ID: 945427297

View in Genome Browser
Species Human (GRCh38)
Location 2:209722648-209722670
Sequence TTGAACCTTGCATCTTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 206}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945427297 Original CRISPR TTGAACCTTGCATCTTTTGG AGG (reversed) Intronic
901967159 1:12877939-12877961 TTAAAAGTTACATCTTTTGGGGG - Intronic
902452628 1:16507138-16507160 TAGCTCCTTGCATTTTTTGGGGG - Intergenic
902472688 1:16659801-16659823 TAGCTCCTTGCATTTTTTGGGGG - Intergenic
902486116 1:16747642-16747664 TAGCTCCTTGCATTTTTTGGGGG + Intronic
902703963 1:18191742-18191764 TTGAACCTGGCATCTGTTTGGGG + Intronic
903050659 1:20598319-20598341 TTGAACATTGCATCCTCTGGAGG - Intronic
905975930 1:42173467-42173489 GTGCACCTTTCCTCTTTTGGAGG - Intergenic
906590608 1:47021542-47021564 TTTTACCTTGCATCTTTTTTTGG + Intergenic
908890784 1:68845015-68845037 TTGATCCCTACATCTTTTTGAGG - Intergenic
909092485 1:71244039-71244061 TTGAACACTGCATCCTCTGGAGG + Intergenic
912013049 1:104995481-104995503 TTGGACCTTGCATTATTTTGGGG + Intergenic
917012714 1:170492229-170492251 TTGACACTTTCATATTTTGGGGG - Intergenic
917523169 1:175764647-175764669 TTCAACCTTGCCTCTCTGGGAGG + Intergenic
918134608 1:181660584-181660606 TTAAACCTTGCATCTCCTGTTGG + Intronic
918223858 1:182460784-182460806 TTGAAACTTGCAATGTTTGGGGG + Intronic
919286857 1:195574334-195574356 TTTATCCATGCATCTTTTGATGG - Intergenic
1066813827 10:39376285-39376307 TTGAAAGTTGTTTCTTTTGGTGG - Intergenic
1067774983 10:49156960-49156982 CTGAACCTTCCATCTTTTGAAGG - Intronic
1068502178 10:57854243-57854265 TTGAAGGATGCATCATTTGGGGG + Intergenic
1072126590 10:92450926-92450948 CTTAACCTTGCCTATTTTGGGGG - Intergenic
1072483687 10:95833796-95833818 TTGAACTCTGCATCCTCTGGAGG + Intronic
1075599692 10:123758346-123758368 TTGACTCTTGCAGCTTCTGGGGG + Intronic
1076637010 10:131888299-131888321 TTGATCCATTCACCTTTTGGAGG - Intergenic
1078782024 11:14448075-14448097 TTCAACATAGCATCTTTGGGAGG - Intronic
1079142429 11:17820910-17820932 TTGACCCTTCCAGCTTCTGGTGG - Intronic
1080289638 11:30656311-30656333 TTGAAGCTTGGGTTTTTTGGAGG + Intergenic
1082648267 11:55755290-55755312 TTGTACCATGCATCCTTTGAAGG - Intergenic
1083126391 11:60571254-60571276 TGGAACCTTGCGTCTGCTGGTGG + Intergenic
1085615061 11:77991341-77991363 TTTAACTTTGCCTCATTTGGTGG + Intronic
1085658882 11:78343582-78343604 CTGAACCTGGCTTCTTTGGGTGG - Intronic
1085928191 11:81047621-81047643 TTGATCCTTGTATCTTTTAATGG + Intergenic
1088701712 11:112419088-112419110 TTGACCCTTTCTTCTTTAGGAGG + Intergenic
1088761523 11:112933599-112933621 TCAAACCTTATATCTTTTGGTGG + Intergenic
1088766546 11:112986230-112986252 TTGAACCATGCTTGTTTTCGAGG + Intronic
1089401282 11:118166119-118166141 TTGAAACTGGCCTCTGTTGGTGG + Exonic
1092576050 12:9783484-9783506 TTGATCTTTTCAGCTTTTGGGGG + Intergenic
1092576798 12:9793074-9793096 TTGCATCTGGCATTTTTTGGGGG + Intergenic
1092666982 12:10812457-10812479 TAGAACCTTACATCTTTTACAGG + Intergenic
1092991232 12:13902303-13902325 TTGAATCTTACATCGTTTAGGGG + Intronic
1093414341 12:18902897-18902919 TTGAACACTGCATCTTTCAGAGG + Intergenic
1093836259 12:23832836-23832858 TTGAATTTTGCATCATTTGCAGG - Intronic
1095916998 12:47489759-47489781 TTGATTCTTCCAGCTTTTGGAGG + Intergenic
1096550835 12:52370578-52370600 TTGTACCCTGCACCTTTTGAAGG + Intergenic
1097532726 12:60825289-60825311 TTGAAAATTCCATTTTTTGGTGG - Intergenic
1100158979 12:91835355-91835377 TTGAATCTTTCATCTTCTGATGG + Intergenic
1100310309 12:93388912-93388934 TTGAACCTTTCATGCTTTTGAGG - Intronic
1100744445 12:97630115-97630137 TTGCACCTTGCAGCTTTTAAGGG + Intergenic
1102109361 12:110352875-110352897 TTTAACCATGTTTCTTTTGGGGG - Intergenic
1102163887 12:110790836-110790858 TTGGACTTTGCAGCTTCTGGTGG + Intergenic
1103957863 12:124588515-124588537 ATTAACCAAGCATCTTTTGGTGG - Intergenic
1104570196 12:129918305-129918327 TTACACCTTGCAAGTTTTGGGGG - Intergenic
1106468246 13:30031923-30031945 TTGAAACCTGCATCCTCTGGAGG - Intergenic
1107733478 13:43371540-43371562 TTGAAACCTGCATCTTTCTGAGG + Intronic
1110787851 13:79554537-79554559 TTGAACCTTACAGATTTGGGGGG - Exonic
1110831872 13:80041254-80041276 TTAAAGCTTCCCTCTTTTGGGGG + Intergenic
1111517664 13:89356531-89356553 TTGACCATTGAAGCTTTTGGTGG + Intergenic
1112201152 13:97276351-97276373 TTCAACCTGACAACTTTTGGGGG - Exonic
1112207195 13:97336609-97336631 TTGACTCTTCCATCTTCTGGTGG - Intronic
1116028583 14:39543250-39543272 TTGCCTCTTCCATCTTTTGGTGG + Intergenic
1116754664 14:48931848-48931870 TTAAACCTAGGATATTTTGGAGG - Intergenic
1119514435 14:75236893-75236915 TTTAACTGTGCATCTTTTGGGGG + Intergenic
1119579974 14:75769420-75769442 TTTATTCTTTCATCTTTTGGGGG + Intronic
1120185611 14:81390887-81390909 TTGTATCTTGCAGCTTCTGGTGG + Intronic
1121504147 14:94463397-94463419 TTGAACCTTGAATCCTTTCAAGG - Intronic
1121542207 14:94736882-94736904 TAGGACTTTACATCTTTTGGGGG - Intergenic
1123921412 15:25072377-25072399 TTGAACCTTTGATTTGTTGGGGG + Intergenic
1124015761 15:25873756-25873778 TTTATCCTTTCACCTTTTGGAGG - Intergenic
1125071601 15:35561152-35561174 CTGAACTTTGCAGCCTTTGGAGG + Intergenic
1125790867 15:42364889-42364911 TAGATCCCTGCTTCTTTTGGAGG + Intronic
1126513379 15:49505002-49505024 TTTATCCATTCATCTTTTGGTGG - Intronic
1127412127 15:58719904-58719926 TTGAACCTTGCCTCTTTGGTAGG - Intronic
1135159545 16:20081538-20081560 TTGAAACTAACATCTCTTGGTGG + Intergenic
1135231617 16:20713757-20713779 TTGAAATGTGCATATTTTGGGGG + Intronic
1137012304 16:35335093-35335115 GTGAACCTTGCATTTTGTAGAGG - Intergenic
1137864940 16:51884035-51884057 TTTAACCATTCATCATTTGGTGG + Intergenic
1139127741 16:64100362-64100384 TTGAAATTGGCATGTTTTGGAGG + Intergenic
1139621826 16:68151468-68151490 CTTAAAATTGCATCTTTTGGGGG + Intronic
1142052241 16:87966280-87966302 CTGAGCCCTGCATCTCTTGGTGG + Intronic
1146044326 17:29490834-29490856 TTTAACTCTGCATCCTTTGGAGG + Intronic
1147613021 17:41812593-41812615 ATGAACCTTGCTTCTTTCGCGGG - Exonic
1147943324 17:44065946-44065968 TTGGTCCTTGCCTGTTTTGGGGG - Intronic
1149090556 17:52773170-52773192 TCAAACCTTGCATCATTTGAAGG - Intergenic
1149165960 17:53752277-53752299 TTGACCCTTGAACATTTTGGGGG - Intergenic
1149355066 17:55831146-55831168 TTCACCCTTGCTGCTTTTGGAGG - Intronic
1152294978 17:79461889-79461911 TTGCCCCTTGCACCTTCTGGGGG - Intronic
1153207732 18:2720978-2721000 ATAAACCTTCCATCTTTTGCTGG + Intronic
1153992613 18:10413759-10413781 TTGAGCCTTGCCTCTTTTAGAGG + Intergenic
1155841077 18:30643463-30643485 TTGCAACTAGTATCTTTTGGGGG - Intergenic
1156524680 18:37755758-37755780 TTGGCTCTTGCTTCTTTTGGAGG + Intergenic
1157600176 18:48888853-48888875 TTGAACACTGCATCATCTGGAGG + Intergenic
1158432796 18:57405176-57405198 TTGCAGCTGGCATATTTTGGTGG - Intergenic
1158687973 18:59632039-59632061 TTGAACCTTAAAGCTTTTGCAGG - Intronic
1159650565 18:70972565-70972587 TTTATCCATTCATCTTTTGGCGG - Intergenic
1161888662 19:7017753-7017775 TTGAACCTTGAACATCTTGGGGG + Intergenic
1164602850 19:29575261-29575283 TTGAAGCTTACATTTTTTGGGGG - Intergenic
1202705081 1_KI270713v1_random:16621-16643 TAGCTCCTTGCATTTTTTGGGGG - Intergenic
925404034 2:3594488-3594510 CCGAATCTTGCATGTTTTGGGGG - Intergenic
926558326 2:14386717-14386739 TATATCCTTGCTTCTTTTGGAGG - Intergenic
926746349 2:16161516-16161538 TTGCCCCTTCCAGCTTTTGGTGG - Intergenic
929934285 2:46282971-46282993 TGGAAACTTGCAGGTTTTGGAGG + Intergenic
930334628 2:50029428-50029450 TTGAAGATAGCATCTTTAGGAGG + Intronic
930912308 2:56643909-56643931 TTGCCCTTTCCATCTTTTGGTGG - Intergenic
941094234 2:161217537-161217559 CTGAACTTTGCATATATTGGAGG - Intronic
941373881 2:164703627-164703649 TTGAATCTTTCATCTTTAAGTGG - Intronic
942313018 2:174673062-174673084 TAAAAACTTGCATCTTTTTGAGG - Intronic
943471298 2:188296875-188296897 TAGAAACTTCCATATTTTGGGGG + Intronic
945427297 2:209722648-209722670 TTGAACCTTGCATCTTTTGGAGG - Intronic
1169003655 20:2188945-2188967 TTAAACAATGGATCTTTTGGTGG - Intergenic
1169574588 20:6943926-6943948 TTTATCTTTGCAGCTTTTGGTGG + Intergenic
1172928003 20:38558269-38558291 TTGCTCCTTTCTTCTTTTGGTGG + Intronic
1174197507 20:48783999-48784021 TAAAACCCTGCATCTTTTGCAGG - Intronic
1174335506 20:49857035-49857057 TTGAACTCTGCATTTTATGGTGG + Intronic
1177955908 21:27598899-27598921 TGGAACCTGACATTTTTTGGTGG - Intergenic
1178669660 21:34579400-34579422 TTTAACATTGCATTTTTGGGGGG - Intronic
1179137038 21:38688595-38688617 TAGACCCCTACATCTTTTGGAGG - Intergenic
1179570880 21:42278373-42278395 TTTAACATATCATCTTTTGGGGG - Intronic
1181879184 22:25964134-25964156 TTGAAGCATGCAGCTTTGGGAGG + Intronic
949145044 3:690374-690396 TTGAAACTTTGGTCTTTTGGGGG - Intergenic
949422846 3:3884594-3884616 TTGAATGCTGCATCCTTTGGAGG - Intronic
949957119 3:9278266-9278288 TTGACCCGTGCATATCTTGGAGG - Intronic
951736207 3:25867657-25867679 TTGATTCTTGTCTCTTTTGGAGG + Intronic
952005910 3:28842063-28842085 TTGAACGCTGCCTCTTCTGGAGG + Intergenic
953445046 3:42956283-42956305 TTGAACGCTGCATCCTCTGGAGG + Intronic
954442561 3:50529887-50529909 TTGGGCCTTGAATCTTGTGGAGG - Intergenic
954814105 3:53266957-53266979 TTTATCCTTTCATCCTTTGGTGG - Intergenic
957749035 3:84388374-84388396 TTGAACTCTTCATTTTTTGGAGG + Intergenic
958793304 3:98678452-98678474 TAGAACATTGTATCTTCTGGTGG + Intergenic
959782528 3:110253386-110253408 TTTATCCCTTCATCTTTTGGTGG - Intergenic
960260295 3:115560250-115560272 TGGAAGCCTGCATCTTTTGGGGG + Intergenic
960748508 3:120918039-120918061 TTGACTCTTGCAGCTTTTAGAGG + Intronic
963237925 3:142973846-142973868 TTGAACCTGGCAGCTCCTGGAGG + Intronic
963348673 3:144126472-144126494 TTGACTCTTTCAGCTTTTGGTGG + Intergenic
963361939 3:144285298-144285320 TTTATCCATGCATCTGTTGGTGG + Intergenic
963533672 3:146501761-146501783 TTGAACCCTGCATAATCTGGAGG + Intergenic
964674721 3:159265240-159265262 TTCATCCTTACATCTCTTGGAGG + Exonic
965498690 3:169431148-169431170 TTCAACCTTGCTTCTTTCAGAGG - Intronic
966616493 3:181919065-181919087 TTGAATCTTGCAGTTTATGGTGG + Intergenic
967531761 3:190555702-190555724 ATGAAGCTTGCAATTTTTGGAGG - Intronic
968973405 4:3808760-3808782 ATGAACCTGCCATCATTTGGGGG - Intergenic
969967280 4:11010222-11010244 TTGCACTTTGCATCTCTAGGAGG + Intergenic
969970354 4:11040582-11040604 TTGAACGCTGCAACTTCTGGAGG + Intergenic
970275430 4:14394643-14394665 TTCAACTTTGAATATTTTGGAGG + Intergenic
971002660 4:22340024-22340046 TTGACCCTTGAATAATTTGGTGG + Intergenic
973215245 4:47660933-47660955 TTTAACCATTCATCTTTTGATGG - Intronic
977760759 4:100733886-100733908 TTGCAACTTGTATCTTTTCGTGG - Intronic
977954400 4:103010658-103010680 TTGAATGCTGCATCTTCTGGAGG + Intronic
978005432 4:103610002-103610024 TTTAACCATGCATCTCTTGGTGG + Intronic
978509802 4:109503949-109503971 TAGAAACTTGGGTCTTTTGGGGG + Intronic
979516030 4:121611330-121611352 TAGGACCTTGCTACTTTTGGGGG + Intergenic
981217284 4:142185259-142185281 CTCAAACTTGCTTCTTTTGGGGG - Intronic
981455675 4:144950935-144950957 TTGAGCCTTGCATATTTGGTTGG - Intergenic
981546207 4:145896493-145896515 TTGTACCTGGCATTGTTTGGGGG - Intronic
982165191 4:152607813-152607835 TTGAAGCTGGGATCTTTGGGAGG + Intergenic
983290081 4:165790804-165790826 TTAAATCTTACATCTTTTTGAGG + Intergenic
984177700 4:176439568-176439590 TGGTACCTTACATTTTTTGGGGG + Intergenic
984473791 4:180212271-180212293 TGGCACCTTACATTTTTTGGGGG - Intergenic
985075117 4:186206480-186206502 TTTCACCTTGCAGCTATTGGGGG - Intronic
986634093 5:9802529-9802551 TTGGACCTATGATCTTTTGGGGG - Intergenic
986772007 5:10982754-10982776 TTTAACCATTCATCTGTTGGTGG - Intronic
988795376 5:34648657-34648679 TTGATCCCTGAGTCTTTTGGTGG + Intergenic
989082148 5:37634471-37634493 TCTAACCTTACCTCTTTTGGTGG + Intronic
989260278 5:39411962-39411984 TAGAACTTTGCTTATTTTGGAGG - Intronic
991254624 5:64600597-64600619 TTGAACCTTGGATCTATCTGGGG + Intronic
992732452 5:79686843-79686865 TTGAGCTTTTCATATTTTGGGGG + Intergenic
994561987 5:101386250-101386272 TTGAACATTGCTTCTCTTGGGGG - Intergenic
997053729 5:130414501-130414523 TTGAACCTGATTTCTTTTGGTGG + Intergenic
997989369 5:138531300-138531322 TTGAACGCTGCATCCTTTGTTGG - Intronic
1001869938 5:175144028-175144050 TTGACCCTTGCATTTTTTTGGGG - Intergenic
1007446006 6:41906780-41906802 TTGGACCTTGCCTCCTTTAGGGG - Exonic
1010599623 6:77807923-77807945 TCGACCATTGCATCTTTTTGAGG + Intronic
1011995681 6:93584558-93584580 TTGAACACTGCATCATCTGGAGG - Intergenic
1012544282 6:100399208-100399230 TTTAACCATTCATCTTTTGAAGG - Intronic
1015229801 6:130901507-130901529 TTAATCCTTACATCTTTTGAGGG - Intronic
1016609776 6:145975307-145975329 TTGAAACTTTCATCTTTGGATGG + Intergenic
1016787933 6:148033781-148033803 TTTAACCATTCATCTGTTGGTGG - Intergenic
1016973167 6:149784092-149784114 ATGAACCTTGAATATATTGGGGG + Intronic
1022248728 7:28586001-28586023 TAGAACTTTGCATCTTTTTTTGG + Intronic
1022499121 7:30871594-30871616 TTTCACCTTGCATCTTTTGAAGG + Intronic
1023392982 7:39728370-39728392 TTGAACACAGAATCTTTTGGGGG + Intergenic
1026884697 7:73933206-73933228 TTGAACCTATCATATTTTTGAGG - Intergenic
1027600036 7:80228545-80228567 TTGAACCTTTCATCTTTAATAGG - Intergenic
1028082476 7:86595433-86595455 TTAAAACATGCATCTTTTTGAGG - Intergenic
1028191732 7:87861266-87861288 TTGAACCAGGGTTCTTTTGGTGG - Intronic
1028532192 7:91850387-91850409 TTGAACTTTGCTTATTTTGAGGG + Intronic
1030884859 7:114923767-114923789 TTGAACCTTTCTTCTCTTGAAGG + Intronic
1031608466 7:123796691-123796713 TTGATCCATTCATCTGTTGGTGG - Intergenic
1032009961 7:128339188-128339210 ATGAACATTGCATGTTTTGAAGG - Intronic
1032904285 7:136346857-136346879 TTGGACCTTCCCTATTTTGGAGG - Intergenic
1033741571 7:144279870-144279892 TTGAACCTTCCTTCTCTTTGAGG - Intergenic
1033752331 7:144369744-144369766 TTGAACCTTCCTTCTCTTTGAGG + Intronic
1034975003 7:155443133-155443155 TTGTCCCTTCCAGCTTTTGGTGG - Intergenic
1036485340 8:9174056-9174078 GGAAACCTTGCATCTTCTGGTGG + Intergenic
1036912586 8:12769647-12769669 TTGAACCTTACATTTTTTGAAGG + Intergenic
1036913408 8:12780032-12780054 TTTATCCTTTCATCTTTTGACGG + Intergenic
1038939912 8:32293145-32293167 TTTAACCTGATATCTTTTGGGGG - Intronic
1039196056 8:35032991-35033013 TTGCACCTTGCAGCTTTTGGTGG - Intergenic
1039224436 8:35372447-35372469 ATTAACCTTGTATATTTTGGGGG + Intronic
1039621359 8:38999816-38999838 TTAGAGCTTGCATCTTTTGGGGG - Intronic
1041152988 8:54955614-54955636 TTGAAGCTTTCAGCATTTGGGGG - Intergenic
1042099021 8:65253735-65253757 TGGTACCTATCATCTTTTGGGGG - Intergenic
1043132884 8:76483438-76483460 TTCAATGTTGCCTCTTTTGGAGG - Intergenic
1044025321 8:87163009-87163031 TTGAAAGCTACATCTTTTGGAGG - Intronic
1044924334 8:97197164-97197186 TTGAAGCCTGCTGCTTTTGGAGG - Intergenic
1046058384 8:109106334-109106356 CTGAGCTTTGTATCTTTTGGAGG + Intronic
1047550888 8:125871175-125871197 TTGAACCCTGCATTTTTCTGAGG + Intergenic
1047662116 8:127048560-127048582 TGGAAACTTTCATCTCTTGGAGG + Intergenic
1047758960 8:127939968-127939990 CTGAACCCTGCATTTTGTGGAGG + Intergenic
1049490830 8:142900808-142900830 TTGAACATTGCATCGTCTGGAGG - Intronic
1050884705 9:10749808-10749830 TTCAGCCTAGCATCTTTTGAGGG - Intergenic
1052623062 9:30939167-30939189 TTTAACCTTCCATTTTTTGGGGG + Intergenic
1056736481 9:89214466-89214488 TTCTATCTTGCATTTTTTGGGGG - Intergenic
1057368234 9:94444470-94444492 TTGAACATTTTATCATTTGGTGG - Intronic
1058833704 9:108841905-108841927 ATGAACCATGCAACTTTTTGGGG - Intergenic
1059510953 9:114846259-114846281 TTGAAACTTACTTCTTTTGATGG - Intergenic
1060189177 9:121581409-121581431 TTGCACCTTGCATCTTCAGGAGG + Intronic
1060430888 9:123550821-123550843 TAGAAGATTGCAACTTTTGGAGG - Intronic
1186269437 X:7869040-7869062 TTTATCCTTACATCTATTGGTGG + Intergenic
1191105456 X:56769402-56769424 TTGAGCCTTGAGTATTTTGGGGG + Intergenic
1191106449 X:56774804-56774826 TTGAGCCTTGAGTATTTTGGGGG + Intergenic
1191107442 X:56780206-56780228 TTGAGCCTTGAGTATTTTGGGGG + Intergenic
1196002317 X:110798809-110798831 TTAAACCATTCATCTATTGGAGG + Intergenic
1196201669 X:112893195-112893217 CTGTACTTTGAATCTTTTGGGGG + Intergenic
1197787799 X:130217204-130217226 TTTATCCTTTCATCTATTGGTGG - Intronic
1200796575 Y:7346352-7346374 TTGAACCCGGAAACTTTTGGTGG + Intergenic
1201351121 Y:13042340-13042362 TTGAATCTTCAATCTGTTGGGGG - Intergenic