ID: 945436043

View in Genome Browser
Species Human (GRCh38)
Location 2:209818408-209818430
Sequence CTCTGGGTATAATCCAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 77}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945436043 Original CRISPR CTCTGGGTATAATCCAAGAC AGG Intronic
900716884 1:4150711-4150733 CTCTGGTCAGAATCCAAGGCTGG - Intergenic
903275628 1:22219528-22219550 GTCTGGGTACAAACCAAGCCTGG - Intergenic
908819783 1:68073396-68073418 CTCTGGGTATATACCAATAATGG + Intergenic
918325115 1:183402791-183402813 CTCTGGGGATAATTCAAAAAGGG + Intronic
921686312 1:218093087-218093109 TTCTGGATAGAGTCCAAGACGGG + Intergenic
923761485 1:236849269-236849291 CACTGGGGATAAAGCAAGACTGG + Intronic
924141144 1:241024807-241024829 ATCTGGGTACAATACAAAACAGG - Intronic
1064172795 10:13048864-13048886 CTCTAGGTATGATGAAAGACAGG - Intronic
1064830224 10:19456002-19456024 CTCAGGGTAGAATCCAATAATGG + Intronic
1069061111 10:63895339-63895361 CTCTGAGTAAATTCCAAGCCGGG + Intergenic
1081108878 11:39107094-39107116 CTCTGGGTATTATCCATTATGGG + Intergenic
1091707896 12:2712078-2712100 CTGAGGGTATAATAAAAGACTGG + Intergenic
1093229945 12:16531790-16531812 CTGTGGGTAAATGCCAAGACTGG + Intronic
1093347835 12:18061857-18061879 TTTTGTGTATAATGCAAGACAGG - Intergenic
1094266783 12:28568629-28568651 CTCTGGGTATAATTGCATACTGG + Intronic
1094437005 12:30431668-30431690 ATATGTGTATAATCCAAGACAGG - Intergenic
1096711991 12:53464386-53464408 CTGTGGGAACAATCCATGACAGG - Intronic
1101834954 12:108288614-108288636 CTCTGGGAATTATCTAAGGCTGG + Exonic
1103409050 12:120697753-120697775 CTCTAGGCATAAACCAAAACTGG - Exonic
1106161756 13:27207487-27207509 CTCTGGGGAAGCTCCAAGACAGG - Intergenic
1107466749 13:40658118-40658140 CTCTGGGTAGGAGCCAAGATTGG + Intronic
1110558858 13:76888481-76888503 CCCTGCTTATAATCCAAGGCTGG + Intergenic
1113456817 13:110455218-110455240 CTCGGGGTAAAAGCCAAGTCCGG + Intronic
1120277920 14:82400875-82400897 CTCTGGGTATAACCCAGTAAGGG - Intergenic
1126369576 15:47932026-47932048 CTCTGTGTATAATGCAAAACAGG + Intergenic
1126547402 15:49888193-49888215 CTCTGGGGAAAGTCCAGGACTGG - Intronic
1126709350 15:51440591-51440613 CACTGGGTATCCTCCAAGGCCGG + Intergenic
1135166498 16:20143604-20143626 CTTTGGATATAATGCAAGATGGG - Intergenic
1137707090 16:50543168-50543190 GTCTGGGAATAGTCAAAGACTGG + Intergenic
1138371624 16:56531479-56531501 TTCTGGGTACAATCCTGGACTGG + Intergenic
1140353175 16:74282006-74282028 CTCTGGGTTTCATCCAAGATAGG + Intergenic
1141681555 16:85547161-85547183 CTCTGGGCATTGTCCAAGTCTGG - Intergenic
1143046182 17:4081702-4081724 CTCAGGGTCTCATCCAGGACTGG - Intronic
1143336792 17:6177574-6177596 CACTGTGTGGAATCCAAGACTGG - Intergenic
1143336797 17:6177619-6177641 CACTGTGTGGAATCCAAGACTGG - Intergenic
1153132021 18:1865348-1865370 TTCTGGGCATAGTCCACGACTGG + Intergenic
1155653437 18:28168875-28168897 CTCTGGGTATTATACAAAAAGGG + Intronic
1156145756 18:34175282-34175304 CACTGGGTGAAATCCAAGTCAGG - Intronic
1157932022 18:51833660-51833682 CTTTGGAAATAATCCAAGTCAGG + Intergenic
1158262899 18:55628535-55628557 TTCTGTGTATAATGAAAGACAGG - Intronic
1159197147 18:65132355-65132377 CTATTGGTATAATCTAGGACAGG - Intergenic
1164775772 19:30852458-30852480 CTCTGGGGATGACCAAAGACTGG + Intergenic
1165308895 19:35018956-35018978 CTCAGGGCAGAAGCCAAGACGGG + Intronic
926173045 2:10565599-10565621 CTCTGGCTTTAATACAAGAGGGG - Intergenic
926381278 2:12292568-12292590 CTTTGGGTATAACCCAATAACGG - Intergenic
928932129 2:36635818-36635840 CTCTGGGTAAGATGGAAGACTGG + Intronic
931479711 2:62629405-62629427 CTCTGGGTATAATCCTTGCTGGG + Intergenic
937455060 2:122034057-122034079 CTCTAAGTAAACTCCAAGACTGG + Intergenic
939613472 2:144336654-144336676 CTCTCTGGATCATCCAAGACTGG - Intergenic
941464834 2:165813700-165813722 ATCAGGGTTTGATCCAAGACTGG - Intergenic
944973920 2:205025723-205025745 CTCTGGGTTTAATACCAGCCCGG + Intronic
945161014 2:206890521-206890543 CTTTTGGTATAATCCTAAACTGG + Intergenic
945436043 2:209818408-209818430 CTCTGGGTATAATCCAAGACAGG + Intronic
946152214 2:217784119-217784141 CTTTGGGTATAATCCTAGTAAGG - Intergenic
1174770336 20:53293547-53293569 CTCTGGACAACATCCAAGACTGG - Intronic
1179255727 21:39713614-39713636 CTCTGGGTCTCATGCAAAACTGG + Intergenic
950200139 3:11036808-11036830 CTCTGGGGAAAATCCCAGCCTGG - Intronic
962150243 3:132885149-132885171 CTCTGGGTATAATAGAAGTCAGG - Intergenic
963782022 3:149495914-149495936 CTCTGGGTGTCATCAAAGCCAGG + Intronic
970097881 4:12486126-12486148 CTCTGGGTCTGACCCAATACAGG - Intergenic
976584204 4:86776928-86776950 CTCTGGGAATGAGCCAGGACTGG - Intronic
977081137 4:92529660-92529682 CTCAGGGTAAAATCCAAGCCAGG - Intronic
981214801 4:142151557-142151579 GTCTGGGAAAAATCCAAGCCAGG - Intronic
981359836 4:143833487-143833509 CCCTAGATATAATCCAACACAGG + Intergenic
981370602 4:143954566-143954588 CACTAGATATAATCCAACACAGG + Intergenic
983519512 4:168692347-168692369 CTCTGCTTATAATTCATGACAGG - Intronic
983902230 4:173147750-173147772 ATCTGGGTATAATGCAAAATAGG + Intergenic
987669558 5:20989698-20989720 CTCTGAGTTTAATGCAAGAAAGG + Intergenic
988367710 5:30322678-30322700 CTCTGTGTATAATACAATGCAGG + Intergenic
989751395 5:44898561-44898583 CTGTGTGTATAATGGAAGACAGG - Intergenic
993984374 5:94580195-94580217 CTCTGGTTTTAATCAATGACTGG - Intronic
994263544 5:97687672-97687694 CTCTGGGTATATACCAATAATGG - Intergenic
1000931962 5:167262699-167262721 TTCAGAGTATAATGCAAGACTGG + Intergenic
1009782846 6:68292902-68292924 CTCTGGGCCTAATTCAACACTGG - Intergenic
1010891181 6:81312737-81312759 CTCTGGGTATCATAGAAGACAGG + Intergenic
1017457922 6:154619392-154619414 CTGTGGTTGTAGTCCAAGACTGG - Intergenic
1021751892 7:23809130-23809152 CTCTAGCTATAATACAACACAGG - Intronic
1022973976 7:35540299-35540321 CTGAGGGAAGAATCCAAGACAGG + Intergenic
1024454539 7:49588487-49588509 CTATGGTTATAAGTCAAGACAGG - Intergenic
1025286949 7:57671257-57671279 CTCTCGGTGCAATTCAAGACAGG - Intergenic
1040726600 8:50388123-50388145 ATAAGGGTATAATCTAAGACAGG + Intronic
1055278086 9:74642209-74642231 CTGTGGGCATAAACCAGGACAGG + Intronic
1059385352 9:113960016-113960038 CTCTGCACATAATCTAAGACTGG + Intronic
1191259632 X:58301894-58301916 CTTTTGGTATAATCTAAGATTGG + Intergenic