ID: 945419940

View in Genome Browser
Species Human (GRCh38)
Location 2:209622408-209622430
Sequence GTGTCCTTCCCAGCATCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 218}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945419940_945419941 -9 Left 945419940 2:209622408-209622430 CCTTGTGATGCTGGGAAGGACAC 0: 1
1: 0
2: 0
3: 24
4: 218
Right 945419941 2:209622422-209622444 GAAGGACACTTAAACTCTCTTGG 0: 1
1: 0
2: 2
3: 48
4: 340
945419940_945419945 17 Left 945419940 2:209622408-209622430 CCTTGTGATGCTGGGAAGGACAC 0: 1
1: 0
2: 0
3: 24
4: 218
Right 945419945 2:209622448-209622470 GTTTTCTCATTTGTAAAGTGGGG 0: 6
1: 110
2: 833
3: 3273
4: 8345
945419940_945419944 16 Left 945419940 2:209622408-209622430 CCTTGTGATGCTGGGAAGGACAC 0: 1
1: 0
2: 0
3: 24
4: 218
Right 945419944 2:209622447-209622469 TGTTTTCTCATTTGTAAAGTGGG 0: 3
1: 33
2: 406
3: 2158
4: 7346
945419940_945419946 30 Left 945419940 2:209622408-209622430 CCTTGTGATGCTGGGAAGGACAC 0: 1
1: 0
2: 0
3: 24
4: 218
Right 945419946 2:209622461-209622483 TAAAGTGGGGACAATAATAGAGG 0: 1
1: 0
2: 10
3: 54
4: 247
945419940_945419943 15 Left 945419940 2:209622408-209622430 CCTTGTGATGCTGGGAAGGACAC 0: 1
1: 0
2: 0
3: 24
4: 218
Right 945419943 2:209622446-209622468 CTGTTTTCTCATTTGTAAAGTGG 0: 2
1: 41
2: 438
3: 2341
4: 7648

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945419940 Original CRISPR GTGTCCTTCCCAGCATCACA AGG (reversed) Intronic
900325290 1:2105813-2105835 GTGACCTTCCCGGCATCACCTGG - Intronic
900336538 1:2166756-2166778 CTGTGCTTCCCAGCATCCCTTGG + Intronic
902188610 1:14744352-14744374 GTGGCCTGTCCAGAATCACATGG + Intronic
903010305 1:20325115-20325137 GTGCTTTTCCCAGCATCACAGGG + Intronic
904445903 1:30572743-30572765 CTGTCTGTCCCAGCATCACTGGG - Intergenic
904602727 1:31682830-31682852 CTGCCCATCCCAGCAGCACAGGG - Intronic
905092134 1:35438117-35438139 CTTTGCTTCCCAGCATCACCAGG + Intronic
905283079 1:36861439-36861461 CTCTCCTTCCCAGCACCAGATGG - Intronic
906265495 1:44425625-44425647 GAGACTTACCCAGCATCACACGG - Intronic
908559183 1:65287934-65287956 GTGTTCTTCCCAGCACTTCATGG - Intronic
912708706 1:111934113-111934135 GTGACCTACCCAGAACCACACGG - Intronic
913117414 1:115710343-115710365 ATGACTTGCCCAGCATCACACGG + Intronic
913380561 1:118205779-118205801 GTGGCCATCTCAACATCACAGGG + Intergenic
916840844 1:168599038-168599060 GTCCCTTTCCCAGCATCTCAGGG - Intergenic
918472068 1:184885005-184885027 GCCTCCTACCCAACATCACAGGG + Intronic
920962360 1:210674630-210674652 GTGTCTTACCCAGCTACACAGGG + Exonic
921160783 1:212470794-212470816 CTGTCCTTCCAAACACCACAGGG + Intergenic
921609492 1:217194425-217194447 CTGTCCTTGGCAGCATTACAGGG + Intergenic
922796029 1:228340314-228340336 GTGGCCTTCCCAGAAGCACAGGG - Intronic
1063139409 10:3243137-3243159 GTGACCTTCCCACCAGCACTGGG + Intergenic
1063162789 10:3431713-3431735 GTGCCATTCCCAGGAGCACAGGG - Intergenic
1063455962 10:6182869-6182891 GTGCCCTTCCCAGCCCCCCAGGG + Intronic
1064719997 10:18219383-18219405 ATGTCTTTGCCAGCAGCACATGG - Intronic
1068956934 10:62826930-62826952 ATGGCCTTGCCAACATCACAGGG - Intronic
1069048501 10:63767422-63767444 ATGCCTTTCCCAACATCACATGG - Intergenic
1073596554 10:104806137-104806159 GTGTCCTTCCTAAGACCACATGG + Intronic
1075377939 10:121994593-121994615 CTGTCTTCCCCAGGATCACATGG - Intronic
1076067597 10:127461125-127461147 TTGTCCCTCCCAGGCTCACATGG - Intergenic
1076666737 10:132097418-132097440 GTGGCCCTCCAAGCATCACACGG + Intergenic
1077257372 11:1592963-1592985 ATGTGCTTCCCAGAATCAAAAGG - Intergenic
1077619258 11:3705383-3705405 ATGTGCTTCCCAGAATCAAAAGG + Intronic
1078911644 11:15738235-15738257 GTGACCTTCTCAAGATCACAGGG + Intergenic
1079605536 11:22360900-22360922 GTGACCTACCCAGCATGTCATGG + Exonic
1081960263 11:47130784-47130806 ATGTCCTTCCGAGCATCTCTTGG + Intronic
1082723025 11:56701982-56702004 GTGACCTTCTGAGCATCAAAGGG + Intergenic
1083162418 11:60862985-60863007 GTGTCCTTCTCAGTATCTCGAGG - Intergenic
1083413782 11:62512284-62512306 GTGTTCCTCCCTGCTTCACACGG + Intronic
1084972344 11:72778764-72778786 GTATCCTTGCCTGCATCCCAGGG + Intronic
1085193612 11:74651272-74651294 ATGACTTTCCCAGGATCACATGG - Intronic
1087729385 11:101760912-101760934 GTGGTCTTCCCAGCCTCACATGG + Intronic
1089586703 11:119514044-119514066 GTGACTTTCCCAGAGTCACACGG - Intergenic
1091840541 12:3617350-3617372 GTGTCTTTGCCTGAATCACAGGG - Intronic
1091958557 12:4670451-4670473 GTTTGCTTCACAGAATCACAGGG - Intronic
1094375526 12:29784126-29784148 GTGTCCTTCCCCGCAGCTCCCGG - Intronic
1096840775 12:54378353-54378375 GTGTCCAAGCCAGCATCCCAGGG - Intronic
1100328828 12:93567085-93567107 GAGTGCATCCCAGGATCACAGGG + Intergenic
1100607202 12:96161650-96161672 GTGCCCTTCTCTGCTTCACAGGG - Intergenic
1100609601 12:96180327-96180349 GTGTTTTTCCCAAAATCACACGG + Intergenic
1101985462 12:109442623-109442645 GTGACCTGCCCAGGATCTCACGG - Intronic
1108497487 13:51039954-51039976 GTGTCCCTGCCAGCCTCACTGGG - Intergenic
1109406533 13:61907611-61907633 GAGTCCATCCCAGCAACTCAGGG + Intergenic
1112247228 13:97746240-97746262 TCTTCCTTCCCAGCCTCACAGGG + Intergenic
1112394350 13:99014774-99014796 GTGGCCTTCCCACCAGCACCAGG - Intronic
1113914092 13:113860794-113860816 GTGTCCCTTCCAGCAGAACAGGG + Intronic
1114580196 14:23750308-23750330 TTGTCATTCCCAGTCTCACAGGG - Intergenic
1115751954 14:36502887-36502909 ATGTCCTTCCAAGCCTCAGATGG + Intronic
1116287488 14:42991156-42991178 CTTGTCTTCCCAGCATCACAAGG + Intergenic
1116763067 14:49038736-49038758 GTGCCCTTCCCAGCATGGGAGGG + Intergenic
1117738187 14:58788705-58788727 GTGTCCTTCCCACCACCCCAGGG + Intergenic
1117773805 14:59161910-59161932 GTCTCTTTCCCAGCAGAACACGG - Intergenic
1118391333 14:65298316-65298338 GTTTCCCACCCAGCATCCCATGG - Intergenic
1119478999 14:74948222-74948244 GGGTCCCTCCCAGCCTCGCAGGG - Intronic
1120316945 14:82906339-82906361 TATTCCTTCCCAGCATCCCAAGG - Intergenic
1121281895 14:92705026-92705048 GTGTCCCTCCCAGAATCAAAAGG - Intronic
1121618714 14:95331636-95331658 GTCTCCTTCCCACCTCCACAGGG - Intergenic
1121748062 14:96318368-96318390 GTGACCTTCCCAAAGTCACATGG + Intronic
1123124945 14:105939899-105939921 ATGTCCTTCCCAGCCACTCAAGG + Intergenic
1123996153 15:25719337-25719359 GTCACCTGCCCACCATCACAAGG + Intronic
1126049619 15:44674176-44674198 GTGACATTCCCAGCATACCAGGG + Exonic
1127580733 15:60337206-60337228 GTGACTTTCCCAGAGTCACATGG - Intergenic
1128367468 15:67014556-67014578 CTTTCCTTCCCAGAAGCACAAGG + Intergenic
1129508255 15:76101149-76101171 GTGACTTTCCCAGGATCACATGG + Intronic
1130356283 15:83133720-83133742 GTGATGTTCCCAGCAGCACAAGG - Exonic
1132520112 16:383167-383189 GTGTCCTTCCCAGGATGTGAGGG + Intronic
1133366592 16:5215161-5215183 CTGTTCTTCCCAGCAACAAATGG - Intergenic
1137335833 16:47547756-47547778 GTGTCTTTCCCAACCTCCCAAGG + Intronic
1137679386 16:50326356-50326378 TTGTCATTCCCAGTCTCACAGGG + Exonic
1138944598 16:61833043-61833065 GTGACCTGCCCACGATCACATGG - Intronic
1139399419 16:66668874-66668896 GTATTCTTCCCAGCAGTACATGG - Intronic
1140647177 16:77045328-77045350 GCGCACTTCACAGCATCACAGGG + Intergenic
1140671459 16:77283928-77283950 GTGTCCTCCCCAGCACCTTAGGG - Exonic
1141876789 16:86830401-86830423 GTGTTCTTGCCGGCATCACTGGG - Intergenic
1142051232 16:87959625-87959647 GTGTCCCTCCCAAAACCACACGG - Intronic
1142214716 16:88824891-88824913 GTGTCCTTCCTGTCATTACATGG - Intronic
1143294265 17:5859037-5859059 GTGTCCTTCCCAATATCGCTTGG - Intronic
1144811984 17:18006492-18006514 GTGTGCTTGCCTGCAACACAGGG - Intronic
1147641531 17:42004495-42004517 GAGTCATTCCCAGCATCTCTTGG - Intronic
1151277786 17:73048993-73049015 GTGTCATTCCCAGCAGCCCAGGG + Intronic
1151694215 17:75705775-75705797 GTATCCCTCCCGGCATCACCAGG - Intronic
1152147955 17:78580515-78580537 GTGGCCTTCCTATCCTCACATGG - Intergenic
1152190090 17:78883057-78883079 GGTTCCTGCCCAGCACCACAGGG - Intronic
1153050012 18:893332-893354 GAGTATTTCCCAGCATCACTTGG + Intergenic
1159118022 18:64137160-64137182 GTTTCCTCCTCAGCATCACATGG - Intergenic
1160237543 18:77097957-77097979 GTGTCCTTCCCCACTTCCCAGGG - Intronic
1161984599 19:7646637-7646659 CTGGCCTTCCCAGGATCCCAGGG + Intronic
1162415751 19:10536069-10536091 GGGTCCTTCCTAGCTTCCCATGG + Intergenic
1163726455 19:18925821-18925843 GTGACCTGCCCAGCACCACAGGG - Intronic
1164888137 19:31800768-31800790 GTCTCTTCCCTAGCATCACATGG + Intergenic
1166270153 19:41708579-41708601 GAGTACTTCTCAGCATCACGTGG - Intronic
1166755032 19:45185347-45185369 ATGGCCTTCACACCATCACACGG + Intronic
1167593970 19:50417944-50417966 GTGACCTTGCAAGCATCCCATGG + Exonic
1167708905 19:51098486-51098508 GTCTCCTTCCCAACCCCACATGG + Exonic
925080612 2:1061239-1061261 GCGTCCAACCCAGGATCACACGG - Intronic
925975607 2:9139987-9140009 GTGACGTCCCCAGGATCACAGGG + Intergenic
926559003 2:14394747-14394769 GTGTACATCCCAGCCACACAAGG - Intergenic
926625669 2:15087632-15087654 GTGTCCTTCCCAGGCTAAAAAGG - Intergenic
927685622 2:25168643-25168665 TTGACCTTCCCGGCAGCACAAGG + Exonic
928323794 2:30304021-30304043 TTGTTCTTCCCAGCAACAAAGGG + Intronic
928487308 2:31745722-31745744 GTGTCCTTCCCTTCATCCAAGGG + Intergenic
929805926 2:45145066-45145088 CGTTCCTGCCCAGCATCACAGGG + Intergenic
930619407 2:53628061-53628083 GTGTCCTCCCCAGGAGCCCACGG + Intronic
931804555 2:65791315-65791337 GTGTAGTTCCCAGCATTTCAAGG + Intergenic
932682976 2:73842447-73842469 GAGTCCATCCCAGCAGCTCAAGG - Intronic
933833156 2:86226415-86226437 GTGTCCTTACCTGGAGCACAAGG + Intronic
933943944 2:87268141-87268163 TTGTCCTTCCCAAGGTCACAGGG - Intergenic
935406946 2:102719112-102719134 GGCTCCTTCCCAACAGCACATGG + Exonic
936336276 2:111593438-111593460 TTGTCCTTCCCAAGGTCACAGGG + Intergenic
937299548 2:120830699-120830721 GTGCCCTTCCCAGAACCTCATGG + Intronic
939886727 2:147689374-147689396 GTGTCCTTTCCCACAACACAAGG - Intergenic
940525853 2:154812340-154812362 GTGTCCTACACACCATGACAAGG - Intronic
945419940 2:209622408-209622430 GTGTCCTTCCCAGCATCACAAGG - Intronic
946122983 2:217532643-217532665 GAGGCCTCCCCAGCCTCACATGG + Intronic
948356927 2:237385515-237385537 ATGACCTGCCCAGGATCACATGG + Intronic
1168961727 20:1874630-1874652 GTGACTTGCCCAGCATCACATGG - Intergenic
1170083786 20:12506541-12506563 GTGACTTTACCAGGATCACAAGG - Intergenic
1170605172 20:17870226-17870248 GTGTGCCTCCCAGCTTCCCACGG + Intergenic
1171306630 20:24112565-24112587 GTGTCCATCCCATGCTCACAGGG + Intergenic
1171894698 20:30748771-30748793 ATGTTCTTCCCAAAATCACAGGG + Intergenic
1174060074 20:47826446-47826468 TTTCCCTTCCCAGCCTCACATGG + Intergenic
1174071822 20:47904930-47904952 TTTCCCTTCCCAGCCTCACATGG - Intergenic
1174152231 20:48493739-48493761 TTTCCCTTCCCAGCCTCACATGG + Intergenic
1174391779 20:50222230-50222252 AGGTCTTTCCCAGGATCACAGGG + Intergenic
1176024588 20:62979161-62979183 GTGTTTTTGCCAGCATCCCATGG + Intergenic
1176296002 21:5073553-5073575 GTCACCTCCCCAGCACCACAAGG + Intergenic
1177348300 21:19900985-19901007 GTCTCCCTCCCAGCATCCAATGG + Intergenic
1179169045 21:38958435-38958457 GTGTCATTCCCAGCAGCCCCAGG + Intergenic
1179439385 21:41382503-41382525 TTGACCTTCCCGGCATCACCAGG + Exonic
1179616160 21:42584566-42584588 CTGTCCTTCCCAGCAGTCCAGGG - Intergenic
1179713737 21:43277160-43277182 GTGTCCTCCCCACCCTCCCAGGG + Intergenic
1179818543 21:43923189-43923211 GTGTCCCTTCCTGCAGCACAAGG - Intronic
1179861047 21:44188568-44188590 GTCACCTCCCCAGCACCACAAGG - Intergenic
1179914785 21:44469276-44469298 GTCCCCTTCCCCGCATCATACGG - Intergenic
1179957891 21:44751381-44751403 GTTTCATTCTCAGCAGCACAGGG - Intergenic
1181754728 22:25015737-25015759 GTGTCCTACCCTACATCCCATGG + Intronic
1182420429 22:30246090-30246112 CTGTTCGTCCCAGCATCCCAAGG + Intronic
1183295919 22:37029507-37029529 GTGTCCTGCCCAGCTTCAGTGGG - Exonic
949954419 3:9255932-9255954 ATGACTTTCCCAGCATCCCATGG + Intronic
951166984 3:19494280-19494302 GGGTCCCTCCCACCAACACATGG - Intronic
951974403 3:28488126-28488148 GTGTCCCTCCCACCATGACTAGG + Intronic
953251341 3:41247802-41247824 TTGTCCTTTCCAGCCTCACTGGG - Intronic
953417003 3:42728273-42728295 GTGCTCATCCCAGCATCCCAGGG - Intronic
954394471 3:50286226-50286248 GTTTCCTTCCAAGCACCCCAGGG - Intronic
954459679 3:50619274-50619296 GTGTCTTTCCCAGGACCACTAGG + Intronic
955541359 3:59979923-59979945 CAGTCCTTCCCAGCATAATAAGG + Intronic
956090168 3:65657853-65657875 GTGACCTTCCCAGTATCATCTGG - Intronic
956770515 3:72522115-72522137 GAATACTCCCCAGCATCACAGGG + Intergenic
959420985 3:106128069-106128091 GAGTGCTTCCCAGAATCAAAAGG - Intergenic
960148527 3:114228724-114228746 TTATCCTTCCCACCATCCCAAGG - Intergenic
961097518 3:124170425-124170447 GTGTCTTATCCAGCGTCACATGG + Intronic
961473663 3:127134148-127134170 GTGGCCTGTCCAGCCTCACAGGG + Intergenic
961858104 3:129893187-129893209 GTTCCCTTCCCAGCATCCCAGGG - Intronic
964757510 3:160101935-160101957 TTGTCATTCCCAGTCTCACAGGG - Intergenic
965030983 3:163367557-163367579 GAGTCCTTCCCAGAAGCAGATGG + Intergenic
966093844 3:176173751-176173773 GTGTCCTTCCCAGCCTCAGTTGG - Intergenic
967965681 3:194958315-194958337 GTATCATTGCCAGCATCACATGG + Intergenic
969147412 4:5136284-5136306 GTGTCCTTGCCAAAAACACAAGG - Intronic
969509159 4:7607784-7607806 GTCACATTCCCAGGATCACATGG + Intronic
969842112 4:9890345-9890367 GTGTCTTGCCCAAGATCACACGG + Intronic
972763885 4:42133502-42133524 GTAACCTGCCCAGGATCACATGG - Intronic
974794209 4:66728050-66728072 GTTTCCTTCCCAGGGTAACAAGG + Intergenic
978851052 4:113337041-113337063 GTTTCCTTCTCAGCAACACGGGG - Intronic
986496177 5:8344214-8344236 GAGCCCATCCCAGCATAACATGG - Intergenic
986853289 5:11838141-11838163 ATGCCCTTCCCAACATCTCAAGG + Intronic
992117608 5:73555920-73555942 GTGTCTTGCCCAGGGTCACATGG - Intronic
992982736 5:82193428-82193450 CTGTCCTTCACAGCCTCACACGG + Intronic
992993329 5:82307636-82307658 ATTTCCTTGCCAGCACCACAAGG - Intronic
993280586 5:85920511-85920533 GTGGCCTTGCTAGCATCCCAAGG - Intergenic
993639716 5:90387634-90387656 GAGACCTTCCCAGCACTACAGGG - Intergenic
995789892 5:115875313-115875335 CTGATCTTCCCAGCATCACCTGG + Intronic
997405575 5:133644100-133644122 GTGTCCTTCCCAGGGCCACAGGG + Intergenic
997984375 5:138491589-138491611 GTACCCGTCCCAGCATCACCCGG + Intergenic
1002415292 5:179117286-179117308 GTGTCCCTCCCAGCACCATCAGG - Intronic
1006239125 6:32662039-32662061 GAGTCATTTCCAGCATCACCAGG + Exonic
1006284870 6:33085137-33085159 GGGTCATTTCCAGCATCACCAGG - Exonic
1006949418 6:37809200-37809222 GAGTCCATCCCAGCCACACATGG + Intergenic
1010814489 6:80341425-80341447 TTGTCATTCCCAGCCTCAAAGGG + Intronic
1011554476 6:88560334-88560356 GTAGCCTGCCCAGGATCACATGG + Intergenic
1013571492 6:111430924-111430946 TTGTCATTCCCAGTCTCACAGGG - Intronic
1013819586 6:114138568-114138590 GTTTCCTTCCTAGCATCTCTCGG + Intronic
1018714238 6:166519654-166519676 GTTTCCTTCCCAGGAAAACACGG + Intronic
1021320368 7:19202760-19202782 GTGACCTTCACTGTATCACAGGG + Intergenic
1021591398 7:22267277-22267299 AGGTACTTCCCATCATCACAGGG - Intronic
1022589744 7:31650341-31650363 GTCTGCCTCCCAGCAGCACAAGG - Intronic
1023903813 7:44506821-44506843 GTGTTCTTCCCAGTGTCAGAGGG + Intergenic
1024231409 7:47366725-47366747 GTGGCCTGCCCAGGTTCACATGG - Intronic
1025234842 7:57227559-57227581 TTTCCCTTCCCAGCCTCACATGG - Intergenic
1028739860 7:94261492-94261514 ATCCCCTTCCCAGCATTACAGGG + Intergenic
1029106238 7:98178899-98178921 GTGACCAGCCCAGCATCACATGG + Intronic
1030371376 7:108703197-108703219 ATGACTTTCCCAGGATCACACGG + Intergenic
1030778142 7:113562492-113562514 GTGTTCTTCCCAGTATGCCAGGG - Intergenic
1031451891 7:121931565-121931587 GTGTGTTTCCCAGCAGCCCAGGG + Intronic
1032839844 7:135705064-135705086 CTCTGCTTCCCATCATCACAAGG + Intronic
1033640290 7:143256740-143256762 GTGTTCTCCTCAGCATCTCAGGG + Intronic
1033869258 7:145730434-145730456 TTGTCCTTCCCACCATGACACGG - Intergenic
1034518779 7:151603064-151603086 GTTTCATTCTCATCATCACACGG + Intronic
1034540733 7:151756361-151756383 GGGTCCCTCCCAGCATTGCAAGG - Intronic
1037428553 8:18784762-18784784 GTGGGCATCCCAACATCACAGGG - Intronic
1040999067 8:53431872-53431894 CTGTCCTTCCCAACATCACGAGG + Intergenic
1043026939 8:75082099-75082121 GAGTGCATCCCAGGATCACATGG + Intergenic
1045363136 8:101451118-101451140 ATGTAGTTCCCAGCACCACAAGG + Intergenic
1047034028 8:120914824-120914846 GTGACTTTCCCAGGATCATATGG + Intergenic
1047379465 8:124345287-124345309 GAGTTCCTCCCAGCAACACATGG - Intronic
1048132869 8:131717036-131717058 GTGCCCTTCCCATCAACACATGG + Intergenic
1048979644 8:139696529-139696551 GTGTGCCTCCCACCAGCACAGGG + Intronic
1049408295 8:142461338-142461360 GAGTCCATCCCAGGTTCACAGGG - Intronic
1049476636 8:142799944-142799966 GCGTCCCTCCCAGCATGCCAAGG - Intergenic
1049852146 8:144838455-144838477 GTGTGCTGCCCAGCATGACAAGG + Intronic
1051358007 9:16257419-16257441 GTGTCCTTCCCAGCTCCTCCAGG + Intronic
1052324505 9:27203098-27203120 GTGACCCTCCCAGAATCTCAAGG + Exonic
1054353941 9:64043994-64044016 ATGTTCTTCCCAAAATCACAGGG - Intergenic
1055424339 9:76178440-76178462 GTGGCTTGCCCAGTATCACATGG - Intronic
1055572463 9:77631304-77631326 GTTTACATCCCATCATCACATGG + Intronic
1057290513 9:93803136-93803158 TGGTGCTTCCCAGCATCACATGG - Intergenic
1057691781 9:97292340-97292362 GTGACCTTCCCAAGACCACATGG - Intergenic
1058456976 9:105146934-105146956 CTCTCAGTCCCAGCATCACAGGG + Intergenic
1059849200 9:118318282-118318304 GTGTACTTGACAGCAACACAGGG - Intergenic
1060789360 9:126475609-126475631 GTGCCCTTCTCACCAGCACAGGG - Intronic
1061930989 9:133833068-133833090 GTGGCCAGCCCAGCATCAAAGGG + Intronic
1062733299 9:138120985-138121007 TTGTCATTCCCAGCAACCCAAGG + Intronic
1203742277 Un_GL000218v1:13104-13126 ATGTTCTTCCCAAAATCACAGGG - Intergenic
1187094877 X:16137305-16137327 GTGTCCTTTCCAGCATGACCTGG + Intronic
1187585106 X:20651680-20651702 GAGTCCTTGACACCATCACAGGG - Intergenic
1190638873 X:52463751-52463773 GTATCTTGCCCAACATCACAAGG - Intergenic
1190680122 X:52819333-52819355 GTATCCTGCCCACCATCTCAAGG - Intergenic
1192710921 X:73586659-73586681 GTGACTTTCTCAGAATCACATGG + Intronic
1192729521 X:73788989-73789011 ATGTTCTTCTCAGCACCACATGG - Intergenic
1192855300 X:75003887-75003909 CTGTACTTCCCAGTATGACATGG + Intergenic
1194275102 X:91869308-91869330 GAGTTCTTGCCAGCATCAAAAGG + Intronic
1195865917 X:109432642-109432664 GTGTGCTGCCTAACATCACAGGG - Intronic
1196728249 X:118916549-118916571 ATTTCCTTCTCAGCATCCCAGGG + Intergenic
1200592344 Y:5090712-5090734 GAGTTCTTGCCAGCATCAAAAGG + Intronic
1201155811 Y:11130579-11130601 ATGTTCTTCCCAAAATCACAGGG - Intergenic
1202095254 Y:21243106-21243128 TTGTCCTTCTCAGCATGACTTGG + Intergenic