ID: 945426849

View in Genome Browser
Species Human (GRCh38)
Location 2:209716446-209716468
Sequence TGCACCACATGTGGCCCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 125}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945426849_945426853 -5 Left 945426849 2:209716446-209716468 CCCTTGGGGCCACATGTGGTGCA 0: 1
1: 0
2: 1
3: 18
4: 125
Right 945426853 2:209716464-209716486 GTGCAGGATGACTTTGAATGTGG 0: 1
1: 1
2: 32
3: 321
4: 553

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945426849 Original CRISPR TGCACCACATGTGGCCCCAA GGG (reversed) Intronic
903423886 1:23238692-23238714 TGAGCCTCATGGGGCCCCAAAGG - Intergenic
903940602 1:26927792-26927814 CAAAACACATGTGGCCCCAAGGG - Intronic
904292772 1:29498349-29498371 TGCTCCTCATCTGCCCCCAAAGG - Intergenic
905526173 1:38641720-38641742 TGGATCACATGTGGGCTCAAAGG + Intergenic
906691247 1:47794214-47794236 TGAAGCACATGTGGCCCCAGAGG - Intronic
907526275 1:55056028-55056050 AGCACCACCAGTGGCCCCACAGG - Exonic
910624015 1:89286864-89286886 TGAAGCACAGGTGGCCCCAATGG + Intergenic
915738715 1:158101611-158101633 GGCACTACATAAGGCCCCAAGGG + Intergenic
920150302 1:203900648-203900670 AGCTCCACCTGTGGCCCCAGTGG + Intergenic
920409157 1:205745052-205745074 TAAACCACATATGGCCCCAATGG + Intronic
921051923 1:211517097-211517119 TGCACCACAGGTGGCGTCATGGG - Intergenic
1062795482 10:341918-341940 TGCACGATACCTGGCCCCAAAGG + Intronic
1064934026 10:20660153-20660175 TGAAACAAGTGTGGCCCCAAAGG - Intergenic
1065370045 10:24975076-24975098 TAAACCACATGTGGCCTCCAGGG + Intergenic
1067486689 10:46657158-46657180 TGGACCACATGCAGCCCCACAGG + Intergenic
1067608059 10:47684504-47684526 TGGACCACATGCAGCCCCACAGG - Intergenic
1070376877 10:75841265-75841287 TGCAGCACATGTGTCCTTAAAGG + Intronic
1071623658 10:87146211-87146233 TGGACCACATGCAGCCCCACAGG - Intronic
1072799560 10:98383815-98383837 TGCAGCACATGTGGCCTTTAGGG - Exonic
1073150007 10:101305104-101305126 TGCTCCACATGAGTACCCAATGG + Intergenic
1074654838 10:115573136-115573158 TGGATCACATGTGGGCTCAAAGG + Intronic
1076098373 10:127753078-127753100 TGCTCCACATCTGTCTCCAAGGG + Intergenic
1076444843 10:130507379-130507401 TTCTCCCCATGTGGCCCCAGAGG + Intergenic
1077871966 11:6270273-6270295 TGCAGCACACGAGGCCCCACTGG - Exonic
1083998224 11:66282646-66282668 CGCTCCACATGTGGCCGCCAGGG - Intronic
1084675083 11:70629525-70629547 CCCACCACATGCGGCCCCCAGGG - Intronic
1084690413 11:70721984-70722006 TGCACCTCATGTGGCACTCAAGG + Intronic
1087025635 11:93646831-93646853 AGCACCACATGTGATTCCAATGG - Intergenic
1087551248 11:99652865-99652887 TGAAACACATCTGCCCCCAAGGG + Intronic
1090632800 11:128664935-128664957 TGAATCACAGGTGGCCCCAATGG - Intergenic
1096055142 12:48644382-48644404 GCCACCACACCTGGCCCCAAAGG + Intergenic
1096661991 12:53131390-53131412 TGCACGAGATGTGCCTCCAAGGG + Intergenic
1097150954 12:56979531-56979553 TGCACAACCTGAGGCTCCAAAGG - Intergenic
1099610513 12:84862475-84862497 TGAAGCACATCTGGCCCCAAGGG + Intronic
1100512856 12:95294171-95294193 GCCACCACACCTGGCCCCAAGGG + Intronic
1101736478 12:107466973-107466995 TGAAACACCTCTGGCCCCAAGGG + Intronic
1104971893 12:132534536-132534558 TGCCCCACATGTGCCCACACAGG + Intronic
1105847811 13:24308307-24308329 TGCACCGCAGGCGGCCCCGACGG - Intronic
1106169263 13:27274869-27274891 TGCACCACTTATGGTGCCAAGGG + Intergenic
1109639256 13:65165894-65165916 TGGACCACATTTGGCCCATAAGG + Intergenic
1111374214 13:87356238-87356260 GGTACCACAAATGGCCCCAAAGG + Intergenic
1113799261 13:113078048-113078070 ACCACCACCTGTGGCCTCAAAGG + Intronic
1113799291 13:113078162-113078184 GCCACCACCTGTGGCCCCAGAGG + Intronic
1120534098 14:85671512-85671534 GGCAGCACATGTGGCCACAGAGG - Intergenic
1121049355 14:90810293-90810315 TGAAATACATCTGGCCCCAAGGG + Intronic
1122160984 14:99783767-99783789 GCCACCACGTCTGGCCCCAAAGG + Intronic
1127772690 15:62243918-62243940 TGCACCCTCTGAGGCCCCAAGGG - Intergenic
1127920063 15:63487471-63487493 AGCACCACCTGTGTCCCCTAGGG + Intergenic
1128893111 15:71348697-71348719 TGCTCCAGATTTGGTCCCAAAGG + Intronic
1129137789 15:73569855-73569877 TTCACCACATGGGGCCTGAAAGG + Intronic
1129267471 15:74401673-74401695 TGGACCACAGGAGGCCCCAGAGG - Intergenic
1129788711 15:78326348-78326370 TGAAACACATCTGGCCCCAAAGG + Intergenic
1130910328 15:88266305-88266327 CTCACCACATGTGGTCCCCAGGG + Intergenic
1131282354 15:91032216-91032238 TGCACCCTCTGAGGCCCCAAAGG - Intergenic
1131554732 15:93387176-93387198 TGAAACACAGCTGGCCCCAAAGG + Intergenic
1131733407 15:95306021-95306043 TGGACCACATTAGGCACCAATGG + Intergenic
1135474310 16:22760809-22760831 AGCACCCCAGGTGGCCCCCAGGG - Intergenic
1138207423 16:55135077-55135099 TTCACCTCATTTGGCCCCAGGGG - Intergenic
1139470754 16:67176937-67176959 TGGACCACCTGCGGCCCCATGGG - Exonic
1139758546 16:69165408-69165430 TTCACCACCTTTGGCTCCAAAGG + Exonic
1140756532 16:78072363-78072385 TGCACTACCTGGGGCACCAAAGG - Intergenic
1145056555 17:19707200-19707222 TGCCCCACATGAGGCCCCAGGGG + Intronic
1147143383 17:38471775-38471797 TGGACCACTTGTGGCCGCACAGG - Intronic
1147244161 17:39109508-39109530 TGCTGGACCTGTGGCCCCAAGGG + Intronic
1147419174 17:40313564-40313586 TGCACCACGTGTGGCTACACAGG - Intronic
1148516014 17:48218075-48218097 TGCACCAAATCTGATCCCAAAGG - Intronic
1151231514 17:72688545-72688567 TGCTCCCCATGTGTCCCCCATGG + Intronic
1154028247 18:10726791-10726813 TGGACCACCTGCGGCCCCATGGG + Intronic
1156046313 18:32881369-32881391 TCCACCACTAGTGGCCCCAGTGG - Intergenic
1157958052 18:52121116-52121138 TGGACCACATGTGGCCCTGTGGG + Intergenic
1163684917 19:18706491-18706513 GCCACCACATCTGGCCCCATTGG + Intronic
928201667 2:29251234-29251256 TTCACCACATGTGGGGCCAGCGG - Exonic
935022666 2:99246699-99246721 TGCATCACAAGTGGCCCCAGAGG + Exonic
935176043 2:100649428-100649450 TGAACCACAAGTGGCCCAACTGG - Intergenic
935923849 2:108045335-108045357 TGCAGCTGATGTGGGCCCAATGG + Intergenic
936942973 2:117904523-117904545 TGAAACACATCTGGTCCCAAAGG - Intergenic
938510441 2:131936725-131936747 TGCTTCAGATGTGGCTCCAAAGG - Intergenic
940372408 2:152918052-152918074 TGCCCCACATGTGGCTCCAGTGG + Intergenic
941892749 2:170598616-170598638 TAGACCACATGTGGTCTCAATGG - Intronic
942891190 2:180990904-180990926 TGAAACACATCTGGCCCCAAGGG - Intronic
945426849 2:209716446-209716468 TGCACCACATGTGGCCCCAAGGG - Intronic
945631745 2:212287057-212287079 TGCTCCACAGGTAGCCCAAATGG + Intronic
1168820684 20:771639-771661 TGCAAGACATTTGCCCCCAAGGG - Intergenic
1170463722 20:16603425-16603447 GGCAAGACATGTGACCCCAAAGG + Intergenic
1172333259 20:34091427-34091449 GCCACCACACCTGGCCCCAATGG - Intronic
1172856886 20:38011601-38011623 TGAACCACATCTGCCACCAAAGG + Exonic
1173392214 20:42645408-42645430 TGAACCACAGTTGGCCACAATGG + Intronic
1173397043 20:42689456-42689478 TGGATCACATGTGGGCTCAAAGG - Intronic
1174007567 20:47422551-47422573 TGCACCAAATGGGGACCCAGAGG - Intergenic
1175310843 20:58010820-58010842 TGCCCCAGTTGTGGCCCCCATGG + Intergenic
1180926342 22:19557820-19557842 GCCACCACATGTGGCCCAAATGG - Intergenic
1182940313 22:34270365-34270387 TGCTCCACATGTGGCTGAAAGGG - Intergenic
953458393 3:43062143-43062165 TGAATCACATCTGGCCCCCAGGG + Intergenic
953955167 3:47226426-47226448 ACCACCACATGTGGCCTCAAGGG + Intergenic
966064940 3:175808650-175808672 TGCACCACCTAAGTCCCCAAAGG + Intergenic
969597207 4:8156246-8156268 TGCAGCCCATGTGGTCACAAGGG - Intronic
969650503 4:8464905-8464927 TGCACCCCATGTTGCTGCAAAGG - Intronic
970929511 4:21493138-21493160 TGCACTACAGATGGCCCCATGGG - Intronic
974597289 4:64030484-64030506 TGCACAGCTTGTGGCTCCAAAGG - Intergenic
977612170 4:99047359-99047381 TGCTCCAACTGCGGCCCCAAGGG - Intronic
978287757 4:107098685-107098707 TGCACAGCTTGTGGCTCCAAAGG + Intronic
981311634 4:143303459-143303481 TGAAACACATCTTGCCCCAAGGG - Intergenic
981548060 4:145915044-145915066 CGCACTACGTGTGGCCCCAAGGG - Intronic
985823396 5:2176104-2176126 TGCAGCAGGGGTGGCCCCAAGGG + Intergenic
986725655 5:10594603-10594625 TGAACCCCATGTGGCTCCCAGGG - Intronic
988903494 5:35760032-35760054 TGAAACACTTTTGGCCCCAACGG + Intronic
993145862 5:84093038-84093060 TGCACCACATGTGGTACCAATGG + Intronic
993302202 5:86225166-86225188 TGCACCACATGTACCACTAAAGG + Intergenic
993691182 5:91002730-91002752 TGGACAACATGAGGCCCCATGGG - Intronic
1001572380 5:172738615-172738637 TGGTCCACAAGTAGCCCCAAGGG - Intergenic
1004548275 6:16620837-16620859 AGCACCACATGTGGTCCCACAGG + Intronic
1006524177 6:34589601-34589623 TGCACCACATGTGCACACACGGG - Exonic
1006701030 6:35973460-35973482 TGGGCCACATGTGGCCCCGCAGG - Intronic
1006850234 6:37092950-37092972 GGCACCCCATGAGGGCCCAAGGG + Intergenic
1012893974 6:104928090-104928112 TCCACTACATATGGCCCAAAGGG + Intergenic
1014822220 6:126003191-126003213 TGGACCACATGTGGCCCAGATGG + Intronic
1018724084 6:166597253-166597275 GGCACCCCGTGAGGCCCCAAAGG + Intronic
1021761864 7:23910319-23910341 TGCACCACACTTGGGCCCACTGG - Intergenic
1024247810 7:47483669-47483691 TGCACCCCATCTGGCCACAGAGG - Intronic
1030093742 7:105879109-105879131 AGCAGCTAATGTGGCCCCAAAGG + Intronic
1030166839 7:106563825-106563847 TCCACCATATTTGGACCCAAAGG + Intergenic
1036795898 8:11756719-11756741 TGAAACACACGTGGCCTCAAGGG + Intronic
1040818281 8:51531441-51531463 TGCTCCAGATGTGGCCCTCAGGG - Intronic
1041030281 8:53729549-53729571 AGCACATCATGTGGCCCCCAGGG - Intronic
1043029894 8:75121035-75121057 GGTAACACATGTGGCCCCCATGG - Intergenic
1043526220 8:81099181-81099203 TGAAAGACATTTGGCCCCAAAGG + Intronic
1045108140 8:98913652-98913674 TGCACCACATGTGCCCACTCAGG + Intronic
1045758683 8:105575877-105575899 TGAACCATATGTGGATCCAAAGG - Intronic
1047241179 8:123089973-123089995 TGAAACACATCTGGCCCCAAGGG + Intronic
1048193401 8:132310625-132310647 GGCACCACAGGTGGCACCACAGG + Intronic
1048545898 8:135386894-135386916 TGCAGCTCCTGTGGCCCCACTGG - Intergenic
1049009729 8:139879350-139879372 TGCACCACACGTGCTCCCAGTGG + Intronic
1049354294 8:142179974-142179996 TGGGCCACAGGTGGCCCCAGGGG + Intergenic
1055777546 9:79782437-79782459 TTGACCACGTGTGGCCCCACTGG - Intergenic
1057101888 9:92369182-92369204 TGCTCCTCATGTGGCCCCTATGG - Intronic
1060729817 9:126030166-126030188 TGCCCCAGATGTGCCCCCAAAGG - Intergenic
1061062627 9:128258274-128258296 TGCACCCTCTGAGGCCCCAAGGG - Intronic
1186802950 X:13111782-13111804 TGCAACACAAAAGGCCCCAAGGG + Intergenic
1187143113 X:16613573-16613595 TCCACCAAATGTGCCCCCCAGGG + Intronic
1190118785 X:47643653-47643675 TGAAACACATCTGGCCCCAGGGG + Intronic
1190409489 X:50121315-50121337 GCCACCACACCTGGCCCCAAGGG + Intergenic
1196685308 X:118505534-118505556 TGCTCCAGATGATGCCCCAAAGG + Intronic
1198632102 X:138651826-138651848 TCCACCCCATGTGGCCTCACTGG - Intronic
1199545239 X:149001950-149001972 TGACCCCAATGTGGCCCCAAAGG + Intergenic
1199941500 X:152632298-152632320 TGTACCACATGTGGCCACTCTGG + Intergenic