1021737345 7:23653071-23653093 ACCAATTGGCTATAAACTGGGGG + Intergenic
1023380398 7:39601461-39601483 AACAATAAACTATAAAGGGCCGG + Intronic
1024488296 7:49946120-49946142 AACAAAAAGCTAAAAAGGGGGGG - Intronic
1026591992 7:71704712-71704734 ATCAATGGACTATAAATGTGAGG - Intronic
1027920914 7:84393339-84393361 ATCAATTGACTATAAATGTGTGG + Intronic
1027957402 7:84898694-84898716 ATCACCAGGCTAAAGAGGGGAGG + Intergenic
1028026941 7:85855009-85855031 ATCAATTGGCTATAAATGCATGG + Intergenic
1028911752 7:96215506-96215528 ATCAATTGACTATAAATGTGAGG - Intronic
1032352108 7:131174266-131174288 ATCAAAAGTCTTTAAAGGGTGGG - Intronic
1032778553 7:135142429-135142451 AACAATAGGCTATTAAGTGTTGG + Intronic
1034430187 7:151037392-151037414 AGCAATAAGCTATAAGGGTGGGG - Intronic
1036399817 8:8398094-8398116 ATCCACAGGCCCTAAAGGGGAGG - Intergenic
1039560823 8:38511079-38511101 ATCAATATGCAGTAAAGAGGAGG - Exonic
1041622230 8:59985202-59985224 ATCAATTTGCTATAAATGTGTGG + Intergenic
1044844897 8:96371169-96371191 ATGAACAGGGTTTAAAGGGGAGG - Intergenic
1045139177 8:99260608-99260630 GTTAATTGGCTAGAAAGGGGAGG + Intronic
1045145909 8:99344152-99344174 ATCAATTGACTATAAATGAGTGG - Intronic
1046267442 8:111848584-111848606 ATCAATTGGCTGTAAATGTGTGG + Intergenic
1050084971 9:1955383-1955405 ATCAGTTGGCTATAAATGTGTGG - Intergenic
1051224704 9:14886603-14886625 ATCAATAGAATGTACAGGGGCGG + Intronic
1052657705 9:31384491-31384513 ATCAATTTGCTATAAAAAGGAGG + Intergenic
1055021678 9:71676546-71676568 AAGAACAGGTTATAAAGGGGAGG - Intergenic
1058133706 9:101283355-101283377 ATCAGTTGGCTATAAACGTGTGG - Intronic
1058499450 9:105595825-105595847 ATCTATAAGCTATAGATGGGAGG - Intronic
1062140350 9:134953791-134953813 ATCAATAGGCCATAGATGTGAGG + Intergenic
1185971996 X:4675555-4675577 CTCTATGGTCTATAAAGGGGAGG - Intergenic
1187080786 X:15984955-15984977 AAAAATAGTCTATTAAGGGGTGG - Intergenic
1188327828 X:28828664-28828686 ATCAATTGACTATAAATGTGAGG + Intronic
1189769069 X:44404551-44404573 ATCAGTTGGCTATAAATGTGTGG + Intergenic
1191037440 X:56041981-56042003 ATCAAAAAGCTAGAAAGGGCTGG - Intergenic
1193512046 X:82414731-82414753 ATCAATAGGATTTATAAGGGAGG + Intergenic
1193867682 X:86756033-86756055 ATCAGTTGGCTATAAATGGGTGG + Intronic
1194378067 X:93160533-93160555 ATCAATGGGCTATAAATGTGTGG - Intergenic
1194942868 X:100033128-100033150 ATAAAAATGCTATAAAGGAGAGG - Intergenic
1195786778 X:108533223-108533245 ATCAATTGGCTATGAAGATGTGG - Intronic
1196771449 X:119298822-119298844 ATCAATTGACCATAAATGGGTGG + Intergenic
1197185918 X:123587444-123587466 ATCAATTGACTATAAATGTGAGG + Intergenic
1198614265 X:138438136-138438158 ATCAATGGAGTATAAAGGTGAGG + Intergenic